Erinaceus_europaeus Locus TOR1AIP2
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus TOR1AIP2
Erinaceus_europaeus
TOR1AIP2
GeneScaffold_4611
SNORA11
3784..3911
12573
CTTTTTCAGTGCTTGCATATGGTAGTGCTAGGAACTGAACCTGGGACTTTTGAATGCAA
GTCTGGTATACTTTTGCTTTCCTACTTCCATGCCTCACATTTTGGTCATCTGATTTTTTC
CCATTCTCTCAACTACAGTGGGTAGAACATATTAGGTGACTATGGCATCTGTGCCGGATT
AATAATTTGATATGTTTTTCTTTTTTTTTTTTTCTATTTTTTCTATTTATTTTCCTTTTT
GTTGCCCTGGTTGTTATTGTTGTAGTTATTGTTGTTGTTATTGATGTTATCATTGTTAGA
TAGGACAGAGAGAAATCAAGACAGGAGGGGAAGACAGTGAAGGGGGGAGAAAGATAGACA
CCTGCAGACCACCTATGAAGCGACTCCCCTACAGATGGGGAGCTAGGGGCTCGAACCAGT
ATCCTTATGCTGGTCCTTGTGCTTGGCACCACATGCGCTTAACTGGCTGCACTACCGCGC
GACTCCCGGATGTGTTTTTCTTTTTGTAGTCTGGGATTTGGATGATGATCTTCATGAAAG
CCAGAAAACTTTTCTTTACTAGAAAAGATCCAAAGAGAGGGGCAGAGGTAGATAGCATAA
TGGTTATGCAAAGAGACTCTTATGCCTGAGGCTCCGAAGTCCCAGGTTCAATCTCCCGAA
TCACCATAAGCCAGAGCTTATGTCTTTCTCTCTCAAAAATAAAATAAATAAAATACTTAA
AAATAAAAAGATCCAAAGAGGAATTACTAAAATAGATTTAACATATAAAGATGAAATTGG
CATTTCTCTCTTGTGTGGATAAAAAGTCATTTAATATTTTTCATTTTATTTTAGTCACTG
TATTTATGCCTTATTTCCTGGGTCCACGGGAGGCATGAGCCTGTTGGGACTTGGAACAAG
GAGAAAGCAAGACATCTCCACAAGGAACACCAGACACTAACAAAAAAATCTTCCCAAGTG
TGACAAACTAGAGCACAGACATGAGCGACAAGAGCACAGCCATGAACGACAGAGGACTTA
GAGATCCTGCAGAGGGTAAGGTAGTCTGTGCAGCACTGAAGTTTGTGCTGTATAAAGTAG
AGCTACGGTAAGAGGGATAGTTTCTGATGATGAAAACTTGAAGTTTGGAAGTAAAAAAGG
AGCTAATTTAATTGGCTATGAATATTCTTATTCTCTCATATTCACTGAGTTCTATATGCT
TATATGGAAAATTAATGTTTTTTAGAGTTCTCAATATTAGGAACTTAGGTTTGAAACATG
TAACATAGCTTTAAAATGATGATATATACATTTTTAGAGTTACACTTTAAAAAATGAGTA
AGTCAATTTTGAAATCTTTAAGATTTGCTGTGTATTTAGAAGGAATTCTTCAATTATAAA
AAAAGAAAATTTAAATTCTTCATGTGCTATTTATACTTAGGTGATATAAAATAGGCAACA
TATGAACTAGACTTTTCAGAAGAGAAGAAGCATATTTAAATGTCTTATTAAGGATTTTTA
AAAATATATTGTATTTCTTAGAAACTGATAGCTCTCGGAGTCGGGCTGTAGCGCAGCGGG
TTAAGCATACGTAGCGCAAAGCGCAAGGACCGGCGTAATGATTCTGGTTGGAGCCTCCAG
CTCCCCACCTGCAGGGGAGTCGCTTCATAGGCGGTGAAGCAGGTCTGCAGGTGTCTGTCT
TTCTCTCCCCCTCTCTGTCTTCCCCTCCTCCCTCCATTTCTCTCTGTCCTATCCAACAAT
GATAACATCAATAATAACTACAACAGTAAAAAAACAAGGGCAACAAAAAGGAATAAATAA
ATATATAAAAAAAGAAACTGATACCTCTAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGAACTGTTCTCTGAACCTTTCGCTCAAGCTCAGCTGTTGGTCGAATA
TTCATAGGTATAATGTCAACTCCTAGTCTGTTGACTTTGAAGGTAATGATGTCTGGTTTC
CATCTCTGAGGTATGCTGATAACATCTCTGATGTATGCTGATAACGGTATGTTGATAAAT
TTGCCAGTCTGCTTTCATTTATAAATTCTTCAACTTTTGCCAGTAGCTTTAGCTATTTTT
TTTCCTTCTTCCTGACATCAATGGAATTCAGTGCTCTAGGCCACTCTTTTTTTTTTTCTT
TCCCATATAGAGACTGAGATAGAGAGAGAAAGACATGTATGTTAGCACTGAAGCTTCCTT
CAGTATGGTGGTGACTGGCCTGGAGCTGGGTTTGTGCACATGACAAAGCAAGCACACTAT
AGAGTAAAGCTATCTTGCAGATGCTACATGGTGGTTTTAGATACCATTGATAATCCTTGC
CTAAATCCATTATTTCATTAGGGAAGAGTATGTATATAGCACATCCAAAAGTTGATTCTG
TCACTCAGAATAAATTTTACATTATATATATTAGATTTATAAGCATAATAGAATATTTAT
TTATATTTATTTTTAAATATTTATTCCCTTTTGTTGCCCTTGTTTTTTGCTGTTGTAATT
ATTATTGTTGTAATTGATGTCGTCATTAGATAGGACAGAGAGAAATAGAGGGGGGAAGAC
AGAGGGGGAGAGAAAGATAGACCTGCAGACCTGTTTCACCACCTGTGAAGTGAATCCCCT
GCAGATGGGGAGCTGGAGGCTCACACTGGGATTCTTATGCCAGTCCTTGGCTTTGCACCA
CATATGCTTAACCCGCTGCGCTACGCCCGACTCCCAGAATATTTATTCTAAATGCTTTTA
GTAGGAACTAAGAGAAATTGCATTTAAGATAGTAACTGGTAAACCAAATCTGTGTTTTAC
TTATTAATCAGGGACCTTGGTAAATATATAGGGACATTTAAAAAATTGAAATTGTAAATT
TTTATCTCAATAGACTCTCAAAAGGATTTGGAAAATGTGTCATTAGTAAATTCACAAGCA
CTGGAGATTGCAGTCATAGCAAATACTTCGAAAGAAGCACAGGGCCCTGATTCTAGCTCT
GGCTTAAAAGTAGAGACAGTAGGTCCAAGAAGTACAGACAAAGATGACCAAGAAGAAAAT
CCAGAGGAAGCAAATTACGGCAGCTGTCCAAAGGGTCAACCAGAACTTGAGGACAACCAG
AATCTTCAGGATGAAGAACAAGGGCATCACCCCCCTTCAGGAAGGCTGAGTAGTGACCTC
TTGGATCTGGAAGAACCAAATCATCCTCCAAGTGATAAGGTGGAAAGAACAGACACACAC
TTGGGGGTCAGCTCTGCAGCCCTTCCTGAGGACATGCATGATGAATCCAGTGGGGAGCCC
TCTGAGCAGAATCCCCTTGCCCAGGAGCTCCAGGAGGCCCCGAGTTCTGGCCATCCGAGT
GCAAGACTGGAGAGCTCAGAAACATTGAGGAGGCGACGATTGGTGCCAGGTGAGAGTATC
TTTAGGACGTCTGTTTTACCCTGTTACACTTTGTTACTGAAATCACTACTGATCAGGGCC
AACTTCTCTACCTGTGGTCCTACTACGGAGTATGACGAAGCTGAGATTAGAACTCAAGCT
GCCCTACTCAGCTCCTAGACTAGCTCATCTCACTATGTTGCTTCCTACATAGCAATTGCA
TTTTTAATTTGGAGGAAATACCTTTTCATTATTTATTTGAATGAGAGAGACCGTTAACCT
GTCATCAGAATTTTGCTGGTAGCTTCTCTAAGAAGGAGTTAGTGTTTTTGAAAATGCAGT
TTGTGGGGTGTGATCAGAGCAGGAAGCCTAAAGAAATGGCTCCTTTGTTTACAACACACC
CAACAGAAATCTGGGTTTATTGACAGTGGGCATAAAAGTCTTGGCCTACCAATGAATACA
TAACCCTACAGCAGGCATAGGGCCAGAGAGTATGGATTCTGACACAGGCTGCAACATGGA
TAGCATTATGCTGAGTTAAATAAATAAAATACAAAAGGTAAAAAAAAAAAAAAAAGTTCA
TTTTTAAACCCATTCTTCAGAAATAACTGTTTTTAACAAAGTACTGTTGATGATGATGAG
TCAAACCGGGATCCTTACGCTGGTCCTTGTGCTTTGTGCCACGTGCGCTTAACCTGACTC
CCACTCATCAATTTTTTTTTGTGTGTGTTTTGTATTTTATTATTTTAATGAGAGAGAATG
ACCACCAGTGTAAGGATCCTGGTTTGAGCCCTTGGCTCCCCACCTGCAGGGAAGTTGCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCTGAACTCTCTCTGTCATA
ATAAACAGATACACAGCACCAGGCGGAGTCACACCTGGTGGAACGCACACGTGGCTGTGT
GTCAGGACCTGGGTTCGAGCCCCGATCCCCACCTGTAGGGGGGAGGCTTCATAAGCAGTG
AAGCAGGTCTGTAATGTCTCTCTGCTTCTCTCCTTTTCTATTCCCCCCTCCCTTATCAAT
CTCTCTCTATCTTATCAAATGAAAGAAAAAAGAGGGGGCAGGTGGTGGCGCACCTGGTTG
AGCGCACAAATGACAGTGCACAAGGACCTGGGTTCAAGCCCATGGTCCCCATCTGCAGGA
GGAAAGTTTTGTGAGTGAGGAAGCAGGTCTGCAGGTGTCTCTCTGTCTCTCTCCCTTTCT
CTATCCCCCTTCCTCTCAATTTCTGGCTGTCTTTAAAAATAATAATAATAATAATAACAA
CAATAATAATAAGGAAAAATGGCAGCTGGGAGATGTGGGTTTGTCGTGCAGACACCGGGC
CCAGAGATAACCCTTGTGGCAATAAAAAAAAAATGCAAAAGAAAGAAATTGAAAAAAAGT
ACATCTTAAGAAATAAAACTTAGGGGCTGGGAGGTACGCACTGGGTTAAGCACGCGTAGT
GCGAAGCGTGAGGATCCCGGTTCAAGCCCCGGGCTCCCCATCTGCAGGGAGTCACTTCAC
AGTGACTTACAGGTGGTGAAGCAGGTCTGCAGTGTCTGTCTTTCTCTCCCCTCTCTGTCT
TCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAACAATGACATCAATAACCACAA
CAATGTTAAACAACAAGGGCAACAAAAGGGAAAATAAATAAATAAATAAATATTTTTAAA
AAATTGATGAGAAAAATAGTAGGAGAGAAAAGGAGAGAATTGGATACCACTCTGGTATGT
GTGCTTCTGGGAATTGAACTCAGACCTCATGCTTGAGAGTTCAGTGCCTTATCCATGTGT
CATCATCAGCTTTTTTTTTTTTTTTTGTATGGTAGGGGGAGATTTTATTTTATTTTATTT
TTTCATTCACACAAGACAGGAAGGGAGAGAACTAGAGTATTCCTCTGGCATAGGTGATAC
CAGGGGTCAAATTCATACCTTGAGCATGTAAGCCCAGTTCTCTACATGCTATGTATGACA
CCTCCTGGATTGTTCACTAACATTTAAAATTTATTATTATTATTATTATTTCTTTATTGG
GGAATTAATGCTTTACATTCAACAGTAAATACAATAGTTTGTACATGCATAACATCCCCC
AGTTTCCACATTTAAAAATTTTCTGGATCAGTAATACCTTTAATTTTTTTTCAATTTCAA
GGTTGGTAAAATTTATATTCTAACCTATGATCATAGATCTCTCTTAAGTTTTCCAGTTTA
TTCTGAAAGTTGTAAACGAGTAAAGAGCATATATGCAATTATTCTAACCTATGATCATAG
ATATCTCTTAAGTTTTCCAGTTTATTCTGAAAGTTGTAAACGAGTAAAGAGCATATATGC
AATTATGTTGCAATTACCATATTGGAAGCACCTTAGAATAAGCCATTCACAAAGATGAGA
AGAAACCTGCTTCTAATCTTTATGTGACCCTGGCCAAAGGCCTGAATGTTCTATCAGTCC
TAAAATTCTAAGATAATATATTTTATAAACTTTTTTTTTTTACCAGAGCACTGTTCAGCT
CTGGCTTATGGTGGTACAGGGGATTGAACATAGGACTTCAGAGTCTCAGGCTTAAGAGTC
TCTTTGCATAACCATCATACTATCTACCCCCACAATACTCCCAGCCTCCCATACTCCCAG
TGCGCCTCTCTCTTTGCCTAGTAGAGTGGGTCTCTGGGGAAGTGGAGCTCCAGGACACAT
TGGTGGGGTCGTCTGTCCAGGGAAGTCTGGTTGGCATTATGCTGGCATCTGGAACCTGGT
GGCTGAAAAAGAGAGTTAACATACAAAGCCAAACAAATTGTTGAACAATCATGGACCTAA
AGGCTGAAATAGTGCAGATGAAGTGTTGGGGGGTACTCACTGCAGACTATTGTGTACTTT
TGCTTTCAGATATATATTTTGCCCTAGTTTATGCTTAGGACACACCAACATCTTACCTGC
TTCTCACTCTGCACTTGACACCCTAGTTTCGGTAACTCAGCCCCAGGTGCAGTCCTTGGC
ACCATATATGCTGAGTGGTGCTCCAGTCTCCCTCCCCTTCATAAAAATCATAAATCATTT
TTTAAAAGAGAATACCACATCTCAGAAGTAGAGATGAGAACACAATGAGTTCTGATTGTT
TCCATTCTTTAACTTCCAAACAAGCACAATTCATGTACCTCTGCTGCCCCTTCCCACCGC
CTCTCAGTTATTTTGAAGTCAGTCCTAGGGATTATATTGTTCTGTTTAGAAGTATTCAGT
TTCTATGAAAGACAAGGCTTTTTATTAATTTATTTTATTTTTAAGTCTCTCTTAAAATTT
AATTTTATTGATTATTTGATAGAGACAGAAATTGAGAGGGGCAGGGAAGATAGAGAGTGA
GAGAGACAGAGAGATACTAAGATACCTATAGCACTGCTTCACCACTCGTGAAACTTTCCC
CCAGCAGGTGGAGATCAGGGGCCTGAACCTGGGTCCCTGTGCACTGTAGTGTATGCACTT
AACCAGGTGCGTCATTGCCTGGCCCCTTACTAATTTATTAAGTGATTGATTACTTGGTGC
TTGGGATTTATCACAGGCCCTCACTTTATGTAAACCATGCACTCTATCACTGACATAAGA
TAAGACTTTTTCCCCCCCTGACGGCTTTTGGGAGTTGGGTGGTAGTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTAAGAAACTTGTCAGAGATTGCAGAAGGACTATAATTTATTGTCAT
TTATATAAATCTTTCATAAGCCAACAATGGGAAATCAAGTATTTTTAGCTCAAAATAAAA
TGTTTTTGAAGTGGTTATTATTCAATAAAAATGCACAAAACTCTCAAAGAAAAGGAAATA
ATATAATTTCGACCTCCTGTTCTGGTAGTGGTACAATGCCTGAGAAGCGCTACTAGGTAG
TATGAGTTAGAACTGAATGGGTCAAGGTTTGTGGTAAAGAAAAAGGAGATGGTCACTTTA
AGAAAAATTAAGACCGGGTCAGGCGGTGGCGCAGTGGGTTAAGCGCATGTGGCGCAAAGC
GCAGGGACCGGCGTAAGAATCCCGGTTCGAGCCCCCGGCTCCCCACCTGCAGGGGAGTCG
CTTCACAGGCGGTGAAGCAGGTCTGCAGGTGTCTATCTTTCTCTCCCCTTCTCTGTCTTC
CCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAACGAATTGCGTCAACAAGGGCAAT
AATAATAATAACCACAACGAAGCTACAACAAGGGCAACAAAAGGGGGGAAAAAATGGCCT
CCAGAAGCGGTGGATTTCATGGTGCAGGCACCGAGCCCAGCAATTACCCCTGGAGGAAAA
AAAAAAAAAAAAAAGAATTTCATAGCCCTTCATTTTATTCTTCCAAGTGAAATAAATGTA
ATAGCTTTAAGGGAAATAATAAGGAAGGGAGCCAGGCAGTGGCGCAGTAGGTTAAGTGCA
TATGACGGAAAAGCATATGGACAGGCATCAGGATCCTGGTTTGAGCCCCAACTCCCCACC
TGCAGGGGAGTAGCTTCACAAGTGGTGAAGCAAGTCTGCAGGTGTCTGTCTTTCTCTCCC
CCTCTCTGTCTTCCCCTCCTCTCTCTTATTTCTCTCTGTCCTATCCACCAACGACAGCAA
TAACAACAACAATGATAAACAACAAGGGCAACAAAAGAGAAAAAGAAAAAAATAAGGAAA
ATATTAGCACTGTATAAAATTTTACAGAGTATGGAAATCCTTTCAGCCAAATCTTTGATT
ATTTAAGAGGAATAAAAGATACATGTATTCATTAATTTATTGTCTAAAATTAATACCCTT
CCCCCTTTCCCTCCCACAGAAACTAGAATTCATCAACAAGAAACACAAAGATTCGAAGAA
AACAAAGACATTGGAAAGGATATCAAAAGGAAGCTTAATCGAAAGAATATGTTGAGCATT
GGTAAGAATAAAACTGATCATACTGCAGAAATTTTCAAGGAAAATATCTAGACAAATAGC
AGACTTACACAGTTTAAGCATTGTATTTTTTTTTTGAGCATTGTATTAATATGTTTTTAA
AAGGCTGATACGGACAAAAACTGTTTCAGGGAGCCTTACTTCAGGGGTACTGATCGATAT
TTTGCTGTCATTAACAAAGAAATTCTTATATGAAGAAGGGTTTTTCCTAAATAAGAAGCT
AAAACTGCATTTTCTGTTAGAGAGCGTTAACTAAAGATGTTTTACATATTGACTTCTAGG
GGAAATGGCCTGTTATAGGTAGTGCTTTTTTTTTTAACTGGATTTTTCTTTTTATTTTAT
TCATTTTTTAAAATTTCTTTATTGGGGGATTGATGTTTTACATTCAACAGTAAATAAAAT
AGTTTGTACATGCATAACATTTCTCAGTTTTCCACATAACAATTCAACCACCATTAGTAC
AACCCCCACTAGGTCCTCTGTCACCCTTTTTGGACCTGTACTCTCCCCCCCTACCCACCC
CACCGTCTTTTACTTTGGTGCAATACGACAATTCTAGTTCAGGTTCTACTTGTGTTTTCT
CTTCTGATCTTGTTTTTCAACTTCTGCCTGAGAGTGAGATCATCCCATATTCATCCTTCT
GTTTCTGACTTATTTCACTTAACATGGTTTATTCAAGCTCCATCCAAGATCAGCTGAAAA
CGTTGAAGTCACCATTTTTAATAGCTGAGTAGTAAGTACTCCATTGTATATATATATATA
TATATATCACAACTTGCTCAGCCACTCATCTGTTGTTGGACACCTGGGTTGCTTCCAGGT
TTTGGCTATTACAAATTGTGCTGCTAAGGACATATGTGTACACAAATCTTTTTGGATGGG
TGTGTTGGGTTCCTTAGGATATATCCCCAGGAGAGGAATTGCAGGGTCATAGGGTAGGTC
CATTTCTAGCTTTCTGAGAGTCCTCCAGACTGCTCTCCACAGAGGTTGGACCAATTGACA
TTCCTACCAGCAGTGAAGGAGGGTGCCTTTGACCCCACAACCTCGCCAGCATTTGTTGCT
GCTATCTTTTCTGATGTATGACATTCTTACAGGAGTGAAGTAGTATCTCATTGTTGTCTT
TATTTGCATTTCTCTGACAAAGGCTTGGAGCATTTTTTCATGTGTTTCTTGGCCTTTTGG
ATCTCTTCGGTGGTGAATATTCTGTCCATGTCCTCTCCCCAAGTTTGGATGAGGTCATTT
GTTTTCTTGTTGAGTTTGGCAAGCTCTGTATATATTTTGGCAAGCTCTGTATATTAAACT
CATGTCTGATGTATGGCATGTAAAGATTTTCTCCCATTCTGTGAGGGGTCTCTTGGTTTG
GGTAGTGGTTTCTTTTGCTGTGAAGAAGCTTTTTAATTTGATGTAGTCCCATAGGTTTAT
ACTTGCCTTAGTCTTCTTTATAATTGGATTCATTTCATTGAAGATGTCTTTGAAATGAAT
GCGGAAAAGAGTTCTGCCAATATTTTCCTCTAAATATCTGATAGTTCTGGTCTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCAGCCTTTAAAGATGTGGCCC
TGGTCCTGACCGTCCTCTGAGGAGGAAACATTAGAAGCAAGTGTTGGCCCCAGGGAAACA
GAAGAGAAAGTGAGAGATTTGCTCTGGGCCCGCTTTACTGACTCCAGTGCTCCCACTTCC
TATGATCACATGGACTCAGACAAACTGAGTGGGCTGTGGAGTCGGATCTCACACCTGGTG
CTGCCTGTCCAGCCCGTGAGCCACATTGAACAAGAAGGGTGCCTTCTTTCTCAGAGCTAA
GCACCAAGCAGGTGATGGCTGGCACTGGCCTACTGAAAAGTCTGTTTTAAAAAACCCTCC
ATTTGTGTAGAAGGAAGTTGATGAATGTAAGGAAACAGCCTGAAGAACACAAAAAAGCTT
GTTTTAGAGACAGGCATTTTTTTTTTTTTAATTTTTTACTTTTGGGAAAACCTTCCAAAT
CCTAGCCTGACAAAGCTCAAATTTGACATGCCTTTTATTCTTTGCCTTTTAAGAAAAATC
AGGTTTGAAATAGATCATGATACCATATAACCAGAGTGTTTTAAAATCTAAAACATAGCA
ACAGAATTACTGTACAGTAGATGATAGTCTCAGAATGACTACAAAATGATTTTTTAAAAA
GGCTTTATAGTCTTTAGTGTAGATTCTGGATACCAGCTGAAGCAATCACAATTATGAAGA
AATGCTAATTTTATGAAAAAAATTCTATCATTCAAGTATTTTAAAAATTCAGTTTAACAA
CTTAGTTGTGGGGTTATATCCTATCGTCACTTGCACTTTTGAATGTTATAAGAAAAGGAA
GTAGGAATTCAGATATTTACCTAAGCTGTGTAGGTAAGTATCTGTGTATAAGACACTGTG
CTTTTATTCTGTCAATGAGCTGAAGTAAAAACGGCCATATTCCAATGTTCTTAAACAAGG
GAAGTTGCTAGTAATAATTGGAAATGAAGAAATTAGCTGACCATATTTAGCTTCTTGAAT
GATCTAAAGCAGTGATTTTCAAGCTTTGTCTGCTGGGACTATACTTTTTGTTTCAGAGCA
GGCTCCCAACTATATTATACATTGAGATTCTCCATGATGTTCAGTTGAAACAAAGAGTTC
CACTGGCGATGATGTCTGAAAATCACTGACCCAATGAACAGAAAAATATGAGATGAGTAG
GAAAATTGAATGTTTTAAAATAACTTATAAGGAACGAATGAAGTATAGGGTTATTGGCTA
GATTTACCGTTTTTGAACAAGAAAAACCTTGCGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1034, 2953..3468, 8959..9060, 10713..11215, 11318..11353, 11358..11573
1001..1034, 2953..3468, 8959..9060, 10713..11215, 11318..11353, 11358..11573
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved