Erinaceus_europaeus Locus ITCH
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ITCH
Erinaceus_europaeus
ITCH
GeneScaffold_881
SNORA48
10914..11048
59333
AAGAATTTCATTTCTAAATTCACTGTTTCAGTACTATAGAAAAAACTTTTAATAGTTTT
TAGCATGTGTGATATTGCTTTTAGTGAAGATACAAGAATGAAGTTAATTGTACTATATAG
TTCAGTCTCAAGTGGAAGTGACTGTTGGCAGGTAGCATTCAGATATATTGAATAGTTTTT
ATAAGATTTTCTGACACAAGTAATACCTGCTGTCCTGTAAGCTACAAAACTAAAACTATA
TACAGGGAGATTTTATTTTATTTTTATTATGTATATATTTCCCTCCAGTGTTGTTGCTGG
GGCTAGATGCCTGCAGCACGAATCCACTGCTTCTGGAGGCCATTTCCCCATTTTGTTGCC
CTTGTTATTGTCATTGTTGCCATTGCTGTTGTTGTTGGATTGGACAGAGAGAAATCAAGA
GTGGGGGGTAAGACAGAGGGGTAGAGAAAAACACCTGCAGACGTGCTTCACCACTTGTGA
AGCGAACCCCCCCTCAACAGGTCGGGGGCTGGGTACTCAAACCAGGATCCTTACACTAGT
CCGCCATGTGCTTAACCCACTGCGCTATTGCCTGGCCCCCACAGGGAGATTTTAGATATT
CAAACTTTTTTTCCTTTTTTGTTAGTGATTTAACAGTTTTGCAAAATTAAAAGGTTTCAG
GGATATGATTTCATACCCATACATGGTGAGTGTTAAGTCACCACCACCTCCACCGAAGTT
CCCCCATCCCATCCCTGTAACCATTTATAATAATTCTCACAAAGTCTAAGTGACGGTTTA
GTTAACAATTTTTATGTGTTTTTTTTTTTTTTGCAAATTCATTTGTTTTAGTCATTTCTA
TTCCACATATGAGCAAAACTATCATGTAGTTTTCTTTCACCTTTTATTTCACTTAGCATA
GTCATCTTTAGTTTTTGGATAATAACAATTATAATTTATTTAGGATTGCATTGTAATATT
TAATGAAAGTAATTTTTTTTTTAATCTTTTTCACTCTTAGTATTGTCACCCCTGTGAGTA
AATTACATTTTCGTGTATGGAGTCACCAGACACTGAAATCTGATGTTTTGTTGGGAACTG
CTGCATTAGATATCTATGAAACTTTGAAGTCAAACAATATGAAACGTATGTATGTAAAAC
TGGTAGAAACTGTGCTCAGCTGTTGTTCTAAGAGAAATTCATCTGCCAAAAATGCAGAAT
GACTATGTTCACTATTTGTTTTTTAGTTTACTTGATAATGATATTAACAGGGAGAAAAAC
CTTAAACTGTTGAACATAAATAACATAGCTTTTGCCATTCATTTTGAATTCAGTATTTAG
AGCATGTACATTTAAAGCTACTTCATACTCACTGATAGAGAAACAGAATACACCTTCATC
AAGTTGAATATGGCTAATATTTTGATATTTCTTTTAAAAAATACTTATTTTAATGAGAGG
ACTCAGCTCTAGCTTATGGAGATACCAGGGATTGAACCTGGGACTTCAGGTCTGATGTTT
GCTTTCCAAATGCTTTTGATTTGTTTATGTTAGATAGTTATGCTTTATTAATACGTACAT
TGTGGGGGCAACACATCTTTCCTTTATGCTCCTTAGAGTTCTTTAACTGACTGATAATTA
AATTGATACAAGATAGATGACTGGGGGAAGAAAAATTTAGTTTCTTTTATATGGGGCCCC
CATAGGTATGTAATAAACGCCTAGCATAGTGACTATAACTTCCAACTTTTTTGGCACGAA
GATTTAGGCATGCAGATTAGTAAGGAGGCCAAAGAGTTAGTTTATGAAGTAATCTCATCC
CTATCTTTGGTGATAAAGATACTTTTTTATGTTAGTAAGGATACTTTTTTTGATTGGGGA
ATTAATCTCCTTTTGAGGATACACAATCCTTTTTGTACCTGCTGCTTCTTAAGAAAATTT
TATTCAAAGCATTCCATATACCAGAGTAGCTTGTAGATGTATATTATAGGTACATAAGAA
TTTGAAACATGCTGGTTTTGATTTTAAAACAACTTTTTCCACCGCTGGCTATCTAAAAAC
ATACTAAAAAATTTATTTCTCATTTAGAATTTTGATATAATTTTATTTTTTTAAATGGTC
CCAGGAATGAACCTAGGCTCTTTTCCCATCCCCCACCTCACTTGAAAGAGAGAGAAAAGC
AGAGCATTGTTCTGATGTTTTTAATCTTATGTTGGGGATTATATCGATCCCATAGCGGTC
CCACATGTACTGTTTAGTTGCCTGTTACGCTTCAATTCTCCTCTCTCTCTTTAATTCATT
AGTGATTTTAACATAACACATTTCCTACCACCAGATTTCTGTGTTTCCATTCTCTCCATT
AGAAACTGCGTTAGGACCTGAACTGGAGTTAGTGTATTGCACCAAAGTAAAAGACTCTGG
GGTGGGTGGGGGTGAGTGTATAGGTCCTGGAAAAGGATAACAGAGGACTTAGTGGGGGTT
GTATTGTTGTATGGAAAACTGAGAAATGTTATGCATGTACAAACTATTGTATTTACTGTC
AAATGTAAAACGTTAATCCCCTAATAAAGAAAAAAAGAAAAGAAAAGAAACTGCATTAGG
GGACTGTGGGTGGTGGTCCACCTAGTTGTGTGCACATGTTACGGTATGCAAGGACCCAGG
TTCAAGTCCCTGGTCGCCACCTACAGGGGGAAAGCTTTGTGAGTGGTGAAGTAAGGTTGC
AGGTCTCTCTCTCTCTCTCCCTCTCAATTTCTGGCTGTCTCTATCCAATTCATAAATAAA
GATAATTTTAAAAAGAAAGAAACTGCATTAGTTTTCCCAGGATCACAAATATGGGTTGAC
TATTTATAACTGTCTATATGTATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGATTAAAAGAAGTTTGGGGGGGCCGGGCAGTAACACAGTGGGTTAAGCACATG
TGGCACCAAGTGCAAGGACCCGTCTAAGGGTCCCAGTTCAAGTCCCCGGCTTCTCACCAG
CAAGGGGACTGTAGGGGAGTCACTTCACAAGTGGTGAAACAGGTCTGCAAGTGTCTGTCT
CCCCCCCCCCCCCCCGCCTTCCCCATCTCTCTCAGATTCTCTCTGTCCTATCAACAATAA
CAACAACAATAACAAGGGCAACAAAATGGAAAAAATGACCTCCAGGTAGATTGATAGTGC
AGGCACCGAGCCCCAGTGATAACCCTGGAAACAAGAAAAAAGTTTGATGGCGACTGAGTT
AGTGCCTGCACAACTGGCATTCTCAAAACTGTTTAGCAAATTCTTTTTCATTATTTCCCT
AGCTTAGGCATATATATATTTTTCACTTGGAACATAGATTTGTAAGGACCCAAGTTAAAG
AGCAAGTTAATTTTTCTCTTGATAAGTCTGACAATATCTTTTTGTGTTTAGATAGAAACT
GAATTATGAAAGTTTGCAGCTGTCAGGTGCTTTTCTTTTGTTTCTATTCTGGAAAGTGTC
TACTTCCTATTTATCTCATGAGCAAGAGGGAGAAGGGGAGAGGAACAGAACCAGAACATT
ACTCTTGCACATGCCCTGTGAAGGGTCAAACTCAAAAAAAAACCCTATGTCTAAGTCAGA
GCTTTATCCACTATTCCACTTCCCAGGCTACTTGCCTCATGACTTTTAAAAAATTACTAT
TGAAAATTTTTTATTTACAAAAAGGAAACACTGACAAAAAAACATAGGATAAGGGAAGTT
CCCCCCACCAGAACTCCGTATCTCATCCCCTCCCCTGATAGCTTCCCTATTTTTTGTTTA
GAAGAAAGTTTCTTTTTTTTAAGATTTTATTTATTGATTGATGAGAAAGATAGGAAGAGA
GAGAGAAAGAACCAGACATCATTCTGATACATGTGCTGCCAGGGCTTTTAACTCAGGACC
TCAAGCTTGAGAGTCAAGTGGTTTGTCCATTGTGCCACCTCCCGGACCACAGTTTCCCTA
TTCTTTATTCCTCTGGGAGTATGGACCCAGGGTCATTATGGGGTGCAGTAGGTGGAAGGT
CTGGCTTCTGTACTTGCTTCCTCACTGAACATGGGTGTTGACAGATCAATCCATACTCCC
AGCCTGTCTCTCTAGTTCCCTAGAGGGACAGAGTTCTAGGGAATCAGAGCTCCAGAACAC
ATTGGTGGTGTCGTCTGTCCAAGGACATCCGGTTGGCATCATGGTAGCATCTGAAACCTG
GATAGTTCTGGTGTACTTCCATTTCAATTCTTTGGTGTTAATGAGTATGCAGAGACATTT
CTGAAACTACTATGCTGTTTCAGAGTTGATACATTCATTTTCATTGACTGTTATATACAG
AAATTCTACAGTGTTGGGCTGTCAGAAAACTCGTGCATTTTTGCATAGCAAAACAGAAAA
AAAATACATCATGACTTCTAACAACCTAATAGATTTTTTTTTTCCCTTGTAAATTGGAAT
TTTGCAAGATACTACATGAGAATGAGACACCACCACATGACTCTTCCACCTGTGACACTT
CCCTGGTGCTGTTATGCTTGCATATTGTTTTGGGGCTTGAAGTCAGGTCTTCTGCGTGGG
CAGGTATATGCTGTATACTCCACTGGGTGAGCTCCCTGCCCAGAATTTTTAGTAATTAAC
AAAAATAAGGGGAATGGTGGTGGCATACCTGGTTGAGTGCACACAGTTCATAAGCACCGG
GTTCAAGCCTCCTTTCCCCCATCTGCAAGGGGAAAGCATCATGAGCAGTGGAAACAGTGC
TGCAGGTCTGTTTCCTTCCTTCCTTTCTCCTTCCCTCTCAATTTCTCTCTGTCTCTATCC
AAAATAAATAAATTAAAAAATACAAAAAAGCACATCAGTCTTTATTTTTCAGGGTGGAAT
CTAAACTGCATATTTATATTTATGATTTTGGTTTTTATTTTCTTCAGAAGTAAATTTGAC
ATGTATGCCACCATTTTTCCACTTAGGAAGGAAAATAGGACTAGGAAAATAGCATAGTGG
CTATACACAAAGACTTTCATGTCTGAGACATGAAAAGCCTCAGGTTCAGTCTCCCAACAC
CACCATAAACCAGGGGTTAGTAGTGCTTGGTTAAGAAGAAAGAAATTACAAAATTTAATC
TGATTCTTTCAGTAGAGAGAGGCTTTATACTTCGAAGTCACAATGGACTTTGGGGTTGGA
GTTGTCAGATATAATATCTTGCTGCTAGTTTTTGAATGCTTGTCATATGTCAGTCACTTG
GTATGTTAGATATTATCTTTCTCATTTAAAAATCACAACTATATAATTTTATACCTGCCT
TAAGGAAAATGAGACACTGAGGGTTTTTATACCCAGGACCACAAAAACTTAGTCAAGATT
GAAACCCAGGTATTAATTTTTATTCATTATATATTTTGTATTTCAATGGCTTTCATACTA
TTTAATATGCAGCACCAGGAAATGAACTGAGGCTTTATATCAGGTTTGATCTCAAGCCTG
CTGTCACCCTTAAGTTGACAAGTCTCACTTTATAACTCAAACCATTTGCATAATTTTTAT
TGGGAGATCTTAATAATATTCAGTATATAATTTGGTTAATGGTAAAGGTAATAAAGACCA
CAGTTCTGATTTATTTATTTATGTATTTTTACCAGAGCACTGCTTAGCTCTGGCTTATGG
TGGTGTGGGGGAGTGAACAATTCTGACTTAAAAAAAAAAAAAAAACAAATTTATTTATTT
ATTTATTATTGGGTAGAGACTGAGAGAGGAGGGGGCATGATAGAAAGTAAGAGCCCTGTT
TCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAG
AATGCCCAGTATTAAAATCTAGGGGTGTGTATCTAGATCACTTGTGACTGATTTCTGTTG
CCAATCATTGTTTTGTAAAAAGGTAATTTTTTTTTTTAAAACCAGAGCACTTCTTAGCTC
TGGTTTATTGTGTGGTGGGGGGATTGAATCTGAGACGTTGGAACCTCAGGCATGAGAGTC
TCTTATGTAACCATTATACTGTCTACCCCTAATTGACTTGTTTTGTTTTGAGATTTATTT
ATTAATAAGAGAGAGAATACCATACTATCACAGTGGCACATGCAGTACTGGACCTCATGC
TTACAAGCTTAATGTTTTATCTACATTTAGGATTACTTTTGATGTACTGCTCTGTAGGAG
TAGCCTCCACCTAGTAAATTGTTGTTCTTTCATAGTGACCCCCACCTTTTTATCATGTGA
ATTTATTTGTTTATTATTGGCTAGAGACAGAGAAATTGAGAAGGGAGAAGAGATAGAGAG
GGAGACAGACAGACAGACACCTGCAGTCCTGCTTCACCACTTGTGAAGCTTTCCCCCTAC
AGGTGAGGACCAGGGGCTTGGACCTGGTTCCTTGTGCATTGTAATATGTGCACCTCGCCA
GTTGTGCCAACACCTAGCCCCTATCATGTGAAGTTATTACAGTGTAAGTACACATAATAT
TTTGATGTGTGAACATTATTACAGTATTCATACATACAGTCACTAAACTCAAACTTGTGT
GATTCCACTGTGTGTACTCCTCGATCCAATTTTGTTGTTGTTGTTATTCTATTCTATATC
CTTAGGAGATAGAGATAACCCACCTGGATCATGTGCCTGTTTTGCTATGCATGTTGCTCA
GGTTCAAGCCTGCCCCCACCCCTGTTGCACTGCAGTGGGTTCCAGCACTTTAGTATCACT
AACCCTCTCCCTCTGGCTCTGCCTCCCCCTTTATGCACACACAAACGCGCGCACACACAC
ACAGACTGGGGCTTGAATCCTTGAGCATGGCAGTGTGTATGTTCAACCAGGTGTGCCGTC
ACTTAGGCTATCTTGAATATCTTAGGCTATTTTTTAGGCTCTTATAGTTTGGGCACTTAA
CTTGGTGCACCAGCATCTGGCTTTTCTAGGCACTTATAAAAGTGAGATGTTATTGGGTTT
TCTGAAACTTATATTTGTCACCCTGCTGGTAATGTGACATGTATGACATTTGAACTACAG
AAGATGGCAAAAATACGAGATCTGAATTACAATCAAGCAAAAATATATTTCAAAAGAGGC
AGAACTAACTCATGGGTGATATGCTACAGATTATCTCTTTAATACACCACAGTATTAAAG
AGTATGCTACAGATTATCTCTTTAATACACCACAGTATTAAAGTACTTTGGTATTGCTGA
TTTATTATTTTAATCATGAACATTAACCACACCTTTCTGTTAGTTAAATATGTTGGAATT
TAGCTATATTTTAAATAGACATTTTGTAACGGGATTTGCTTACATACTATTTTGTTTAAA
TTGTATTGCTATTAAAGGTGCTTCACAGAATGATGATGGCTCCAGACCCAAGGATGAAAC
AAGGTAAAAGTTTACTTAATACTTATCACAGAATGCAGAAAGAAACAAGAAAGAATGAAT
AAATATTGGTGTTATTATATAAATATAAGTGAATGTTAAAAAAATTTCAGAGCTCAAAGT
GAGAAAATACTTAGGAACGGTTCTGATTTTATAGCTTATCTAACTGCATTTCCTCTGAAC
TAACCAAGTACTAGCTTCTTGCCCAGAATAGTAACTTACTGTCCATAAAACAGTCACTCA
CTACTACCACTTTCATCATTAATATATTGGCATTTTTCCACAGCTAGATACTCAGAATCT
CAGGGCTATCACTGGGCTGTTAACTTTCCTTTCTAGGAAATTTGGAGTATGAGCTTTGGA
TATATGTAGAGGTCACCATAAACTATGATAATTTCTTGACTTTGCTTAGAAAGAACAGAG
ATTTATACCAACTGTTCGCTCTTATCTTAGTCTAGATCTTTCATGGATATCTCAGTTTTC
AGGTCTAGGGCCTAAAAAGTCTTATTTTTGGGGTTATGTTGACTGACTTAACAAACTTTA
AATGTTTGTGGTTATCTTGGAAACTAGTAATGGAAGAAAAAGTTAGGGGAAATGAGATGA
TCCTAGTCTTAAAGCAGTAAGAAATATATCTTATAAAATTATAAAATCCCATTGGATTCT
TTTTTTTTTTCCCCAGACAGGGTAAGCAGTGGGTTGGAAGGAAAGATCAAAAGATCAGTC
ATAGGAGTAGTCAGAATAAGAGGAGAACCAGAAAATCAGTGTCATAGGACAGAACGAAGA
AATACCTAGAAAGATGGACTTTATAGTATCCAGTACAGCAGTGGAGAATAGGGGGATTAA
GTAGAGCAAAATGTTGATGGTTGTTGAAACTAAGTTGATAAATACATGGGAGTTTATTGT
ACTGGTTGTCTTTTGTGATATATAGTAAATGTCATAATAAAAAAAATGAGTGACTTTCCC
TGTCCTGAGTAGAGTGGCCATTGGCTAGTGGTGCCCATCTCTTATCAGCCAGGAACAAAG
CAACTCCTTGTTCATCCTAACTTGCCTTTTGATCTGTGTCCATGCCTGGTTCATGCTGTA
GGTATACAGGTTGACAAAAAAATTGATAGAAGTCAGTTGATATTGATCTTTTTAGGAAGA
CCACATTTTGTGAGCTATTATTTCTGCAACTGTCTATATTTGTATTTATTTGCCCTCTTA
TTTTTTTTTCTCTCTATGGTCCCATCTTTTCTTCCTTTCCAAGCCACACATACATTACTA
TTACTACATTCAAATGTCCCTCCCTGTTCTCTCTCTCTGGATGCTGATGGAATTGGAGTT
CAGAGCCCTTTGATTATCTTCCCCCTGTTATTTATTACTCCCCCACTGAGAGTATGGATC
AAGGTTCTTTTTGAGGTGTAGAAGATGGGAGTTCTGGCTTCTTTAATTGCTCCTCTGCTG
GAGATGGGGTATTGGTAGGTCGATCTGTACTCCCAGCTTGTTTCTATCTTTCCCTAGTGA
GTAGAGCTCTGGAGAGGTGAGGTTCCAGGACACATTGGTGAGGGAAGTCAGGGTAGGATT
ATGATAGCATTTGCATCTTGGTGGCTAAAAGGCAGCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTTTTTAAAAGACTTTGGAGCCTGAGATAAG
CAGTGCTAATACGATAAATAATAAATCTAGGCTTAAAGAGATTATTTAAGATTGGAATGG
TAATCAGATTGAATTTTAACAGTGGGCTCAAATTCATAATACATTTCTGATATATGCACT
TAACAGGGTGTGCCACTGCCTGACCCTGTTAAAATATTTCTAGTAATGACTTGTTCTTTG
AAATATTAAGTATCCTAAAAGCTTAAGCCAGGGAGAACAGAAGCAACTGGTGGTGTTACT
TTATAAGATACACCTATATATAAATATCATAAAAGGATATAAATTGTATCTTGTATGATA
CAACAAGTCCTAACAATGGGATTTTCAAAGTCAACCCAATTGCCAAATAATTTAGTTATA
GCAATAACTATCTATTGCCTTCTTAAACCCTAAGACAGCAGGAACCTTCCCCTTTCTCTA
TTAAGCCCATGCATCTCCCAGTCCTGGGACCTCTAGGGTGGGGCTCACTTTCCTGCATGC
TTCTTTCAATTATACCAACTGATACTGCATCTGCTGATCCCAGCCTAATCAATGCAGCCA
GTACCACCTCAGCATGCTTAACTTCGGACTGTGTCCAGAGATGCCAGGCATGGGATGTCA
ACCCTTAAGCTTCATTACTGTGGCTTATACGACTCCTTAATTCCATTTTGGGTGGCACAG
GTCTTTTTTTTTTTCTCTCTCTCTTTTTGTTGCCCTTGTTTTTCATTGTTGTTGTAGTTG
TTGTTGATGATGTCATCGTTGTTAGATAGGACAGAGAGAAATGGAGAGAGGAGGAGAGAA
AGACAGACACCTGCAAACCTGCCCCACCGCATGTGAAGTGACTCCCCTGCAGGTGGTGAG
CTGGGGACTCAAACCGGGATCCTTACGCCGGTCCTTGCTCTTTGTGCCACGTGTGCTTAA
CCCACTGTGCTGCCGCCAACTCCCAATTTGTATATTTCTTATGACCTGACTTAATCTTTC
AGTTTCTGTCCTGTTCATAAACATATCTCTCTCTCTCTCTCTCTGTGTGTGTGTGTGTGT
ATACATACTTTTTTTTATAAAGTAGAAATATTGACAAGACCATAGGATAAGAGGGGTACA
ATTCCTACCTACAGAACTCTGTATCCCATCCCCTCCTGTAAAAGCTTTTCTATTTTTTGT
CCCTTTATGAGTATGGACCCAGGATTATTAAGGGGTTGTGTGGCAACACACCTGGTTGAG
TACACATATTATAGTGTGCAAGGATCTAGGTTCAAGTCTCCAGTCCCCACCTGTAGGGGC
AAAACTTCACAAGTGGTGAAGCAGTGCTGCAGTTCCCCTTTCTATCTCCCTCTTCCCCAT
TTTCTTCCCTTTCAATTTTTATCTGTCTTTATCAAGACAAAATAAAAATAAAAAAGGATT
TATATGTATGGTGAGCTAAGTGTAAGTTTGTAAAATTATGGAGCAAATCTCTGGTTTCCG
ATAATGCTGAGAGGACTGAACGTAGGACTTCCATGCCCAGTGCTCTCCCACCCTAGGTTC
AGTTCTCAGCATCACCGTAAACCAGAGCTAAATAGTGCTCTGGACATTCTCTATCTTTTT
CTCTTTTATTGAAATAAAGAAGAAGCATTAAAAGGGTGAGAAGAAGAATAGAAAGAGAAT
ATGTAAGTTATATCAATGGGATGTAGGTATTAAATGTCATGCATGAATGTAGGAAAGAAA
AAGTGTAAAATAGCAGCACTGCCTATAAAACCAAACTCTTAAGAGCAAGAATTATAGTTT
TTTAACTTTTTTTTATTTTGCCTCCAGGATTATCATTGGGGCTTAGTGCTGGTACTATGA
AACCACTGCTCCTGGAGGCCATTTTTACCATTTTTTTTTTTTCAAATAGGATAGGACTGA
GAGAATATGAGAGAAATAGGGAAGGGAGAGAAGGAGAGAGAAAGACACCTGCAGACCGCC
TTCCTTTACCACTTGTGAAGTGACCCCTCTGCAGCTGGTGAGCCAGGGGCTGGCACTGGG
ATCCTTATGTGTCCTTGTACTATGTGCACTTAACCTGGTACATTATGTCCAGCCCCGCCC
TAATTTTTATTTTTATATTTAAGCTCTGCTTTTAAAATTAGCCATGACCCTGGAGATTGT
GCAGAGCATATAAAGGGTTGGACTCAAAAGCACAAGGTCTGAATTTAATCCCTAAGAGGC
TGAATATCAATTTTTTAGCTTTTCACTTCATTCAGAATAAGCTTTTATGAAACCAGCACT
AAATAGAAAGACCCTAAGGGATTTCTGGGAAACATAGTTTGAAAATTATTTAACATAGGG
TACTGCTTCTCTATTTTTTTCTTGAGTTTATTAGATTTTATCTTATTTAGACTTGTTCTG
TAGGTTCAGGAGTGTTGCTTTACATTGTACAGTGATTTGCTGCTTGCCACATAGGTATTA
GAGTCTTAGTTGAGCTATTTCCACATTGATTGTCACATGCACTTTTTACTACATAGATTC
CCTCTGGGAATGGGAACCAATTATATTTGACAGAAGTAGTAATTTTTTTAAATTTATTTC
TTTATTGGGGAATTAATGTTTTACATTCAACAGTAAATACAATAGTTTGTACATGCATAA
CTAATTCCCCAGTTTCCCATTTAACAATACAACCCCCACTATGTCATTTATCATCCTTCA
TGGACCCTGTATTCTCCCCACCCACCCACCCCAGGAGTCTTTTACTTGGTGCGATATGCC
AATTACATTTCAGATTCTACTTGTGTTTCCGTTTCTGGACTTGTTTTTCAACTTCTGCTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACCCTT
CACGACCACCTCCTCCCTACCCCACGTAGACCAGGTGTGTATTCCAGCCACACACCAGCG
CTGTAGCTCTCTCTACTGTGGTTATAAGTAATGTTTAGTTGAGAACTGATTCACAGGTAA
GTTGATGACATCCTTTTAGATGGTTTCCTGACTGTTTTACGTGTAAGATTTTGCTCAAGA
ATACCCTTCCTATAGATAATTAGGATGTGCCTTTTCCCTGAAGTTTTTCCTCCTAATGTG
AGGCTACTGAGGCAGTGTCATATAGCCAAGTATTTTGGTTACTTTTTTTCATTACCAAAT
GATGGTACTCAAGTTATTCCCTAATGGAGTAGACCCAGGAAGTAGCACAGTGGATAAGGT
CCTGAGCTTAATCCTCTGAATTAAATGTGCCCAAACGGATGTTATCATTCTCTCATTAAT
GAGAAAAAAAAATTTATTTAATAATAAATATTTCTAAAAGATAATGAGGCATTGAGGCAT
AGGGATGGAAGGGTTTAAGTGGGCAGAGGCCTGACATCATGCATCAAAGCTTACCCCAGA
CCTTTGGCACTCCCGTGTAGTATGTTCAGTTCAAAATCTGGGCCAAGTCCATGCCAAGGT
AGACAGCCTCCCAGGTGAACTATCTCTCAGACCCCTAACTCCCACTATTTTAAGCAATTT
TCACCTGTGTAACTCCATCTTATATTTTAGATTTATCATCTGTCTTCTAATCTTTGGATG
TTACACCCCCCCAATTTAGATTCCTAAAAACAAAACACTGTTTTCTTGTGTTTCTTACAT
CTCTTATAGCATCTGTTAATGGTTCACCATCTGCCACTTCTGAAAGTGATGGATCTAGTA
CAGGCACTCTGCCACCACCAACAAATACAAATTCAAATACATCGGAAGGAGCAGCATCTG
GATTAATAATTCCTCTTACTATATCTGGAGGTGCAGGTCCTAGGCCATTAAATACTGTAA
ATACTGTACCTCAAGCTCCCTTACCCCCTGGGTAAGTAACTGCTTTTGGTTGGTACTTTT
TTTTTTTTAAGGCTTCTATATATACTTACTAGTAAGAAAATAACTGAATTTCATATTTTA
AATACCATTGTCAAGCAGCTATAACTAATTTTAGTGATCCATGTTAAGCTGAATAAGAAA
ATCTTTTTGTTTGAATGGAACAGAATCACTTCATTTTTAAAAGTAATATTTTGAAAGTTA
TTTTAACGGGGGGAGAAAAGTAATATTTTGGGGTCGGGCAGTGGCGCACCTAGATAAGCG
CACACACTACAGTGAACAAGGACCTGTGTTCAAGCCCCTAGTCCTCACCGGTAGTGGGGG
AAGATTCATGAGTGGTGAAGCAGGGCTGTAGGTGTCTTTCTATCTCTTTCCCTCTCTATC
TCCCCCATTCCCCTCAATTTCTCTCTGTCTCTATCCAATAATAAATAAATAAAAGTAGTA
TTTTAGAAAAATGACAGAATTAGCATTTATAATACCATTTTATAATCTTTGTTGATTTAC
AAAATAATGCTTTAATAGTTGATATGCACATACATTGTAGCATTCAGGTTAATCCAAAAT
TCAGAATGCTTTTCAGAATTAATTTACTAGCTGACAAGTAAACTCATGAAAAGTTTCATT
ACTAAACAGATTATATTGTATCTGTAGTTAGGCTATTTACCTTTTGGAAGATCTATATGG
GAAGCTCAAATAGAAAGCTATTTGTGCAGTGAATTAACAAAAGAAACGGGCCAGGCAGGG
GTGCACCCGAAAAAGTGTATGTTATCATGTGCACATATCAGGGTTCAAGTCCCAGGTCCC
CATTTACAGGGGAGAAACTTCCAAGAGCAGGGAAACCATGCTGTAGGCATCTCTTTCCCA
CTCTATCTCCTCCTTTCCTCTCAATTTCTCTCTTATCAGAAGGAAGGAAGGAAAGAAAAA
GAGGAAAAGAATAAAAAGGTCACTGGAAGTGATAGATTTATCATTTAGGCACCAAGCCTG
AGTAGTGGAGGAGGATGGGAAGTCTTAGAAGTGAATGATAAATCTAATTTTATCTTGAGG
ATAAACCTACCAAGGAGACTAGAATACTTCTTCATTGGACTGTATAGAAACACATTTGAA
AATTTTATATCTTCTTTATATATCACCATACTTATTTGCTTCAGATATTTAATATGTTCA
GATAAGAAGAAAAGAGAAAGACAATATTAAAAAGGCAGGCTTCTTACACAGAGCTATATT
AATCTTTTTAATTTTGTGTTTAAGTTGGGAACAAAGAGTGGATCAGCATGGGCGAGTATA
CTATGTAGATCATGTTGAAAAAAGAACTACATGGGACAGACCAGAACCTCTACCTCCTGG
GTAAGTATCTGACTTCTGAAGAAAAAGGACTTACACAGAATTATAGGTGTATAAAATCTT
CCCAACTAATCATTCGTACAGTTTCTCTTATTTTTTTCTCCATTCACTTTCATTTGTGGT
ACTTGTAAACTAGGAATAAGAGAGTCAAAAAATTTGTCCTGTAGGACTTGAGAGACAACT
CACAGGGTAGGACATGTGCCTTCCTTTGTGCAGGACCCAAATTTGATTTCTGGTACCACA
TGAGTATGCTACAGAATCTATGGCCATACCACAGTCAACTACATTGAGTCTCAGTCTGAT
CTCAGAAGCTAAGCAGGGTTGGGACTGGGTAGTATTTGGGTGGGAAAGTGCCACAGAACC
AGGGAAATACCCAGTACTGTGATTTGTATATCCCCCCCCCCCCCCGTGTCTCTCTTTGTT
TCTGAATGAGAAGTTTCTGTATGTGCCAAAGGAAGAAGAAGGAGAAAAAAAGATATTTGT
AAAAAAAAATAAATAAATAAAAATAAAAAAATGATATTTGAGGATATTTATTGTTATATT
CCTGATAGCCAATTTGAAATCACCAAATTATTGTATCAGTATTTACTCTTTTTTTTTTTT
TTTTGCCTCCCGTGTTATTGTTGGGCTTGGTGCCTACACTATAAATCCACTGCTCCTGGA
GGATTTTTCCCCCCCGTTTTGTTGCCCTCGTTGTTTATTGTTGTTATTATTGTTATTGCT
GCTGTTGTTGGATAGGACAGAGAGAAATTGAGAGAGGAGGGGAGGCAGAGAGGGTGAAAG
AGAGAGATAGACACCTTCAGACCTACTTCACCATCCGTGAAGCAACCCCCATGCAGGTGG
GGAGCTGGGGGCTCAAACCGGGATCCTTAAGCTGGTCCTTGTGCTTCGAACCACGTGCAT
TTAACTTGCTGCAATACCACCCTGCCCCCCAGTATTTACTTAATTTTATGCATCCATTTG
AAGTGGTAAATAAGATATTTGTATTCTTGTGAAAATATTTTTTATAAAGATCTGTTTCTT
GTATATAATAGAGGGGGAAAAAGAGAACCAGAACCTCACTCTGGCACATATGTTCCTGGG
GATCATACTCTGTTCCTCCTGTTTGAGAGTCTCAATGCCTTATNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAAAGTAA
AATCCAAATAGATTGAGAAGAACCAAACAGTCGTAAGTGTAATACTGCCTAACTTAACAC
AACATCTGAAATCTGTAGTTAAGGAGCAGGTGGTGGTGTACCTAGTTGAGCACACATGTT
ACATGCACAAGGATCCAGGATCAAGCCCCCCAGTCCCCACCTGCAAGGGGAAAACTTTGT
GAGTGGTGAAGCAGTGTTGTAGGTGTCTCTCTTCCTCTCTGTCTCCCCCCTCCCTTTCAA
TTTTTGGCTGTCTCTATTCAATAAATAAATAAAGATAATCCCCCTTAAATTTTCTTGAAA
ATTTATTAAAAGTGAAAGAAGATATCTTATAGCTAAGAGCATCTCACCCTTATGTAGTTT
GACAGAACTAATAATATAGTTGAATCACTTTACTATGTAAAGTTTATCTTATTATTTCAA
GTCCTGTAAGACTAAGGAAATTTGAATCACTGTCATATTAAGCTGAGTATAATATTCTGA
ATTCAAAACTGTTATCTTGACATAAAAACATTTCCTCTTGGAAATAATATACATTTTTAT
ATTTTCCTTTAGAATGATATTAGCAGCAATAATGATAAGTATATCAAAATGTATTAATGT
TTTTGTTGTGGACACTTTACATGATCTCAAATACTGAAGTATCAGATCTTTTCTCTGAAG
AAAAGAAAATATTTATTGAGGAAATCTGATTTCATGTGCCAAACACAAGAAATCTGTTTT
AGTAGTATGTGAAATTTCAATAGAAGATAACCAGTTTAAAAGAAACTGGCCCAGGAAGAG
TCAGGCGATAGCACCGCCGGTTAAGCGCAGGTGGCGCAAAACACACCGACCAGTAGAAGG
ATCCCAGTTCGAGCCCCTGGCTCCCCACCTGCAGGGGAGTCGCTTCACAGGCGGTGAAGC
AGGTCTGCAGGTGTCTGTCTATCTTTCTGTCCCCCTCTCTGTCTTCCCCTCCTGTCTCCA
TTTCTCTCTGTCCTATTCAACAATGACGAAAACAATAAAACAACAAGGGCAACAAAAGGG
AATATTTTTTTTAATTTTTTATTTATAAAAAGGAAACATTGACAAAACCATAGGATAAGA
GGGGTACAACTCCACACAGTTTCCACCACCAGAACTCTGTATCCCATCCCCTCCCCTGAT
AGCTTTCCTATTCTTTAACCCTCTGGGAGTATGGACCCAAGATCATTGTGGGATGCAGAA
GATAGAAGGTCTGGCTTCTGTAATTGTTTCCCCGCTGAACATGGGCATTGACAGGCCTAT
CCATACTCCCAGCCTGTGTCTCTCTTTCCCTAGTGGGGAAGGGCTCTGGGGAATCAGAGC
TCCAGGACATATTGGTTGGATTGTCTGTCCAGGGAAGTCTGATCAGCATTATGTTAGCAT
CTGGAACCTGGTGGTTGAAAAGAGAGTTAACATACAAAGCCAAACAAATTGTTGACCAGT
CATGGACTTAAAGGCTGGAATAGTGCAAATGAAGAGTCGGGGGCGGGGGGGGTCCTCCAT
TTTGTAGATAGCTAGTAGGCATATTTTAGTTATATTCCAAAGAGCCTGTGGTTTATACTA
GTCTTCCCCCCCTCCCCCCGAGCCTGACATCTGATGTGCAGGTGGATCCAAGTTACTGTC
TGGGGTGATGATGTCATGGCTGGAAAAAGGACCAGAAAGCTGGATCAGGGAAGAGAGTAG
CTTTAAAAAAAAAAAAAAAAAAAAAAGGAAAGAAAGAAAGAAACTGATCCTTTGGAACAT
GATCACAGAGGACCTAGTGGGGTTGTATTGCTACATGGAACTGGAAAATGTTATACATGT
ACAAACTGTTGTGTTTACTGTTGACTGTAAAGCATTAATCCCCCAATAAAGAAATTTAAA
TAAAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAACTGATCCTCT
CCATCACCATCTCTCCCCCTCCTACACCATATGGTCGTCCCTGTTAGAACCCATAAGTCA
GTTTCTATCCTCAGTAGATGCTACCTTTCCCCCCCTTTCTCCATATTCTCTTCTGTTTCT
TTGATATAGTAAACATTCATTGATAGAGACTATTTTATTAGCTGCTTTCCCTTCACTGCC
TGGTTATGAGTGAGCTAAAAATCTTTCATATAACATTTCTTTCTTGCCACTTTCTGTAAA
TAACTGTCAATATTAATCTCTTTCCTCATTGGTTTTAGGCATGAGATTAGTTTGGTTTCT
TGTCTACCTTATCTTTTTTTTTCCTATGCTGTTTTACATCTTTCTTTCTAAATTTTAATT
ACCTTTGGTATGCCTGGCCAAATTTCTTCTAGGTTTGAATGCCTAGCTTGCCTGCCTTCT
TTAAAGCTAGTTTCCACATGGGTGTCCAGTGAAAAAAGTATGGGCTTTGGAGTTACACAC
ATCTTGGTTCGAATCCTGTTCCACAGTTACTTTCTCTGTATGACTTTAAGTAAGTTACTT
AACCTCATCAAGACTCATTTACTTTATCAATAAAAGATATATGTCAGGAGTCAGACGGTA
GCGCAGTGGGTTAAGTGTACATGGCGCAAAGCGCAAGGATCCTGGTTCAAGCCCCCAGCT
TCCCACCTGCAGTGGAGTAGCTTCACAGGCAGTGAAGCAGATCTGCAGGTATCTGTTTCT
CTGCCTCCCTCCTCTGTCTTCCCCTTCTCTCTCCATTTCTCTCTGTCCTATCCAACAACG
GCGATATCAGTAACAACAATAATAACTACAACAACAATAAAAACAAGGGCAACAAAAAGG
AAATAAATATATAAAAAAATATATATATCTGTATATACACATCTGATTACATCAGCATTT
TTAAAGGGTTCTGTAAAGGTCCTATTATGTTGGCACATGCTATATGCTATGCATATAATA
GATTGTCATATTTTCTTTCTCTCATATTCAGTTATAAATATGCCCTTTACCTCACTTTTA
TAATACATGATTGGCTATAGCACTTCAGTTGTTTTTTGTTTTTTTTTTAAAGTTTTTTTT
TTTTTTTAAGGCAGAAGTTTTATGGAACATCTACAGTTTATATTGCTTAACTATAAACTG
AACCAATCTGATACTCAGAGTCTTTGGAACAGTTTTTGAATTCACAGCTTTACCTCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGAGCAGTGGATTTTGTGGTACAGGCTCTGAGCCCAGC
AGTACCCTGGAGCCAAAAGAAAACGAAAAGAAAGAAACCCAAGGTGGTCCGGGAGGTGGC
GCAGTGGATAAAGCAGTGGACTCTCAAGCCTGAGGTTCTGAGTTCAATCCCCGGCAGCAC
ATGTACCAGAGTGATGTCTGGTTCTTTCTCTCTCTTCTTCTGTCTCTCTCATTAATAAAT
AAATAAAATCTTAAAAAAAAAAAAGAAAGAAAGAAACCCAGATGTAAGGAGCCATGTGGT
GGTGGTGCCACCTGATTAAGTGCACACATTACAGTGTGCAAGGAACCAGGTTCAAGCCCT
TTGTCCCCACCTGTAAAAGGAAAGCCTCAAGAGTGGTGAAGCAGGGCTATAAGTGTCTCT
GTCTCGTACTTCCCTCCAAATTTCTCCCTTTATCCTATAATAAATAAATAAACCAGAAAT
CCAAATGTGTAATGTGAGGACCTTTTAAACATTCTGGTTGGGGGCCCAGGCGGTGGTGCA
CCTGGTTAAGTGTACAAACTATAGGGCACAAGGACCAAGGTTCCAGTTCCTGGTCCCCAC
CTGCAGAGGGAAATTCCGCTTCACAAGAAATGAAGTAGGGCTGTAGGTGTATCTCTGTCT
TTCTCCCTCTCTGTCTTCCCTTCCCCTCTCAATTTCTCTGACTCTATCCAATAATAAATA
AATAAATTTTTTTTAAATTCTGGTTGAAATAAACAAGTAATCAGAGACAGTTAATTAGAG
GTTGACTTTTAGATGATAAAATTAACAGATTCTTTGCTAAGTATAATTATGATCTTGTAA
CTAGATAAGAAAATGCCATAGATTTTAGAAAGGCATACTAAGATAATATTGCAATGAAAT
CATGTCTGGTTTTTACTTCAGCAAAGACTAGGGGGAAAAAGATACAGCAGTATGACTTAA
GTTCTGTAATTCTTAAAACATGGTGTACTGACTATCTTGCTTTTTTTCATATATATATAC
ATACATATATATGTACATAAATATGTATAGTAAGTAAATATATATATAAAATAATGAGAG
AGGCAGGTAGTGGCACACCTACTAAGCACACATATTACCATACAGAAGGACTGAGGTTCA
AGTCCCCAATTCCCACCTGCAGGAGGGGAGCTTCACAAGTGGTGAAGCAGGTCTGCAGAT
GTCAGTCTTTCTCCCTCTATATCTCCCCTCTCCTCTCAATTTCTCTCTGTCCTAGCTAGT
AAAAAGAAAAAGGAATAAAAGAAAAGGGAAAAAATGGCTGCTGGGAACAGTGGATTTGTA
GTGTCTGCACCAAGTCCCAGAAAAAATAAAGTATTTTAAGTATATGTAAATAATTTTTTT
TTATTATTTGTTGTTGTTTTCTTTATTTGTCTTAACCAGAACTCAAAGCCTGTCTTACGG
AGGTGCTAGGAGATTGAACCTGGGATCTCAGAGCCTCAGCCCTGAAAGTTTATTACATAA
ACCATTGTGTTATCCACCTACTCACCCTAGTTCACCCCATCCCACCTCTCACAACAAAAT
ACATTTTTAAAGCATTTGAGTTTTCCTATAATATANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCACAGGGTTTTTACTTTGGTGCCCTACTTTCAATTTAGTCAGTTCCTGCTTTTA
GTTTCCCTTTCTGATCTTCTTTCTCAACTTCTGTTGATGAGTGGGATCATCCCATACTCA
TCTTTATCTTTCTGACTTAGTTCACTTAACATAATTCCTTCTAGCTCTGACCAAGATGGG
TCAGAGAAGTTGAGTTCATTGTTCTTAGTAGCTGCAGAAAATTCTGTTTTTTGTTTTATT
TGTCAAGTCAGCAAGTGTTCTGATATGCACTTAGATTTGAAGTCAGGTATTTTAAATGGT
GTTTATCATGCTGTTTTCCAACATAGTAAGAAATCAATAGCAGTGACAATTTTTCCTTTA
ATAAAGAAAGTGAACCTTCAGTTCACAAGTGCGTACCTTTGAATTGTTTTGTTTATCACA
GTCTCGGCTAAGAAATGCTAATATCAGCACTGCATACTTAGAATATTCATAGAAAATATA
TTCTTAGTTAATTGTCTTGCTTTTGAAGTTAAAAATCTTTTGGCTCTGAGATCAGTTTAC
ACTGATAGAAAGATGAAAATGTGCTCAACTGCATACTTAGGACATTATTTTTAATTTATA
AAAACTTATTTTGAAATTATTTGAGTGGTGGTGCACTTGTTTAAGTGCACATGTTTAAAT
ACAAGGACCCAGGTTCAAGCCCCATTCCCACCTGCAGGGGGGGAGGTCTCATAAGCGGTG
AAGCAAATACTATAGGCGCCTGTCTCACTATCTCCCCTCATTTCTCAGGGTTTTTTTCTG
TCATATCAAGTAATAATAAAGACATGGGTGGGGGAGCCAACAGGAGCGGTAGATTCATTG
TGCAAATACTGAGCCCCAGAGATAACCCTGGTGGCAAATAAATAAATATTTAGATGTAGA
AAAATTGTCAATTCTGCAAATATATTTGAATTTTGAAATTAATGTGACTACCAAAAACAT
TAATTTTGTTATCATGTAGGCAGGTATAGTACTGAAGAAGCTTATTTTAGACATAGAGAC
AGGTTTACATTTGGTTACATATTCCCATATTCAAGATACCATGATTAGTGTTAATATTCA
GTGTATACCACAAGGTGCAGATGATATTTTTAAAACTCTAGGCATATGTGATTTTAATAG
TGGAAGAATATTTTAGATTTTTTTAACCTAAAATATTGTGTGGCTCATGAGTTAAGGTAC
ATGTCTTATCATGCACATTGTCCAGGTTTGAGCCCCTGGCACCACATGCAAGGTGCCATG
TCACCTTAGGAAATTGTGATGCTGTGGTGTCTCTTCTGTCTTTCTATCTAAGTGGGGTGT
GGGGGAAAATGTCTTGGAACATGTGGAAGGCCACAGGTCAACAAAAATAAAACTGTGATT
TAAAAATTATAACAAAATTTGCAATCAGTAATGGGCAAATTCAGCTGATTTTTATTATTT
TAGATTTTTTATTACTATTTTATTAGGTAGAGGCAGCCAGAAATCGAGAGGGAAGGGAAT
GATAGAAAGGGAGAGAGACAGAGAGATACAGGCAGCATTGCTTTACTACTTGCAAAGCTT
TCCCTCTGCAAGTGGCAGCTCAAAACTGGATCCTTGTGCATTGTAACGTGTGCCCAACCA
GGTGCGCCGCTGCCACCTGGCTCTACATTTTATTATTTTATTTTGAGGATAAAGACTATA
CCAACTCTCATACTTGACCTTTTTTATTTTTCTTAACTTCAGAGAAAAGAACAGACAGCA
ATGGTAGAGTCTACTTTGTCAACCACAACACTCGTATTACCCAATGGGAAGATCCCAGAA
GCCAAGGGTAAGAACTTTCAGTTACTAATGTGTACTTAACCTTTTGAAAATTGTCCCTGG
TTTCTGATTCAGTTGTAAATAATCAAAGACACATATTCATTCCTCAAAGACTGCATAAAT
TAGAAAGAGCAAATTCATTCTATCATGTTCATATGATTAATATGGGTTTCTTAAGCATGT
AGGTAAAAATAAAATATGCTCACTACTATGTGAATACACACCGATCCTTGCATCGCCCCA
TGTGCACTTAACTGCCCAGTGCCCTATTATCTCTGTTTTATGAAGAAAATAGCTGATGCT
AAAAAGAGTTTAAGCAAAAATCTAAAGATGTTAAGGAAATGAGTAGGAATATTACATAAA
GAATATTTAAATTGCCTTCTGGAGTGATAATAGAAAATTTCTGGGTAATGGGAAAGACTT
CATTTGGTGGTGTGGCAGCTTATATGTTATTTAGGGAAATGGTGAATGAAACCGTACACT
GTGAAATCATAGTTCAGCAGCTGGGTGGTGACTTATTCCATAGAACATATATTATTACCA
TGTGCAAGGGCTGGGGTTCAAGCTCCTGGCCCCCATCTTCAGGGGAAAAGGAGGGTTCAC
AGGTGGTAGATCAGTGCTTCAAGTGTCTTTCCTCTCCACTCTCACTGTTCAGAAATATGG
CCACCAGGAATGGAGGAGTTATGCAGACATCAAACCTCAGTAAAGGGGGCCAAGGTGGTA
GCACACCGTGTTAAGTGCACATAGTACGAAGTGCAAGGACCAGTGCAGTAAAAACCCAGG
TGGCAAGTATAACAAAAATACATTTGAAAAATTATTAAACCTTATTTGAAAAAAGAAATC
ACAGAGTTTATGATTGGTAGTTGGAATTAGAATGCAGAGATAAACCTGAAAGGGAACATT
GAAGACAGATGAGTGCTTGGTGGCGGAGTTTAGTTCTTAAACCAGTAATGTCCCTTTAAA
AAAAAAAATGTATTGAGCTGGGCAAACAGCATAATAGTTCTGCAAAAGACTTTCATGCCT
GAGGCTCCAGGGTTCCAGCTTTAATCCCTGGCACTACCATAAGCCAGAGCTGAGCTGTTC
TCTGATCTTTCTCTATCTCCCCCCATATATATGTATATATAATAATAAAGTATGTGTGTA
TATATATATATATATTATATATAGAAAAATGTATTTGATCATATCTCAGTTTTTAGTATT
ATGTCTTCACTGTGAAATAAAAATGTAGGGCCCGGGTGATACTAGAAGTAGGAAAGCCAG
TTAGGTATCTGTTACGAAAGTTCGAAAGAGAAATGAATAAAGTCATTACAAGAATAGCAC
CGAGGAGTGAAAAGTGTTGCATACAGCTTCTAAGGTGGAGTGGACCAGAATTTGGTTACC
AGGAAATATTTTAGGTGGGTTATTACATGGGAGAATATCAGCCAAGCAGATGGAATAAAA
TTGAGTGCTGGTTGATTGATCTGTTAGCATATTAAAATTTGCCAGCTTAGGGTATCTAGA
GAGGCTTAATAAACAGTTAGAAATACTGACTTAAGTGGTTTTACATAAGATTTCGACTGC
AAATATGCATATTTTTGTTTTGTGTTTAGTTTCTTTTTTGATATTTTTAATTGTAACAAA
CAACTCTTAACATTTTTCCCTCCTGTGGTGGTGTTTAGTCAATTAAATGAAAAGCCCTTA
CCTGAAGGCTGGGAAATGAGATTCACAGTGGATGGAATTCCATATTTTGTGGACCACAAT
AGAAGAACTACCACCTACATAGATCCCCGCACTGGAAAATCTGCCCTGTAAGTTTTCTAA
ACATTGTAGATTAAAAGTAAGACAAATTCCTAAGGGTTTTATGTAAAGATCTAAATTAAT
TAGCAAGGATTACTGTCTTTACTATTTGTTGTTGTTGTTTTTGATTGCCCATGGGTTTAC
TGAGTATTTTTGTTACCCCTATAAATTAGCATTTTATTCTGTATTCAAGTGAGAATATAT
TATGGCAGTTATACCATTTGGTCAGAGTACTAAATGAGACTATGTACATATTATCAGTGC
AGTATTGCTCACTAGTGAATCCTTGATTTCTTATGCCCACTTTTTTTTTTCACATTTCCA
TTTTCTTTTTTTTTTTTTTTCCTTCCAGGATTATTGTTGGGGCTCGGTGCCTGCACTACA
AATCCATTGCTCCTAGAGGCTATTTTTTCCCCTTTTGTTGCCCTTGTTGTTTATTGTTGC
TGTTATCATTATTGTTGTTAGTAGTATTGTTGTTATTGTTGGATAGGACAGAGAGAAATG
GAGAAGGGGAGAGAAAGACACCTGCAGACCTGCTTCACCACCTATGAAGTGACCACTCTG
CAGGTGGGGAGCCGGGGCTCGAACCGGGATCCTTAGGCCAGTCCTTGCACTTTGCACCCT
ATATGCTTAACCTGCTGCATCACCACCTGGTGCCCTTCCACTTCCTTTTTTTTTTTAATA
TTTATTTTTTTAATCCCCTTTTGCTGTTCTTGTTGTTTTTATTGTTGTAGTTGTTGTTGT
TGTTGTTGATGTTGTTGTTGGATAGGACAGAGAGAAGTGGAGAGGGGAGGGGAAGACAGA
GGCGGAGAAAAAGATAGACACCTGCAGACCTGCTTCACTGCCTATGAAGCAATGCCTCTG
CTGGTGGGGAACCGGGGGCTTGAACCGGGATCCTTATGCCAGTCCTTGTGCTTTGTGCCA
CGTGCGCTTAACATGCTGTGTTACCTCCTGGCTAACCCCTTCCACTTCCTTTTAATAGTA
AATCTAAATAGTACTGTGTTCTAATAAATTAATAACGAGATCATTTCCCATAAAGAAAAT
TCTGGTCCAATTGACTTCACTAGTAAATCTTATCAGGCTTATAATTAATAATGTTGATCC
TGTTAGAATTATTTCATAAAATATAAGAAGTGTTATGTTCTTATAACCTTGATATCAAAA
GCAGATAAGAGCAGTATACATTATTGACTGGGTCAAGGAAGATGGTGCCAGTAGTAGAAC
ACGTGAGGCCCCAAGTTCAATCTCTGGTATCCCATATGCCAAAGCAGTACTCTAACCTTT
CTCTCCCTTTATGAGCATTTTTTTAAAAATATTGATTAGTATTTCTGTGAACGACTGCAT
AAAAATCTTTTTTAAAGATCCTGTTGACCCTTGAACAGCACTGGTTTGAATTGCACAGGT
TTACTTTTTTTTTTTTACTTTTTTTTTATTTAAGAAAGGATTAATTAACAAAACCATAGG
GTAGGAGGGGTACAACTCCACACAATTCCCACCGCCCAATCTCCATATCCCACCCCCTCC
CCAGTAGCTTTCCCATTCTCTATCCCTCTGGGAGCATGGACCCAGGGTCGTTGAGGGTTG
CAGAAGGTGGAAGGTCTGGCTTCTGTAATTGCTTCCTCGCTGAACATGGGTGTTGACTGG
TCGGTCCATACTCCCAGTCTGCCTCTCTCTTTCCCTAGTAGGGTGGGTCTCTGGGGAAGC
TGAGCTCCAGGACACATTGGTAGGGTCTTCAATCCAGGGAAGCCTGGCTAGCATCCTGAT
GGCATCTGGAACCTGGTGACTGAAAAGAGAGTTAACATACAAAGCCAAACAAATTGTTGA
GCAATCATGGACCCAAAGCTTGGAATAGTGGAGAGGAAGTGTTAGGGAGGTACTCACTGC
AAACTCTAGTATACTTCTGCTTTCTTACTTTGGTGCCATACTCCAAACTCAGTCAATTTC
TGCTTTGCGTTTCTACTTCTTTTTTTTTTTTTTACATGCATAACATTCCCCAGATTCCCA
TTTAACAATACAACCCCCACTATGTCATTCATCTTCTTTCATGGACCTGTATTCTCCCCA
CCCACCCATCCACCCCAGAGTCTTTTACTTTGGTGTAATACTCCAATTCCATTTCAGGTT
CGACTTGTGTTTTCTTTTCTAATCTTGTTTTTCAACTTCGGCCTGAGAGTGAGATCATCC
CATATTCATCCTTCTGTTTCTGACTTATTTCACTCAACATGATTTTTTCAAGGTCCATCC
AAGATCGGCTGAAAACGGTGAAGTCACCATTTTTTACAGCTGAGTAGTATTCCATTGCAC
AGGTTTACTTAAACAAAATTTTTTTCAGGATAGAACCCACAGATGCAGAAGGCTGAGTAT
AAAGGAACTTGGCACTCTAAAGGATGGTGGAAGGAGACTCTTGAAACCAATTCCCAGCAG
TTAAAAATAATATTTATAGTTTTATTTTTGGGCAGTCAAAAGTTAGACTAAAATTTCTGA
CTGCACAGTGTTGGTTCTCATATATACCCCCATACCTGTTGTTAATAATAAGTCCAGCAA
GATGTAAAATGTATATTGCATGTTATCAAATGGAATTTGACTCAGGAGTGCAATATCAAT
GTAATTCAGCATATCAGCATACTGAAAGAAAAACTCTTTATCATTTTAAAAAAAAAGCTC
TATCATTTTAAGAATGCTCTTGAAAAAATATAGTGCAAGTTTATGAGAAACTCTATTTTT
CAATGGAAACTTAATCTGAAAAATGTAATTTTTTAAAACCTGCAGCCAACATAAACTTAA
TAATGGAATACTTCTTAAACCGAGGACATGGTACTGTTACTACTTCCTTTTAAAAAAAAG
TGTTGTTAGGCCTGCAGGATAAGAATGTCTGGGCATATATTTGCACAGGACTTGTATGCC
TGAGACTCTTAGTTTGATATTTGGTGCTGAATGTACCGTAGTGGTTCTCAGACTTGCCTC
ACTTGTGTGTGAAACTCTGTTTCTAGAGAAACTATTAAAATCACATTTTAAATCATTATT
AAGAAGGTAAGAGAAAAAGAGGCCAAGAGATATATTACTCAATAGGCCACACACCTTCCT
ATGCATAAAACCGTGGGTTCAAGCCTCCTATCACATGGGAATGAATACCACAACGCCATG
GGGGTTGCATGGATGGTGGAATGGTGCTGTGGTGTCTTTCCCTCTCTTTCTTTGTCTCTG
TCTATATCTAAATTAAAAAAAGAAAAAAGAAAAACATCAGCTAAGGAGCAACAGAGTCAC
ATATGTACAAGATCCCAACACCATCCAAAAAACAAAAGACTTAAAAATACAAGAGATACA
GATTGAAAAAGAAGTAATTTTTAAAGATTTTATACAGATAGACATAATTGTTTATACAGA
AAATCATAGGTAGTCTAGAAAAAGACTACTAGAAGCAGTAAATGAACTTCAGTAGCATTG
CTTGGGGCTAGGAAATAGTTCATTACATAGAGCACATGCCTCACCACGTGTGATGCTTTC
CTCTTTAACCTATCTCTCTCTGTCTAAAATAAAATAATGAAAAATTTGACCCAAAGAAGC
CACTCAGTAATTTCATCACACAAATGCAGAACTCTTAAGTTCATTCCCTGATACTGCATA
AAAAACAAACAAAAAAAAAGTAGCATGACTACATGCAAAGCCAATACCTAAAATCAGTAG
TATTTCACATAAAACATTTGTAAAATTAAAAGTAATTCAGGGGAGGGATGGGGAGATACC
ACAGTGGTTTACTCAACAGACTTTGATGCCTAGGATTCCAAGGTCCCAGGTTCAATCCCC
AGCACCATCACAAGCCAGAACTGAACAGTTTTCTAGTTTAAAAACAGAAGTAATTCAGGG
TAAAAGGTAAATAGTACAGGAATAACAAGTCCAACACTAGACTGGCAGCCCCATGGTACT
GTCAGTGACCTAGAATTCTTTCTTTCTTATATATCGTACAGTGTGGTTTCTGTCACTGAA
GATTTTGTAGCTAAACAACAGTAGTCATTTTCCAGGGTGAAATATGGAGGATAAGCAAGT
GGGAATGAGAAAAAGATTCCCTTTCTAGCTATGTACCTCTTTTTTAAAAAGCCTTTTTGA
AAGTTCTATACAGTACTTCCTTTACTAGTTCATTAGCCAAGTTATGTCTCCCACACTGGG
AAATGTAGTCTTCATCCCAGATAGCAGTCTCCCCAGATAAATATCTAGAGCCTGTTGTTG
GTGTTTAATATTTATCAGATATTTATGAGAGAGATTCAGAGCATCACTTTGTCACATGGT
GATGTAGGAATTCAACTTAGAATTTCATGCCTAAGAGTCCAACACTTTATCTCCTAAACC
ACCTCCCAGACCCATCTATTTTTATTAAAGAGAATGAGAGAATAGGCAACCAGAGTACTA
CTCAGCTCTAGCATATTGCAGTGCTAAGACTGAATTTGGAACTTCAGGGAAGTCTGTTAT
GCAACTCCTGTATACTAATGTTGAACTATATCCCTCATCCCTAGAGTCCAATTTATACAT
AAAGGATAAAATGGTTGGGTGGGAGCAACATAAAACCTCCTTTACAGCAATGGGGGCAGT
GACAGAGTGCTAGAGTACTGGACACTGGGCTTAAAATCAATGTAGGTCCCAAGTATCATC
CTGGTTTGATTCTTTCCCTCTCCTCTCATATCTCTCCTCCCCTCCCCTCTTTTCTTTCTC
TCTCTGTTGTTAATAAGTCAGTCTTTAAAAGAAAGAAAGGAAAGAATAACCCCCTTCACA
AGTCCACAAATCCTGTTAGACTTGGCTATATATGGGGGGGGGGGAAATCCCACAGTAGTG
ACTTTTTAAAAATATATATATTTCTTTTTACTTTTTTTCTTCATGTTAGGACTCCCAAGC
CTTTTTTTCTTTTCTTCCTTTTCTTTCCTTCTCTTTTCTTTTCTCTTCTTCTCTTCCCCT
TCTTTTCACTTCAGACAAGGACAGAGTTCTAGGAAGAGAACCACAGTTCCGCTCCACTAT
TTGTGGAATTTTCCCTTATGCCACAGTGCTTCCATGTGACATCAGGGTAAGGTGTGTGCC
CTACTAGATAAGTCATCTTCCAGTCCCCAATATTGATTTCTGACCCTTTTTTTTTTTTTT
TAAATATTTTTCATAACCAGAGCACTGCTCGGTTCTGGCTTATGGTGGTGTAGGGGATTG
AACCTGGGACTTTGGAGCCTCAGGCATGACAGTCCCTTTGCATAACCATTATGCTGTCTA
CCCCCACCCTATTTCTGATTCTTAATTTAAAATAGTTCCTGGGCAAATATTTAAAAGTGA
GGAATGATAACATTGGGAGTAAGTAGTACTTCAGTATTTTTGTACTTAACTGCTTAGTAT
TAAGGCTATTTGATATTTTGCTTTTTTTCAATAGTTTACGGTAAAAATAGTTAAATTAAT
GTCACATTAACATTCTTCCACAGAGATAATGGGCCCCAGATAGCCTATGTACGGGACTTC
AAAGCAAAGGTTCAGTATTTCCGGTTCTGGTGTCAGGTTAGTAGTATATAGACTGTATTT
TTTATACTCATTTTCCTTTGTTATGTTGCATATATTACCTGATCAGTAATTGTGAAAATA
ACTAATTTGTAGGAAAACCAATTAAATGAGAATCATGAAAACTTCTATCTTTAAAGAACT
AGATTTTTGTCAGTTGATTTGTTATATAATAAATAAGCCTTTTGTTATCCAGAAGAATAA
ACTTGAAATCATTTGAATATGAAAACATCTCTACTCATTTTGTAGTACCTTTTACTCCCT
CCTCCTTTTTTTTTTTTTAACCAGAGCACTGCTCAGCTCTGACTTATAGTGGTGCAGGGG
ATTGAACCTGGGGCTTTGAAGCCTCAGGCATGAGAGTCTCTTTGTGTAACTATTATGCTA
TCTACCCCTACCCATACCTATTACTTTCTGATTACAGAAATGGGGTGAGGGGGTCCTGGC
AGTGGCACACCCACAAGTACTAGGTACTAGGGTTTGAGCCCTTTTGCTGTGCACCTTCAG
GAGAAAGTCTTTACAAGTAGTTAAGAAGGTCTATAGGTATCTATCTTTCTCCTCTATCTC
TCCCCTCTCAATTTCTCTCTGCTCTATCAAATAAAATAAAAAGGAAAACATAGCCTCCAT
CGTGCTAGCATAGAGGCCCAGCAATAACAATGGTAGCAATTTAAACAAAAGAAAATATGG
GAAAGAAACTTTTGAACAGTTGAACCAACAATGCACAAATTATAATCAAACCCTTTCATT
TCTAACATTTGATGGTTTTGATACATGCTAATGACTTTGTTAGACAATACATGTATGTCG
TCACTGAAGTCAGTTTTTTTAAAAAATGTAATTAACTTTCTGATTACAAATATTTACTGG
ATTGATGACTATCAATACTGAATAAAATTAATTCGCTAGTCAATGTGGTATTACTATGAT
AATATGTTTTAAAGTTCAGACTCTTATAGCTAACTGTTCATTCATACAAAAAGAATCTAA
ATTAACTTTTCTGAAAATAAAATATAATGTATTGGACTTATTAGGGAAGCACTGTTCACA
AGATGTTTCTGTTCTTACCAAATAACCTACAATTAGCATGAATCCTCACAAATGTGTAAA
CATTGAATAGTAGTTCACATTCATAGTCTACATGTTTCTGTAAGCAAAGGTAACAGTAAT
TAATGTATCTTTTTTATTTAGACCATTTAATAATTTAATTGTTGAGAATGTTTTAGTATT
TCAGTGCTGAAAATATTTCTTATATTTCAGCAATTGGCTATGCCACAGCACATCAAAATC
ACAGTGACAAAGAAAAACACTGTTTGAGGGATTCCTTCCAGCAGGTAATGCTTCATCCTA
GATGACATTTAGGTGCTAGCAGTTTTCTGGGGTTTTGTTTGTTTGTTTGTTTTTTTGTTT
GTTTTACCCAGAGCACTGATTAGCTCTGATTTATGGTGGTTCAAGGGATTGAACCTGGGA
CTTCAGAGCCTCAGGCATGACAGTCTCTTTATATAACCATTATGCTATCTGAAAACTGCC
CGCTAGCAGTTTTCAACATTTTGTGTTGAAGTTCTTGAGTTTTTAAGTTAATCCCAGCTA
CTCTCAAGTACTTAACATTTGGAACCCACAGATTATTTTGTATCTGTGTTTTGTTCGTCT
GTTCCGTATTTTGTGGTTTTTTTGAAATGTCAGTAACTTAATTAGCTTCACCTTTCCATT
TCTAAACTAAGTGATATGAATTAAGATACTTAAACAAGAAGGTGGACTTCAGAGAAATTC
TGAAATGTACATTTGAACATTACTGAGTAGAAAAGGAAAGGGGAACTGTTTTTATACTTT
TCTATTACTTAATGTTGGGCTTTTTTTTTCTTCTTTTTTTTTTTTTTACAATAAACATGT
TACTGTTATTATTTTAATTTTTTTCCTTAAGGAAAGTAACTTACAACAGTATCTTTAAAA
AGATTTTTTTTTTTCCTCCAGGGTTATCCTGGAGGCCTATTTTTTCCCCCATTTTGTTGC
CCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAAAAGATTAGACTC
CTTGCAGGACCCTGGCTTCCCCCGCCCTGTGAAAAGCAAACTTCCCCCTGGCAGGGTGGG
GAAGCCGGGGGGCTTCGAAACCCGGGATTCCTTAATGCCTGGTTCCTTGTGGCTTTGCGC
CCAACATGCCGCTTTAACCCCACTGCAACCACTGCCCCGACCCCCCAAAAAAGGATACTT
TTCTGAAGTCAACATTTTTTTCCCAGTTGTCCTTAAGAGTCTGAGTTTAATTTATATTTC
TTATTTTTCAACTTTATTTACTAACCATCTGCTATTAAATGTAAGTGATTTTTCCCCACC
CACAGGGAAGGTTAGAATGGCCAGTGGAAAAGTATATTAATATTAAAATATGGACCTGGG
TGGTGGTGTACCTGGTTGAGCGTAGATGTTGCAATGCATAAGGACCTGAGTTCGAGCCCC
TGGTCCCCACTTGCATGGGAACAGCTTTGTGAGTGGTAAAGCAGGGCTACAGGTATGCCC
ATCTTTCACCTTCTCTATCATCCTCTTTCCTCTCAATTTCTGGCTATCTCTATCCTATAA
ATAAAGTTGTTTTTTTTTTTTTTTTTTTAAGAAAATGTATTTAAAATATCCAGTTCATCC
TATTGTATGGCCAGATGTAGACATAATTCCTTATTATCATGCCCCTTCTGATAATTGTAG
TAGCTCTTGCTTTAGGAAGTACCGAATTGAATATTAAAGGAAAAAGAAATCCTCTGAGAT
AGGAAAATTGGTAACTGGCTTCTTTCAGAAAAAGTTAATTATTCCTAGTAGAACCTTACT
TAGAAGCAAAAAAACCAGTTTAAACTGATAGAACCTGTTTAAAAGCAGTAAGCCAGTTTA
CATCCTACTAAGTAGGAACAAGTATCCTTTTTTCCATATTCTTCATTAGTGATTTAATAA
TAACTTCTAAGATTACAGGGGTATAGTTTCACACTGCACCCACCACTAAAGTTCCATGAG
CCCCCAAGATAACTACATTAGTTTTCACAAACTTAGAGATAGTTTGGTCGCTTTTTTTCT
TCTGCAAGTTAAGTATGATAACTTCTGGTTCCATCCGTTTTTTTTCCCAAGGACACAATG
TCATCTTTTTCTTTTTTTTTTTTTAATTACTGAGAAAAATAGGAGTAGACAGAGAAAGAT
CCAGACATCACTCTGGTACATGTGCTGCCAAGGGATTGAACTCAGGATCTCATGCTTGAG
AGTCTAGTTCCTTAGCCACTGAGCCACCTCCCAGACCACGTGTCATCTTTTTTTTAATTA
CAGAGTAGTATTCCTTGGGTAGGGGTAGATAGCATAATGCTTATGCAAAGAGACTTTCAT
GCCTGAAGCTCCAAAGTCCCATGTTCAATACCCCACACCACTATAAACCAGAGCTGTGCA
GTGCTCTGGTAAAAGAAAAAAATAGAAATAAAAATGAAGACTCCCCACCTGCAGGAGAGT
CGCTTCACAGGCGGTGAAGCAGGTCTGCAGGTGTCTTATCTTTCTCTCCCCCTCTCTGTC
TTCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAACGACAACAACAATAACTACA
ACAATAAAACAACAAGAGCAACAAAAGGGAATAAATAAAATAAATATTAAAAAAAAATAA
AAATGAAAAAAAAAGTTATATTCCACTGAATACATGTCCCACAGCTTTTTTTAAACTATT
AATTTATATCATTTATGATTATGGTTTTTTGTTTATTATCTTTATTTCATAGAGACGACC
AGAAATCAGGAGGGTGATAGGGAGACAGACACCTACAGGAAGTAAAGGCATTTTATCAAA
TTGTCTTTCTTTAGGCTGTTTTGTCCTGTCCTATCCCTATCCCTGTCCCTACCCATCCTC
TATCCTGTCCTATTTGCAGTCAGGGTTATCTCTGGACTCTATACTTGCATGATACTACAG
GTACCAGCAGACACCCCACCCCCCTCCACCCCAAGGTTATTGATGGGGTTTGGTGCTTGC
CTGCACAATGAACCCACTACTCCCAGGTGCTTTTTTGTCTATATATTTATTTATTTTAAA
CCAGAGTACTGCTTAACTTTGGTTTATGGTAGTGCTGGGGATTGTTTTTCCTTTTGAATA
GAGACAAAAATTAAGAGGGAAGGGGAAAGAAAAGAGATGTCTGCAGCACTGCTTCGCCAC
TTTCACCCCTTGTGAAACTTCCTCCTACAAGTGGGTACCAGGCACTTAAACCCAATTCCT
TACACATGGTAATGTGTACACTATACTGGGTGCACCACTTCTTGCTGTTGCCCCCCCACA
CACACACACATACACATACCAGCAGACTATTTATTTACTTTTTTTTAAAGATTTTTAAAA
ATATTTATTTATTCCCTTTTGTTGCCCTTGTTTTATTGTTGTAGTTTTTATTGTTGTTAT
TGATGTCGTTTGATAGGAGTGAGAGAAATGGAGAGAAAGGAGGAAAGAAAGATAGACACC
TGCAGACCTGCTTCACCACCTGTGAAGCGACGCCTCCGCAGGTGGGGAGCTAAGGGCTCG
AACTGGGATCCTTAAGCTGATCCTTGTGCTTTGCACCACCTGTGCTTAACCCGCTGCGCT
ACAGCCCAACTCCCCCCCCTTTTTTTTTTATTAGAGCAGTTGGGGAGGTGGTGGCTGGTA
AGAGTGTTGAGATATATATATAATGTGATTCAGGTCCCACGCTCTGGGGTGGTTCTCTCT
TCTCTGTCATGTGAGCCTCTTCCAAATGTAAAAAATGAAAAAAATTTTTAGTTAAACAAA
AGGAATGAGAAAAAATAAAGAGACCCCGGACTGCTCCATTGCTGTGAGAGCTCTCGCGCC
TTAAGGAAACAACCTGGGCCCTCTCCTTATGGTAAAGGGTGTGCCCGCACACACAGGGGC
GTCTCGCTGTCCCCCCACACCTGTGTTTTTTTATAAAAAAAAAAAANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGTATCATTGTCCTTTGCTTGCAAATAATATTTCTTTCAATCTTAATATTTCAGGA
AAGTAGAATTTATCAAATTACTTTACCTTTACTATACTGCAGAATTTCAGTAAACTTTAC
GCTATTTCTAAGCTGTTACTAATTGATTTCACCCTTGTCATTTAATTCTTATAACTCTGT
AAGACAGAATCTTAACAGCAACTAAATTATAGATCCCATACAGACTGTGTATCATCAGAC
CAGTAGCTAGTGCTCAATCCAGCACCTCATGTCTATATCGTAGAGCACAAAAGAATTCTA
GGCTTGGAGGTCCGGCGGTAGCACAGTGGGTTAAGCACACATAGTTTGAAGCACAATGAC
CAGCATACCAGTTCAAGCCCCCAGCTCCCTACCTGCAAGGAAGATGCTTCACAGACGGTG
AAGCAGGTCTGCAGGTGTCTGTCTTTCTCTCCCCCTTTCTGTCTTCCCCTCCTCTCTCCA
CTTCTCTCTGTCCTATCCAACAACGACAACATCAATAACAAATAACTACAACAATAAAAA
AAAACAATAAGGACAATAAAAGAGGGAAAATAAAAAGAAAAAAAAGAATTCTAGGCATAT
CAGATTATTTTTCAAATCATATATTACTGATAGAAACAACTGTCATTAAATTTCCATCTA
AAGGGAGTCGGGCTGTAGCACAGCGGGTTAAGCGCAGGTGGCTCAAAGCACAAGGACTGG
CATAAGGATCCCGGTTCAAACCCCGGCTCCCCACCTGCAGGGGAGTCGCTTCACAGGTGG
TGAAGCAGGTCTGTAGGTGTCTATCTTTCTCTCCTCCTCTCTGTCTTCCCCTCTTCTCTC
CATTTCTCTTTGTCCTATCCAACAATGACAACAACAATAATAACTACAGCAATAAAACAA
CAAGGGCAACAAAAGGGAATAAATAAATAAAATAAATGTTTTTTTAAAAAATTCCATCTA
AGATTATTTCTGTATTGAGAATGTAGAAATCTGTATAAAATATTTGAATTTTTTAATTCT
ATTTTCTGCATTTTAGATCTTCTAATCAAGCTATAGAAGATAGATTCAAAAATTATATTT
CACATTATACATATATATATGATATCAATAAGTAAAAATTTTGCTTAGCATTGTAAAAAA
AAGAAAAAGCAAGCACTTTGAAGTCAAGTCTAGATTTGAATCCTTTTTCTGTACCTTCAT
TTATAAAATAATAGTAGTCATGTCTAGAACTGGACAGTAGTAAGTAGCTCTCCTGGTAAA
ACTCACACTTTACCATTGAGGATGCCCTGGTTTGAGCCCCCAGCATCCCATGGGAGCACC
AGGAGAAGCTTCTTTAGCAGTGCTATTGTATCCCTTCCTCTCAGTAGCTCTCTGAGATTG
AATGGGAAATAGGGGCAAAAATAGTCTGCTGGTGGAATATTGCAGATGTTAAGTCCCAGC
AGCAAATGCATGTTCTATCTACTTTTCTTTCTTTCTTTTTTTTATTTATTTAAGAAAGGA
GACATTAACAAAATCATAGGATGGGGGGTACAACTCCACACAATTCCCACCACCCAATCT
CCGTATCCCATCCCATCCCCAATAGCTTTCCCATTCTCTATCCCTCTGGGAGCATGGACC
CAGGGTCGTTGTGGGTTGCAGAAGGGTTCTATCTACTTTTCTAGGATTATTGGTAGAAGT
AGAAAATCAGGCGGAAGTATGAGCTGCATATTGCCAGAGAACATAAGCCAGGAAGAAATG
ATATCTTGAACACAAACTGATACCGCATGTATTGCCATGATACATAGTAACTATAATCCT
ATGTTTAGATTAATTGATATTTTCACTTCATTTGAATTAGAGCTTTTCAGAGTATTCTTC
TATAGAATTAATGGCTTAAATTAAGTGCTCTATTAGGCCATTGTGAAATTGGGAGAGTTT
TCATAGTTAACTAGATGGTACTTAGTGAAGACAACTATGTGTTTTACTACTACATGAAAT
AATAAATAGAATTAAGCTCATTTTAGCTGAAACCATGTGAATAAATAATGTTAAACTTAT
GTATAGTATTTCATTGATTCTAAAACCAGTGTCCTGTTTTAACATCTCTAAAATTTGGTT
ATATACCACAAATATAATTGAAAAGGATTTAGTTGTTTGTCACATAATTTTGTCTTCAAA
GTCAATGTTGTAAAGTCTTCATAGTAAATAAAATATGCAGCATATAAGTATCACCTTTGT
TAAATACTCAGTTTGGTGGTATGTGTACTCAACCACGTGTACCAACTCCAAGGCCCCAGA
TTTCAGTTTGGACAGAAGCAAAAAAAAGTCAACATAGGATCAGAAAATTTATCACTAAAT
GAGGAATATAGATTCCTAACAACTTTGTACTATTCTTTGATTTGTTGACATTGCTTTACA
AGGTTTTTCACCCTAACTTTTCTTTTGATTTCAGAGAATGGTTCTTTCTTTTGTCTCATG
AAGTGTTGAACCCAATGTATTGCCTGTTTGAATATGCAGGAAAAGATAACTACTGCTTGC
AGATAAACCCCGCTTCTTACATCAATCCAGATCACTTGAAGTATTTCCGTTTTATTGGCA
GGTTTATTGCCATGGTAAGTTGAAGTAGAGAACTGTGTTTACTTTGAATAATAAAGTAGA
ATGTCTTTAACTTTCTCAATTTTTTTTTCTCATCACTATGACATTTCTATAGTTGAATGT
GTTGTATTTTTTTCTTTCCCCAGAAAACTGCATAATAGATCAAATGATAGCCCCCCCCCT
TTTTTGTTGCCTCCAAGGTTATCACGGGCTGGGTGCTCACACTATAAATCCACTGCTCCT
GACCACCATCTTTTTTCCATTGTTGTTGCTGCTGCTATTGTTGTTGTATAGGACAGAGAG
AAATTGAGAGGGTAGGGGAAGACAGAGAGGAGGAGAGAACAATACCTGCAGACCTGCTTC
ACCACTTGTGAAGCAGCTCCCCCTAGCAGGGACCCACGGCCCCAAACTGGGATCCTTTAT
GCCGGTCCTTGCACGTCGTGGTATTTGTGCTTTAGCCTTTTATTGCCCTTGTTGTGTCAT
TGTTGTAGTTATTGATGTCTTTGTTGGAAAGGACAGATAAGAAATGGAGAGAAGATATGG
GAAGACAGATAGGAGGAGAAAATGACAGACTGGCTTTCATCTCTTGTGAAGTGGGTCACT
TTGCAAGTGGGGGAGCGGGGGGCTCCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAGTGAGATCA
TCCCATATTCATCGTTCTGTTTCTGACTTATTTCACATAACATGAATTTTTCAAGGTCCA
TCCAAGATCAGCTCACAACAGTGAAGTCACCATTTTTTACAGCTGAGTAGTATTCCATTG
TGTATATATACCACAACTTGCTCAGCCACTCATCTGTTGTTGGACACCTGGGTTGCTTCC
AGGTTTTGGCTATTACGAATTGTGCTGCTAAAAACAGATATGTACACAGATGGGTGTGTT
GGGTTCCTTAGGATATATCCCCAGGAGAGAAATTGCAGGGTCATAGGGTAGGTCCATTTC
TAGCCTTCTGAGAGTTCTCCAGACTGTTCTCCACAAAGGTTGGACCAATTGACATTCCCA
CCAGCAGTTCAGGAGGATTCCTTTGACTCCACAACCTCTCCAGCATTTGCTGCTCTTACC
TTTACTGATGTATGGCCTTGTTGTTTTTTATTGTTGTTGTAGTTATTATTGTTGTTAGGA
CAGAGAGAAATGGAGGAGGGGAGGACTCTTAGAGAGGGGGAAAGATAATGTATTTACTAT
AAAATTATCTCAGATTTTTTTCTTTTTCTTTTTTTTTTCCTGTAGGCTCTGTTCCATGGG
AAATTTATAGACACAGGTTTTTCTCTGCCATTTTATAAACGTATTTTGAACAAACCAGTT
GGGCTAAAGGATCTTGAATCTATTGATCCAGAATTTTACAATTCTCTCATCTGGGTTAAG
TAAGTTTATTTACTTTTAATTTTTCAAAATATAGCCTATATCCTCTCATTGTGGTATTTA
TAACTTTAACTGTAAGCATGTAATTGGGTTCACTGAATGTGATTAAATGATCTGTACAAC
AAACTTTGTGGTATTACTATTTTTGATAGATTTTAAAGAGATAACTTCAAATGTTAAGCA
AAATGACTTTAGAGTTTAATCTTCCAGTTTTATTTTTCATTTTGATTTCATTTAGCTTAA
AACTTTACTGTCAATTGAATTGTAATAAATGTCATTTCATTTATGCAGAGAAAATAATAT
TGAGGAGTGTGGTTTGGAAATGTACTTCTCTGTTGATAAAGAAATTTTAGGTGAGATCAA
GAGTCATGATTTGAAACCCAATGGTGGCAATATTCTTGTAACAGAAGAAAATAAAGAGGA
ATATATCAGGTGAGAGAATTTTCCTTTTAACATAGTTAAGCCATCCTGTTGAACTGTAGC
ATATTGACTGCCTTGTAACAATAGTGAATAGTATTTATTAGTTATTATGAGAATTAATCA
TCTGTTTATTAATAATATAATTATATTTCTCATTATGTATGTTTAGAGAAAAACAAGGGA
CGTGCTATGGTAAGTAAGCAGGGGACATTCCATGTAGTTATAGTCATGGAACATGTAACT
GATGAGATTTGATAAGAGCCTTAAGAGGTGGAAATGATTAAGTTATATAGAAATGGCAAC
TAAGTTCTTACAGGCACAAGTCACGTGTAGTAATCAGGGAGTCTTTGACCACAGAATATT
ACCTTCTCAGAATTGATATCTTATTCTGCAATATCCTGCATTTCAGAAGCCAAAGAAAAT
GAGGAATCTTTAGAAGATGTGGAGATTTACAAATTATAATCCTTGAAAGAACAGATCTAA
AGTAACTTGTAGATAATAGACGCCAGATTAAAAAAACAAATGACTTCACGAGTGGTGAAG
CAAGTCTGCAGGTGTCTGTCATTCTCTTCCCCTCTCTAGCTCCCTCTCCTCTCAGTTTCT
CTCAGTCCTATTAAAAAAAAAAATTGAAAGAGTGGTCTCAGGAGCAGTGGAACCCTGGTG
GGCAAAAAAAGAAAAAGTAAGGTAGAGATACTTTCCAGGGGCAGAGGATTGGTATTATAA
AAATAATAATGTAAACATTTAATAAAGTTTTTTTATGAAAAGAGAAAAAAATAAAGTTTA
TTATGAACTTTATTAAGTTTTTTATTATTATCTTTATTTATTGGGTAGAGACCGCCAGAA
ATCAAGAGGGAAGAGAGTGGTAGAGAGGGAGAGATAGACACCTGCAACACTGCTTCACCA
CTCACAAAGCTTTCCTCCTATAGGTGGGGACTAGGGGCTCAAACCCAGGTCTTTACATAT
TGTAATGTGCGCTCAGCCAGGTGCACCACTACCTGGCCCCCATAATAAATTTTAAAGATT
TACTTTTACACTCTTAAGTTTAAAGGTAAAGTATATAAGCTCTCTGATAGTTTTTTTTTT
TTTTTTTAAGAATGGTAGCTGAATGGAGATTGTCTCGAGGTGTGGAAGAACAGACACAAG
CTTTCTTTGAGGGCTTTAATGAAATTCTTCCCCAGCAGTATTTGCAGTACTTTGATGCAA
AGGAATTAGAGGTAATGAGTTTTACTTCCTTACTCTTCAACATGCTTGGGTATAATGTCT
TCAGGTGTCTGATTTCAGCTCACCACCCCATAGTTTCTGTGGCAATGGTATTGTTTATGT
TGACAGCATATTTTCTTTTTAAAAAAATATTTGTTTATTATTGGATTTTGACAGAGAGAA
AATGAGAGGGGAAGGGAAAATAGAAAGGGAGAGAAACAGAGAGACACCTGCAGCTCTGCT
TCACCACTTGTGAAGCTTTTCCCCTGCAGGGGCTTAAACCTGTGTCCTGTGCGCTGTAAG
TGTGTGCTTAACCAGGTGAGCCACCGCCTGGCCCCTTGACAGAATATTTTCAGCCACCCC
TAGTCATTAATTCAAATAAAGAGTATTCCAGGACCTGGGGAATAGCACAATGGTCATGCA
AAAAGACTCATGTCTAGGGCACCAATAGGTGCCAGGTTCAATCTCTGGTATTGCTATAAG
CTAGAGCAGAGCCGTCCATCCTATAATACAAAATAGTAACAGTTTGTTTTTAAATGAGCA
TGTTTCCCCTAAAAGTATTACTGTCCAAATTTATAAGTGACTTAATAATTTATGAGTGAT
TGTGCACTCACTGTGTCACCTCCAAGGCTGCTCACTACGACTTTTTTTTTTAACCATCTT
TTCAAATTTGCACTCTGTGTCTAACATTTTTACATAGGTTGAACAGTGAACTAACCATTT
GCCTTTCAACCACCACCCCCCCCCCCAAAGGTTCTTTTATGTGGAATGCAAGAGATTGAT
TTGAATGACTGGCAAAGACATGCTATCTACCGTCATTATACTAGGACAAGCAAGCAAATC
ATGTGGTTTTGGCAGGTTTGTCTCAAATTTATTTCTCTTGACAGACACTATAATTTTTAG
AAATTGCTTACCAAATGAGGAAATGAATCAAAGAACAAAGTGTACCAGTGTGTTTAGATC
CCTAATTTCTTCATGGCTACAGACTATAACAGCACATGCTCAATATCACAAAAACAAGAA
AAGTAAAAGGAAGGAAGGAAGGAAAGGAAGGAAAGGAAGGAAGGAAGGAAGGAAGAAAAA
AAAACATACATTGGCATATTATGCAGTTTTTACAGGAAAAGAAATTCAGGCTCAGGCTAC
AACATTGATGAATACTAAGGATATGCAACACAAACCAGTCACAAAAGGAATAGTACATGA
TTTCTGCTGTATAAATATTTATAATAGATAATAGAAGGTAATGGAGACATAAAGTTTAAA
GCTAAAAAAAATAGATTTATTTATTAGAGAACCAATGCATCTTGCTTCACTCTGGCATCC
AATACCAGGGATCAAACTCAGGACCTCATGCTTTAGAGTCTACTACTTTATCCATTATGC
TACCTCCCAAGCCACAGAAAGTATAGTGTTTACAAAGAGCAAGAGAAGGGGTAGTGTGAC
TAGATAAGCTTTGGGTTTTTGGGTTTTTTTTTTTAAATATTTATTTGTTTTAATTATTTT
TATTTTCACTTTATGGGGGTAAATGGTTTACAGTATGTTTTTATTTTTTTTTAAAAAAGA
TTTTATTTATTTATGATAAAGATAGGAGGAGAGAGAAAGAACCAGACATCACTGGCACAT
GTGCTGCCAGGGATCAAACTTGGGACCTCATGCTTGAGAGTCCAAAGCTTTACCACTACG
CCACCTCCCAGACCACAAGTTTTGGTTTTTATTTCTTTCCTTTTTCCTTTTCTTACTTTC
TTTTTTCTTCTTCTTTTCTTATGTTTTTGAAGGGGATTTTGCTTTTTGAGGGAGTTAATG
CCTTCCCCCCCTAAATATTTTATTTATTAATGAGAAAGATAGGAGGAGAAAAAGAATGAG
ACATCACTCTAGTGCATGTGCTGCTGGGGATTTAACTCAAGACCTCATGCTTTTTTTTTT
TTTTTTTTCCTCCTCCAGGGTTATTGCTGGGCTCGGTGCCTGCACCATGAATCCACCGCT
CCTGGAGGCCATTTTTTTCCCCCTTTTGTTGCCCTTGTTGTAGCTTCGTTGTGGTTATTA
TTATTGCCCTTGTTGACGCAATTCGTTGTTGGATAGGACAGAGAGAAATGGAGAGAGGAG
GGGAAGACAGAGAAGGGGAGAGAAAGATAGACACCTGCAGATCTGCTTCACCGCCTGTGA
AGCGACTCCCCTGCAGGTGGGGAGCCAGGGGCTCGAACCGGGATCCTTACGCCGGTCCCT
GCGCTTTGCGCCACATGCACTTAACCCACTGCGCCACCGCCCGACCCCCAGACCTCATGC
TTTAGAATCCAGTGCTCTACCCACTTCACTACCTCCCAAACCAGAGAGGGTTAATGCTTT
ATTTATTTTCTTAATAAATTTTTTAATGTTTTATTTAATATTGTATAGAGACAGAGAGAA
ATTGAGAGGGGAAGATAGAGAGGGAGAGAAGCAGATACCTGCAACCCTGCTTCACCACTT
GTGAAGCTTTCCCCCTGCAGGTGGGGACCAGGGGCTTGAACCTGGATCCTTGCGCACTGT
AATGTGCTCACTTAACCAAGTGCACCACCACCTGGCCCCCGGGTTAATGCTTTATAGACC
AGGCCCGTAAGGGTTGGTTTTTTTTCCCCTCCCTCCTAAACTAGAAAAGTTTAATATTTT
CATAGCTTTGGGTGGAAATATAAAAAAGTTCTAGCGATAATAGTCTTAGCTTCAAGGTAG
TCTCCAGAAATATGATGTGTTGAGTCAGTTAAAGGATTTTAAAGTTGTGTAATTATGACA
CGCATAGGTTATTTTGTTTTCTAGTGTTTTATTGGTGATTTCATAATGGTTTATAAGATT
ATAAGATTACAGGGGTATAGTCAGTCCTATATCACACCCACCACCAAAGTTGTATAATTA
CATCTGAATCAGAATTCTGTAAGCTTGATTTTTTTTATTCGTAAAGTCTTTACTGATTCA
ACCTCTGTGTTCTAAGTGAACTCCAAGAATGTCCTGTAGAACAGAGACATATAGGAGAAA
GTGGAGGGCCTTACCCAAGAAGAGCTGATCTTCTGTCTACGATGAGTAGAAAGTTGTTGG
GCCTAGGGCACTCTTTAGTTTTCTGTTACAGTTTTGATCAATAGGGAGTAATTTCTCCAT
TCACGATGGTGGGTACAGACATAATCTACTGCATCTGATATAGGAGGTCAGGATTTGAAA
TGGTCGTTTCTCTTTCTTATTTAGTGTTTTAAATGTAACATAACACCCGTGTATCTCTTT
AAATGTGTGTTTAACAGTTTGTTAAAGAAATTGATAATGAGAAGAGAATGCGGCTTCTGC
AGTTTGTTACTGGAACCTGCCGATTGCCAGTTGGAGGATTTGCTGACCTCATGGGTGTGT
ACAATAGTCACTTTTCATATAGAGAAGACTGTCACACTGCTGTTGCATCAATATGTATAT
AGCTTATCAGAAATAACAAAAACAAGTATGGACATTTTCTTAACTAGTCATAGTTTATGA
ATTTGTATATCATCACTATGGTACATACCACGGTGAACATCAAACTCAAGCCCTCATGAT
TGAGAATCCAACACTTAACCCACTGCACCATCTCCCTGTCTGCTTTCAATTGCCTTATTA
GCCCTACCTCTGTAGGAATCTTTAGCTCTTAAGCGATTTTTCATTTTCGCTTAGTAGGAT
GTCATCTTCTATATATAAATACGTTTATTCATTGGTATGTTGCACCAAAGTAAAAAATTC
TGGGGGGGGGCAGGTAAAGGTCCTAAAAAAGGATGGCAGAGGACCTAGTGGGGGTTGTGT
TGTTATGTAGAAATGTTATGCATGTACAAACTATCGTATTTACTGTCGGATGTAAAACAT
TAATCCCCCAATAAAGGAAGAAGTAAACTAAAAAATAAATATGTTCCATCGTTTGTCAAA
TATTTTAGTGTCTCTTAGGAGCCACACACTACCAGTTTTATCATATTATATTTATTTATT
TTCCCTTTTGTTGCCCTTGTTTTATTGTTGTTGTTACTGATGTCATCGTTGTTGGATAGG
ACAGAGAGAAATGGAGAGAGGAGGGGAAGACAGCGGGGAGAGAAAGATAGATACCTGCAG
ACCTGCTTCACCACCTGGAAGCAACTCCCCTGTAGGTGGGAAGCCAGGGGCTTGAACCAG
GATCCTCACACTGGTCCTTGGCGCTTTGCGCCACATGCACTTAACCCACTGCGCTACCGC
CCGGCTCCCCATACTGTATTTTTAACTATTTGTTTACCGTTTTCTCTATGTTAGCTGATG
TATGTGTATGTATATGTATACATATATGTATAGTTGTTCAGAGAGAGAGAGAGACCTGAG
CACTGCTCAGATTTGGCTTAGGGTGATGCTAAAGATTGAACCTGAAGCCTCTTGGGTATC
AGGCATGTAGATCCTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
CAAGTCAAAATTAAGAACGGCGGGGCGGGGTAATTCAACGTAACAAGTAGAAGGGCGGCC
TTGATACAAAGCCCTAGTGCCGCTCCGCAAATGGTCTCGCGCTGAAAGAAAATCTAATGA
TGTTCAATGTCTCAATACTAAATCTGTGGGGCCCAGAGACACGAGATAACTCTCAACGTG
GAGACACAGCGCCCCATACTGTTTCCCCCCTCGCTCCCTCCCTATTCATTTCTCATCTAA
AATGAAAAAAGTGGTTTGGGGCAGGGGTAGATAGCATAATGGTTTATGCACAGACTCTCA
TGCCTGAGGCTCCAAAGTCCCAGGTTCAATAGGGCAGTGCTCTGGTTTAAAAAAAAAAAG
GGGGGGGGGAATCGGGCGGTAGCGCAGCGGGTTAAGTGCACGTGGCGCAAAACACAAGGA
CCGGCGTAAGGATCCCGGTTCGAGCCCCCGGCTTCCCACCTGCAAGGGAGTCGCTTCACA
AGCAGTGAAGCAGGTCTACAGGTGTCTATCTTTTTTTCCCCCTCTGTCTTCCCCTCCTCT
CTCCATTTCTCTCTGTCCTAGCCAACAACAATGATGACATCAATAACCACAACAATGTTA
AACAATAAGGGCAACAAAAAGGGAAAATAAATAAATATTTTAAAAAAAAAAAAGGAAGAA
AAGAAAAAAGTCTGGAACAGGGAAATTATGTATAAGCAAGACCGTGCTTTTGGAAGAAAA
GGAGAAAGAACTAAATAGGTACTTCTTTATACAATGTAGAATCAGTTTAAAATTTCATAG
GGCCAGCAAAGTAATTCACTTGGATAATGCACTATTGCATTGGATGAAGCTTTTGCACTG
GTAGTGTCTTTCTCTTTCTCTGTTTCTGTCTTTCTGTCTGAAAAAGTTAATCTGCAGCTG
TGAAGCCCCAGTGATAACAAAAAAACAATTAAAAGAGACTCTGAAGATAACGGAATTACA
AAAACTATTTGAAGAGAAGAAAACTTACAGAAACTGCAACTTAAAAAATTGGACTGCAAA
ATACAATACAGATTAGAAATGAAGCAGGGAGAGCCTAGAGATAAGAAGAAATTCTTAGTA
ATCATGAGAACATGACTTCTAAGTGATAGAAAAGAATGGGCTGAGAAGATAGTGCAACTA
GACTTTGATAGTCTAAACTTAGAAGTCCTGGGCTCAATCTTCAGCACTACCATAAACAAG
AATAGAGTGGAGGTGTGCTCTTTCTCTGTTAATCTGTTATCCTAGGAAGTGAATAGTGGT
GATCTTTTATAAAACTATTATTTTAGGGAGTTGGGCAGTAGTGCAGCAGGTAAAGCGCAG
GTGGTGCAAAGTGCAAGAACCGGCATAAGTTTCGAACCCCCGGCTCCCCGCCTGCAGGGG
AGTCGCTTCACAAGGAGTGAAGCAGGTCTGCAGGTGTCTATATTTCTCTCCCCTTCTCTG
GCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTGTCCAACAATGGCAACATCAATAACAA
TAATAACTACAACAATAAAAAAACAAGGGCAACAAAAGGGAATAAATATTTTTAAAAATT
ATTATTTTAGATGACCATTCACAAAAATCGCTCATAGAGGGTAAAATGAAATGGAAGAAG
TGAGAGGGAGAGAAAGTGAGTGAGTGAGAGTGTGTGCCCTATGGAATTTGTAAGTATAAA
AATTAATATCTAATTCATTAGAATATTTACATTTTATAAAGTTTAGCAGTAATATTTTGT
CCCAGAATGTGCTCAGTAAAACTGCATTTCCTCCTTACTGATACTGTTTAACATAGTAGT
TCTCAAATGCTGATATTCATAAGAATCACTTTGAAACTTATTCAGACACATTGCTGAGCT
TTACCCCAAGAATTTGATCCACTTCAGTTGGCTTAGTGTAGAACCTGTGAGTTTGTGATT
CTAACAAGTTACCTGGTAGTAGTGATGTTGCTGGGTTGGGCATATAATTTTAGAACCATT
GCACTACTAAACTGTTGATTTTACTGTGTTTTAGGGAGCAATGGACCACAAAAATTCTGC
ATTGAGAAAGTTGGGAAGGAAAATTGGCTACCTAGAAGTCATACCTGGTAAGTAAAATCA
GAACAGTAGAGAAAATAGTATTTTTCCACTCTAGAGTTANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGGACCACTAGAGCTGAGCAGTGCTCTGGTCAGTCTCTCTCT
CCCTCTCTCTCTCTCTCTCTTTTTCTCTTTCTCTCTCATCAGTCCCTCTCTCTCTCTCTT
TCTCCCCCCCTCGTTTTTCTGTATTTCTTATTGAAATAAATAAAAATATATTAAAGCCTA
TTAGAAGTTAGAAAAAGTTTTCCCATGGTATTGAATTATTTTAACAGCTTTATTGAGTCA
TAATTTATACACTGTAGAACCATTTAATTCAATATTAGTGTACTCAACACCAATTTTAGA
AGTATTTCATCACCCTAAAATAATCCTCAATTTTCATTTGCAGTCAATTCTTTTTCTATC
CCCTTACTAAAGAAGGGTGATTAATTTTTAAAATTATCTTTATTTATTTATTGGATAGAG
ACATCTAGAGGGGTGCTGGGCTAGTGTGGGGGTGCCTCTTCCTGGGTGCATACTCTCTGG
GTTGGAGAGAACTTAACCAGAGCCAGCCTGGGCTGCTAGTCACTCAGTGACGCGAGGGAG
ATGACTCAGCAACAGACTCATGGTGGCGAGACAATGAGATTCTTTATTGATCAGAGAGCC
AAGGGTTTTAAAGGTCCTGGAAGTGGCAAGTCAGAAAGGTAAAAGGGAGCTGGAAAGGTA
GGAACTTCCATAGCAACTGTTGCAAGGGTTTTAACTGGTAGGGTTAATAATACCCTGCAG
GCAGGGAGGGTCTTGAGGGTAGAAAGAAGGTAGATGAAAGGAATGGAATGGGTGGGGATC
TTTCAGGCAAAACAATGATTATGTAGATAATATGTCTGATAAGATGAGAGGATGGATGCC
CCCTCAAGTCAATCCCTGCCAAACTCAACCACATCCTCACAATTTCCAGACAGAGGGGAG
CAGAGATAGAGAGGAAGAGAGACAGACATCTGAAGCTCTGCCTGGCCAGTTGTAAAGCTT
TCCCCCTGCAGATGGGGGACCAGCAGCTTGAGCCCAGGTCCTGTACCACCACTCACCCCA
AGAAGAATGATACTAGAGAACTTTTCTCTTTGTTAAGGAAAAAATCAAGTCTAGAGTGCT
ACATTCTAACACAGTGAACAGAGCTCGGTCTCCCTTCCTCCCTCCCTTCCTTCCTTTTTT
TTTACCAGAGCATTGCCCCGCTCTGGCCCATGGTGGTATGGGGGGATTTAATCTGGGACT
TCAGAACCTCAGGCATTTAGATATTCTCTGTAACCATTATGTAATCTCTCCACTTGAACA
GAACTTCATTATTCTACTTAGAGTTTAACCACATTTCTAAAAAAAAAATAATAATAATAA
TTTCTTTATTGGGGAATTAATGTTTTACATTCAATAGTAAATACAATAGTTGGTACATGC
ATAACATTTCCCAGTTTTCCATAAAACAGTACAACTCCCACTAGGTCCTCTGTCATCCTT
TTTGACCTATATTCTCCCCCACCACCCACCCCAGAGTCTTTTACTTTGGTGCAGAATGCC
AATTCCAGTTCAGGTTCTACTTGTGTTTTTCAACTTCTGCCTGAGAGTATCAAAGAGAGT
ACTCAGTATCAAACGAGATATATTGGAGTTTGACCCAATATCAGCAATATTTTATGAGAC
ATCTAGTTATTATATGTGGATCTTGCTGGGTATTTATTTCTTCATCTGCTTTTTCTGTTA
TATTATTTTCCCCTTTATACTTTAATACATATATAACATGCAGGTCTTTTTTGTATTTTG
GAAATTTGTTGTTGCTATTGATGTTCATTAAAAATCTAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGTCAGCTAGCAAAAAAAAAAAAAGTCAGCTAGCTGGGATTTGA
CCCCAGTTGCTTTGAGTCTGTAAGTCAATTAATTGGGGGAGTATTGTGAAGCTTAATGTA
TCCAGTCCATGAACATGGGGTATCTTTCTGTTCATTTAAGTCTTCTTTAATTTATTTCAG
CAAATATTTGTAGATTTCATTATATGTGTTCTACTTTTGTTAAATTCATTCATATTTTAT
TCATTTAAAAACTATTATAAATGGAATTTCAGGTTGTTCATTGCTAGTATATTGAACTGT
AATCAATTTTTGTACATTTATCTTATACAGGCTTGATTTGACTTCATGTTCATTGCTTTT
TTCAAACTTGGAACAAAATGTGCCACTGATGTTAGCAGTTTACCTCAGTGAGCCATGAAA
ATAAATTCTCATAACTTTGTCAAGTTCCATGTTTCCATGGGATTTGGTATTTCAACTCAG
TTGGTTTCCCTAAAATTAGTGCTGTGATATACTACAGCGATCATATGAGTCTTTGTATAT
TTCCTTTTTTCAACCTGACAATTTTCTCTTATAGTTTTAATCGCCTGGACTTGCCACCCT
ACAAGAGCTATGAACAACTGAAAGAAAAACTTTTATTTGCCATTGAAGAAACAGAGGGAT
TTGGACAAGAGTAACTTCTGAGAACTTACATCACAGAAGGACAAGAATTTATTCGCTAGT
GATTGTCCTTTTCCTTCTCTGCCTGTTGCACATCTTGTTGTAAAATTGGACTGTGATTGT
TATAGAGTGTTATCTGGGTATAAGTAAATTAATATTATCATTGAGATCTACCAGTGAATC
TGGATTGCTACTCAATGTTTCCAGAGATCATATCTGCAAATGACTAGTCAACACCTTACT
TAATATGAGATTTTAACACAGCAATGAAATCTGCCTTGTCTTATTCCACTAGATTGTTTC
CTTACTAAAATTTTGTATGTGTGTCAAAAGTCTCACTTCAAAAGTAGCTTTTTCCTTTTA
GGGTTTCTTCAGATATGCAGGGAAGTCCCTTGATTAACTTCATTATGTAATATCTTCTTA
TGCCTCTTGTTAAGAGGGTGTTGTAAGTGCAAGCTTACCCTGGCTTTTTGGGACATGAGC
AAACTTTGACTTGTTTCCTCTCTTTCATTTCAGCCTGACCTGACTGTTTTGCCTTTTCAG
AGCACGAATTCATGCTTCATTTTGTTATCCCTGGAAAGTGGTGCAAAACACTCGCATCTC
TCTATACAATAGTTTCGTTCATTTCAATTCAGGGTGAAGTTGGTCCCAGTCTGCAGATGA
CTTTTCATTTGGATGTCTGTTTGAATTGCCTTGCAAATACTAAACATAACCAATAATGTT
AACACTGTTTCCTTCACTGTCATTTATAAAAAGTTTACTAGAATTGGAATTGATCTAGAT
TCATAGAAGACTAACAATATTTGTTCCTATTTATAAATTGCATCTCCATAATTTTATTGT
AATCCAATAACTACAGTTATGTTCAATTATTACTTTGGAGTTCAAGTCTTCTAGTGCAAA
TAGAGATCAATGAAACACCCTCTTAAAAATTCATTAGGGAGGGAGAGCTATGGTGCTGGC
TGAAAAAAAGTAGTGTGTTTTTAGTGAAACGCTTCTAGTAAACACAGGAAGGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1124, 3697..3834, 7917..8039, 9917..9962, 17091..17211, 17216..17236, 17238..17253, 18009..18210, 19464..19559, 21139..21313, 28035..28104, 29922..30006, 31658..31786, 37223..37295, 38550..38587, 38589..38606, 38608..38623, 42701..42789, 45574..45733, 47265..47398, 47688..47828, 48910..49030, 49770..49874, 52277..52377, 55538..55606, 58234..58333
1001..1124, 3697..3834, 7917..8039, 9917..9962, 17091..17211, 17216..17236, 17238..17253, 18009..18210, 19464..19559, 21139..21313, 28035..28104, 29922..30006, 31658..31786, 37223..37295, 38550..38587, 38589..38606, 38608..38623, 42701..42789, 45574..45733, 47265..47398, 47688..47828, 48910..49030, 49770..49874, 52277..52377, 55538..55606, 58234..58330
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved