Erinaceus_europaeus Locus EIF4A1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus EIF4A1
Erinaceus_europaeus
EIF4A1
GeneScaffold_5841
SNORA67
5915..6055
6870
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCGGGGTCGGGCGCCCTATAA
GTTGTCGATAGGCGGGCACTCCGCCCTAGTTTCTAAGGAACATGTCTGCGAGTCAGGATT
CCCGGTAAGAAAGGCAATGGAAGAGGTTGGGGGTACTTACCCTTCCGCTCCCCTCTGGGA
GCCCTGCCGGCGGCAGCTGAGGCCCGGGGCTGTAGGCCTACGAGGGTTGAGGGGAGAGCC
AGGCGGGAGCAGCCGTCCTGGGCGAGTGGGGGACAGATCCGCGGCCGGTTCTGTCGCCGG
GGCCTAGGCAGGAGGCAAGGACAGCCCGGCGGTCGGGGCCTAGCTTGCGAGGCTCGTCGG
GCCGCGATCCGACGCGGGGCGCGGAGCCCCAGCTGAGTGGCGAGACGAGGTCGCGAACTC
GCTCGGGACGTGAAGGTAGTGGCGGCCGCGACAGCATGGCCGAGGGCCTGCAGGCCCGCT
TTTCTCCGGCGGAGGGAGGGTCGAGCGCGCCCCGCATTCGGAGGGTTCTGGCGGTACCAC
ACGCCGGGGGCGGGGGTGCCTCGTCCCCCGACCCCGTCGCTCCGTCGCGTTGGCCTACGG
GTCGGGGGAGAAGCGGCCGGCGGCGCGGTCTGCTGCCTTTTGTGACGGCCGGGGGCTGAG
CCTAACCCCGAGCAGCGGCCGCGTGAGACACCGGGAGCCGTCCCGGCGGCGGCGGCGGGC
GGGCAGGTCCATTTTGCCGCACAAGCCGGTCAGTTGGCAAGCTGCGGATGGCAGGGTCCA
CTTTACTTCGGGGGTGAGCGGCCTGAGGTAGGGGGGGATGACGCCATTTCGCGGTGGGGG
CGGACGGCATGTGGATTGTCCCATAAAGCGGGGGAGACTGACCGGGTGGTCGAGGGAGCG
AGCACATGGCGGTCTGGGGTGCTCCCCTCCCCCAGTGCGCTCCCCTTGTATAAGTGTTGT
GCAATCTCCTCAGCTCGCTCGGCTGGGGCTCATTGTGCGCGAGGCCGCCACCGCCCGCGG
CCTCCCACATCCGGGCATCGGGGGAGGGGGGTCGGCTTGAGGGGTGGGGGAGGGCGCTGG
CGGAATGACGTGGGGGAAGGGGATGTCCTACCCTCGGTTCCCGGAGGTGAGGGGCGGGAC
TTCCGGCGCACTGGGCCGTGGTGGGAGGTGCGAGCGCGAGGGCTCAGCGGCCTGGCTTCG
GACACGTGGGCCTGGTTGGTCCCCGCCGCCGAAAGAACTGGCTTCAGCCCCCGAGCCTTC
ACGCGATTTGGGCGTAGTCTCAAGGGCGCCCGCACAAGAGCCGCGGCCCGATGGGTCGAA
ATAACTATTTTGTAGGGGCACTGAAGGAAATTCGGTCACTAGTAAAGTCCGATGGCATGC
AAGATAGGCTGCTGATGGGAAGAAACAGACTGTCAGAATTTATAATGTACCTCAACATGC
TCCTTTTGAATCAACAGATCCAGAGACAATGGCCCCGATGGGATGGAGCCCGAAGGTGTC
ATCGAGGTAAGATTAGACCCCTGTCACAATTGTGCTACTTGCTGAGAGTTGTCTAATCCT
CAAGCTATTAAAGTCAGAATGTAGGCTTAGTGTAAAGGAGAAAATTTTACAAGTGACTGA
CTCATGATAGGTTCCCTGACCAACTAGCATGCCTGGAGGGGTAGACATTAAGAATTTTAA
CGTTATTGATTTCTTTGCATCCTAACAGAGTAACTGGAATGAGATTGTGGACAGCTTTGA
TGATATGAATCTCTCTGAATCCCTTCTCCGTGGTATCTATGCCTATGGTTTTGAGAAGCC
GTCTGCCATCCAGCAGCGAGCCATTCTTCCTTGTATCAAGGGTGAGATTGATTCCTCAAC
CCCAAAACAGATTTTGGACTAACATCGTAGGTGGTGGCATCTACCTGGTGGTGTCCATCT
CGTATCAGCTAGATAGATATAAAGTAATCCTTTATTTATCCCACCTTGGCTTTAGGCATT
TGTCCATTTCTGGTTCGTGCTTTGGATATATGTTACTGGTCAGGGTTCCTTTTATTGTCT
CTATTTAGAGTATAGCACTTTTATTCCAACTATTGGTAGGTGGGGGCCTCAAGTATAAGT
CATTTGTTACCACTGTGATAATCTGCCGGTGAAAAGTTTGGTTTTATATTACTATTTGCT
ATTGTTAAAATCTGCCCTCTGCAACATCAAATTTCTCTGTTTAGGTTACGATGTGATCGC
TCAAGCCCAATCTGGGACTGGGAAAACAGCTACTTTTGCCATATCAATTCTGCAGCAGAT
AGAATTGGACTTAAAGGCCACCCAGGCCTTGGTGCTAGCACCCACAAGAGAATTGGCTCA
ACAGGTGAGTGGGGCTTCTAGATTTGTAAATTGATTAGACTTGTTCCCCAACCATACATC
TTGCAAGAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAAACCCATGCACTACAGGTACACCAGA
TTCCTGATAGAGGAAGTAGGGATCTTAAATCTGCTTTTCATATGAAAACTGAATTTAGTA
ATAGTGGTATTTTATTTGCAAGTATATACTTAAAGCATTTTAAATTGGGTCTTCACAGTG
CTAGCTGTTAAGAGCATTTACCTTTCTCTGAGTTCAGATACAGAAGGTGGTCATGGCATT
AGGAGATTACATGGGTGCTTCCTGCCATGCCTGCATTGGTGGTACCAATGTCCGTGCAGA
AGTGCAGAAATTGCAGATGGAAGCTCCTCATATCATCGTCGGTACTCCAGGCCGTGTATT
TGATATGCTTAACCGTAGATACTTGTGTGAGTATCTCTGTTCTCTGCATGCTTTCTCAGT
CATTCCGACTTTTCCCGTCTTGCTTTCAGTGAGAAGTAATAAAGAGCTGCTCTGTGATGA
ACACCATGCGTGTCATCTGAGCCAGGCTTCCTGAGGTCTAAGCCCAGGTGGTGTTCTACT
TCCTGGTGTTTAGCATGGGGCCCCAGGCAAAGGATCAGTCTTTGTGTTCTGAGCGCAGAC
TAGTTATCCTTTCTTTGTTGGCTGTATTTCACATTCCCCTAATTAATAGCCCATTGGCAT
TCTTGCTAGCTCCCAAATACATCAAGATGTTCGTGTTGGATGAAGCTGATGAAATGTTAA
GCCGAGGATTCAAGGACCAGATTTATGACATATTCCAGAAGCTCAATAGCAATACCCAGG
TGAGACATTTTAGGTTTTTACTTGTGTGGTAGATTTAATAACTTTGGATTCCGTTGGTGT
GATAGAATACCAGGTAAAGAGTTATTTTTGCTATTTAAAGCTTTTACTCTCAATCCCATG
AATTCTATTTATAATAGTTACCACTGCAATGTTTTTACATGCAAAGAAATTTTTTTCATG
CCACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGCCCCAGCCTGCTGTGTACCTCCCAGCTTTTAAGTGTGATTGAAGGA
GATATTTCCTATCCTACCTTGAATGGATCTTTCTGTTAGGTGGTGTTGCTGTCAGCTACC
ATGCCTTCTGACGTGCTTGAGGTGACCAAGAAGTTCATGAGGGACCCCATTCGGATTCTG
GTCAAGAAAGAAGAGCTGACTCTGGAGGGTATCCGCCAATTCTACATCAATGTGGAACGA
GAGGTGGGGCCCAGTGCAGGAGGCGGCTCTACTGGCGGGTTCTTGGGTGTTACCCCTGAC
TTGACTTCAAATTTCCCACCTCCAGGAGTGGAAGCTTGACACACTCTGTGACTTGTACGA
AACCTTGACCATCACACAGGCCGTGATCTTTATCAACACCCGAAGGAAGGTTGATTGGCT
AACTGAGAAGATGCACGCCCGAGACTTCACTGTCTCTGCCATGGTGAATTTCCCACCTTG
TTATTAGCAGTATGTGGCAGCATCTCCATCTGACCCAGTTCTCAGAACCCACATGCCTGC
CCATCTTATATCCTGTCGTTCTCTTCTAGCATGGGGACATGGACCAAAAGGAAAGAGATG
TGATCATGAGGGAGTTCCGCTCTGGCTCTAGCCGAGTATTGATCACCACTGATTTGTTGG
TGAGTTGGGAACTTGGGTAACACTAGGAAGGGAGAACCCAAGCTGATTCCCTCTTCCAAG
GGGCTATTGGTGCCCCTCTTCAGGAAAGTAGCAACTTGGAATAATAAAATCTGGCATGCT
TCAGGACTCCGGAGAAGAGAGGCTGCTGCTTTTCCTTCCTTTGGCTGCCAACATGTTTAT
TTGTCCTTTCTGGGGGTAGTTGCTTCTGTTACATGCTGACATCTTCCATTTTTATCACCA
TAGGCCCGAGGCATTGATGTGCAGCAGGTTTCTTTAGTCATCAACTATGATCTTCCCACC
AACAGGGAAAACTACATTCACAGGTCAGTGGGATCTGTAATATTCATCATTCCCAATCCC
TCCCTGAACTGTAACTTCTAGTTTTTGCCCATATTCTTAAATTCACTTGATGCATTGTTT
TCTAGAATCGGTCGTGGTGGACGTTTTGGCCGTAAGGGAGTGGCTATCAATATGGTGACA
GAAGAAGACAAGAGGACTCTTCGAGACATTGAGACCTTCTACAACACCTCCATCGAGGAG
ATGCCTCTCAATGTTGCTGACCTCATCTAAGAGGGGCTGTCCTGCTACCTAGCTCCAGCC
AGGGTCCAAACCTTGAGGGGCTCAGAAGGAGCAGGAGGGGGGAGGGAAGGGAGCCAAGGG
ATGGACATCTTGTCATTTTTTTCCTTTTTTTTTTCTTTGAATAAATGTCACTTTTTGAGG
CAAAGAAGGAAACCGTGAACATTTTAGACACCCTTTTCTTTGGGGTAGGCTCTTGCCCCA
GGCGCCGTCTCCTCCCAAAAACACTAATCCACTTCCCTAACCTAACCAGAGGCTCTCCCA
CCCCAGCTGAATTCCTCTGAAAATGTGTGGCTATATAATGTCACTCAACCTCATTTGCTG
GACCAAATCTGGAGGGAAAACCCTTAGGTGGCCCAGGGGACTGTACTCAGGTGGGGGGGG
GAGCAGGGAGAAAAATGGTAGCCATTTTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 2357..2405, 2608..2740, 3104..3243, 4357..4525, 4809..4918, 5319..5462, 5545..5682, 5789..5878, 6123..6202, 6305..6447, 6450..6451
1001..1023, 2357..2405, 2608..2740, 3104..3243, 4357..4525, 4809..4918, 5319..5462, 5545..5682, 5789..5878, 6123..6202, 6305..6446
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved