Erinaceus_europaeus Locus SF3B3
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SF3B3
Erinaceus_europaeus
SF3B3
GeneScaffold_8215
SNORD111, SNORD111
4066..4145, 10560..10648
49035
TTTCTCTGCAACCATCTTCATCATAGCAAGAGATTGGAAACAGCATATATATTCATCAG
GGTATTGGCTAGATAAATTTTGGTGTGTCTGTTTTATAAAGCTACTTTGCAACTATAAGA
AAAATGTGAGAAAGCCTGCTTATTCTCTACAAGATAAAATATATTTCAGCACAGTGTGAA
TTTCTAATATATGGTATATTTTAGTTAAAAATAGGGAATAATGTGCAGTATGACTGTATA
CTCTTGTATATAAAGTATCTGAGAGAACACAAACTTGGTGAAATTGGTTTTCTCCAACCT
AGGAAATGAGTGGAGAGGGCTTATTCTGTGCTGCATATTCTGAATCATCTCAATATATGA
CCTATTCAGTTGTGAGTAAATGTGGATCTGCTTAGTTTCTGAGACAGTAAATTCAAATAG
ACTGTTAACATTAGTTGGATAGCTCCTTCTAACATTTTCACCATTTGTTGCATGAATTTA
GGCAAATAATTCAATTTTTGTCTCAGTTTTCAATATATGTAAAATGGATATAATATTGAA
TATAGGTTTCTTGTGAGATTAAGGCAAGATAGCATAGTACCTGATATAGAGAAATTAACT
AATTATAAATGTGCCTTCCTATAATTGTACTGCTTTTAGCCAGAAGTTCCCATAAAAAAA
AGTCTATTGAAGGGCTGGGTGGTGGTGCATCTGGTTGAGCTCAAATGTTACAGTGCTCAA
GAAACCAGGCACGAACTCCCGGTCCCAGCTTCGGGGGAAAGGCTTTGCAAGTGGTGAAGC
AGGGCTGCTGTCTCTCTCCCTCTGCCACCTGCTTCCCTTTCAATTTCTGGCATTGTATCT
AATAACTAAATAAAGATAATGCAAAAAAAAATCTTTTAAAAAGTCTGTTGAAATAACTTT
CTAGCTAACATTTTTCTGCTTTTATGTAATTTTAGCTTGCTTTGACTCCATATGATTAAG
ACCCAGATTGTGGTGTTATAAGTGACTCCGTTGGTGCCACCATGTTCCTGTATAACTTGA
CCTTGCAGCGAGCCACTGGCATTAGCTTTGCCATTCATGGCAACTTCTCTGGTAAGTTTT
GCAACAACTCTACCACTAAACTATACCCCCACCCCCACCCCCCAAAAATACCCCAGGAGC
CCTCAAATTCAACTTTAAAATTTAGTTCGTTGGTATTTATTATTGGTTAGAGAAATTGAG
AAGGGGAGGAGGAGGAGATAGAGAGGGGAAGAGATAGACACTTGCAGCCCTGCTATATAT
ACCACATGTGAAGCTTTCCCTCTGTAGGTGGGGACTAAGGGCTTGAGGCTGGATCCTTGT
GTCTGTAATGTAGGTGCTTAACTAGGTACCACCTGGTCCCTTGATTTAGCTTTGTGCTTC
AGTTTTTTTTTTTTTTTCTAAAAACACAATCTAAAACAAATGACGGAAAAACCTTATTAA
TCATTAGAGAGCACTATCATTTATATAATGTTTTAGTTTCCAAGAGTGCTTGGGGATATG
ATTTCATCTATTAGCGGAGAACTTTTGGAAAGTAAGATAACAGAAGAATGAATTGGGAGG
TAGGTTAGGAGTCATTTTTGTGTTAGTGAAAAAACCTGCATTAGGGTAGTAGGGAGAGAA
AGAAGGTAAAGGATGTGGGGCTGGGTGATGATGTACCTGGTGGAGCACATTTACCTTCCG
CAAGGACCTGGGTTTCAGGCCCCACCCCATCTACGGGGGGGAGCTTCTTGAGTGGTGGTG
GAACAGTGCTGCAGGTATCTTTTTTTTTTTTTTGAGAGGGGGGAGGGGGAGATAGATTAA
GAGAGACACTTGCAGACCTGATTGACTGATTGTGAATCATCCTCGAAGGTGGGGAGTGGG
AGCTTGTGCTTAGTACTGTAGCCACTTAGCCAGTTGCGCCCAGCCCGGCCCCCTGCAGGT
ATCTCTTTCTCTTCTGTTTGTCTCCCCTTTCCCTTTCAATTTCTCTCTCCATCCAAAATA
AGTAAATAAGTATTAAAAGACATAAAGTTAAAAATAAATATTAAAAGGTATAAAGTTTTT
TTTTTAAAAAAAAGAAAGTGAAGGATGTGAGTTGTAGTCTGAGTGGCAGAGAAAACGATG
GCAGCATGCGCACTTAACCTGGTACCTGGTGTGCCGTTGCCGGCCCCCCCCGCCATGATT
GTAGTTTAAAAAACTTGAAGGGAGTGAGTTTAGAAATTAATAGTTTATATTAGATGATAG
CTTTAGAAGTTCTATGAGAAACTGACTCACACTGCATTACATTTTAATGTGATTTTATTT
ATTCATTTCCTTTTGTTGCCCTTGTTTTATTGTTGTAGTTATTGTTGTTACTGATGTCAT
TGTTGCTGGCTAGAACAGAGAGAAATGGATAGAGGAGGGGGAGAGAAAGCGATACCGCTG
CAGGTGGGGAACCGGGGGCTTGAACTAGGATCCTTATGCTGGTCTTTACACTGGCGCCAC
CTGTGCTCAACCCGCTGCACTACCGCCCGAATCCAATAAGTTTTTTTTTTTATTTTTTTT
TTAAAGCCATAACCTGTGTGGAATAAAAAGAGGCTTTGGAGTCCCCCGTCCCCCCCCCCC
CATTTGTTTTTTTGCCTTTAGAGTTAAGTTACCTCTGGGGCTTGGTGCTATACTATGAAT
TAACTGTGTTTTATTTTAATTTTTTAATATTTATTTTCCTATTTTGTTAGACTTGTTTTT
ATCATTGTTGTGGTTATTATTATTGTTATTGATTTTGTCAGATAGGACAGAGAGAAATGG
AGAAAGAAAGGGAAGACAGAGATGGGGAAAGAAAGACACCTGTAGACCTGCTTCACCGCT
TGTGAAGCAACCCACCTGCAGGTGGGGAGCCAGGGGCTCAAACCAGGATCCTTAAGCCAG
TCCTTGAGTTTCATGCCATGTGCGCTTAGCCCACGGCGCTACATCCCAACCCCCTTTTAT
TTTTAATTAGATCAGACAGAAATTGAGAAAGGAGGAGTAGATAGGGGGAGAGAGAGAGAC
ACCTACAGACCTACCTCGCCACTTGTGTAGTGTCACCTGGTACACCTGGTTGAGCATACT
ACCATACACAAGGACCTGGTTTGAAGCCTCTGGCTCCCACCTGCAGGTAGGAAGCTTCCC
AAGTGGTAGCAGTATTGCAGGTGTCTCTCCCACTGTCTCCCCTTCTCTCCCTATTTCTCT
GTGTCTAAAGAGAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAA
AGAGGCCACTGGGAGCAGTGGAGTAGTTGTACAGACTCTCGGACCCCAGCAATAACCCTG
GTGGCAAAACAGGAACTTAAAAGGTATAAACTAACTTAGACTTCTACAAGTTTGGCAATG
AGTGACATTATGATCCATTTAGATTGCTTTTTTGGAGTACTGACCATTCACGAATTTTAT
TATTTTTGCCTATGTAGGAACCAAACAACAGGAAATTGTTGTTTCCCGTGGAAAGATCTT
GGAATTGCTTCGCCCTGACCCCAACACTGGCAAAGTACATACTCTACTAACGGTGGAAGT
ATTTGGTGTCATCCGATCACTCATGGCCTTTAGGCTGACTGGTGGCACCAAAGACTACAT
TGTGGTTGGCAGTGACTCTGGTCGGATTGTTATCTTGGAATACCAGCCATCTAAGAATAT
GTTTGAGAAAATTCACCAAGAGACTTTTGGCAAGAGTGGATGCCGCCGAATTGTTCCTGG
CCAATTTTTAGCTGTGGTTCCCAAAGGGCGAGACTGTTTTGTTCAATGAACGGACTGGTA
TATAAGTGGCATCATCCTATGTCACAGGAGCTCTATTTTTAGGATAACAGTTCGGGAATT
GGACAAATGGTAGGGGATGGTATGGAGACATGGGTGGAGACCCATAATTGGGATTACTTC
TACGGGTATAAAGTTGCTTTCCCTTTTCAGAAACAATGGGAAAAGTAACATATCGTTTTA
ATTTCTTATTCAGTTTCAATTAGGTGTTGTCCCAGTTTTTTATCTGTAGCAAAAAGACTA
TAGTTGGTTTTTTATGTTAATTAGCAATGAATATGGTTGCTTTTATCAGCCTGAAGTGAT
GATTTATATTCATGTCTCTTCTCTGATAAATCTCTTGAAGAAACTTCTGTGTATCTGATC
AGGCCTCTAGAGGGCAACCTTTGACTGGTCTACTTTTAAGAATAAAGCTGTTATTTTTTG
AATTATCATTAAATTAAAGGCACACTGATTTTTTTAAAGTTATTGGGATGTTAAATCATT
GTTAGAATGATACTATTGTTTGCTAATGACAGCAGAATCCTAAGTTACACTGTAGAGTTA
GTACTGTTAATAATAATTTAAAAAGCCATGTGAATCTAGCTGTTCTGTAAACCACTTTAT
TCATTAACTGGAAATCTTGTATTTTGTTTCCTTTAACGATAGGTGCCATTGAAAAACAGA
AACTAGTATATATCTTGAACAGAGATGCTGCAGCTCGACTTACCATTTCATCGCCCTTGG
AGGCCCATAAAGCAAATACTTTAGTATATCATGTGGTTGGAGTAGATGTGGGATTTGAAA
ACCCAATGTTTGCTTGTCTGGAAATGGATTATGAGGTAATGGTTTTCTTTTCATTCCCTC
GGTGCTTTCTTAAGATCCCCCCACACACACAGTTAAAAACAAACAAAAAAAAACTTCATG
AGGGCCAGCTAATGGTTTACAGTAGAGTAGTTGTTGACACATATGAACAACCCTTCATGT
TCCTGTGGTAGGTGTGTGTGTCAAGGTGTATCTCAGATTTTTAAAAAAAAATTTTTTTAA
AGTATTTATTCCCTTTTGTTGCCCTTGTTTTATTGTTGTTATTGATGTTGTCATTGTTGG
ATAGGACAGGGAGAAATGGAGAGAGGAGGGGAAGACAGAGGGGGGAGAGAAAGATAAACA
CTTGCAGACCTGCTTCACCGCCTGTGAAGCGTCTTCCCTGCAGGTGGGGGGCTGGGGCCT
CGAACCAAGATCCATAAGCTGGTCCTTGCACTTGCGCCACCTGCGCTTAACCCGCTGCAC
TACTGCCCGACTCCCTTTTTTTTTTTCTTTTTTTTTTTTGCTCCAGGGTTATTGCTGGGC
TCGGTGCCTACACTATGAATCCACTGCTCCTAGAGGCCATTTTTTCCCATTTTGTTCTTG
TTGTTTTTGTTATTGTTGCCATTGGTGTTGTTGGATAAGACAGAGAAATCAAGAGGGGGA
GAGAAAGACACTTGCAGACCTGCTTCACCACTTGTGAAGCGACCCCCCTGTAGGTGGGAA
GCTGGGGGTTGGAACCGGGATCCTTACGCTAGTCCTTGCGCTTTACAGCATGTGTGCTTA
CTTAACCCACTGTGCTACCGTTGGACCCTCCCCCCGCCTTCTTTTTTTAAATTTTATATT
GTTATTTTTTTGTTGGATAGTTAAATTGAGAGGAATGGGGAGATGGAGACACCTATAGCC
CTGCTTCATTTTTCGCAAAGCTTTCCTCCTGCAGCTAGGGACCGGGGGCTTGAACCTGGG
TCCTCAAGTACTATAAGGTGCAGTCTGGGGGCCGGGCGGTAGCATAGCGGATTAAGCACA
TGTGGTGCAAAGTGCAAGGACCTGCACAAGGATCCCAGTTTGAGCACTGGCTCCCCACCT
GCAGGGGGTTTCGCTTCACAAGTTGAAGCAGGTCTGGTTGTCTGTCTTTCTCCTATTGTC
TCTCCCTCTTGATTTTATTGCCTCCAGCAATAACCCTGAAGACAAGAAAAAAAAAAAAAC
TACAGTCAACTAGTTGTGCCACCACCTGGCCCCCTGGAATTATTTTCTTTGGGGACTGTT
ATATCCCATCCTGCCAGCAGACCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATACACAGCAGACA
CTTACTTTCTATGAACTATGACCTTGGTCTAAATCATGTGGTCCGAAAATACAGTGAGCC
TTTGGAGGAACATGGCAACTTCCTTATTACAGGTACTTTTCTCAAAACTACTCTGAAGCC
CTTTGACTTGGAGATGGAGTGGGTAGGCTTAGTAATAGTGTTTAGGATCGAATCCACTTA
TAGTAATACTGAATATCTTATTTAGATGAGTGAGGGGCTGTGCTGCTGAGCTTGTTCACA
TCTTCATAATTCTACAACTCCCGTTGAATTTTTCCAGACAGGCCTAGCTCTTGTGTCTTG
GTATCTGTACCATAAATCCATTGTTTTGGAAATTAGATTTTACTTATAATCACATTGTTA
AACTCTTGTGAAAGAGTATTTTTAATTTAAATTCTTGTTGACTTTTTAAAATCATGTATA
AAGTCTCCTGGGTCCTGCAGTGGTGAAAAGTTACATGTGATCGAGTCTAGTGGTCTGGGA
GTTGGCTCAATGGATAGATTGTTGACTGTTATGCATGAGGTCCAGAGTTCAGTCCTGGGC
AACACATGTACCATTAATCTCTCTTTCTCATTAGTAAATAAATGAAATATATTTTTTAAA
AAAGATCAAATCTAGTGATGAATATATACAAAATTAGTATTTCTAATACATTTGTTTCCC
TCTGAATTAATAGTCCAGGGAGATTAGTTAGTAAACTGAATCTCTAAACCACAGTAGTTG
CAGTGTGAGAGATACTTACAAAAGTCTAGAGAGAGCATTGAATGATACCAGAAGTTTCTT
CTGGTTAAGTCTATTGGTTGATAGTGGTAATCTGAATGGAGAACCCAGAAGGTAGAACAG
ATTTGGAGAACTTGGAGTTTGTTTATGAACATGTTGTAATTTTTTTCCTTTATTGGGGGA
TTAATGTTTTACATATGACAGTACAATAGTTTGCACATGCATAACATTTCTCAGTTTTCC
ACATAACAATACAGCCTCCACTAGGTTCTCCATCATCCTTTTCTAAGACCTGTACTCCCC
TTCCCCCAGTCTTTTACTTTATAGAACATGGTTTTTTTTTTATGTATATAATTTATTTTC
CCTTTTGTTGCCGATGTCTTTTATTGTCGTTATTGATGTCATCGTTGTTAGGACAGAGAG
AAATGAAGAAAGGAGGGGTAGACAGAGGGGGAGAGAAAGACACCTGCAGACCTGTTTCAC
CTCCTGTGAAGCGACTACCCTGCAGTTGGGGAGCCAGGGGCTTGAACCAGGATCTTCCTG
CTGGTCCTTGCGCTTGGTGCCACTGGCGCTACCACCCGACTCCCATGTGTTATATTTTTA
AGATGCCTGTGGAATATCATGTGTGTCCAGTAGGTATTTAGATTATAGAGCTGAAGTTAA
CTGAATTCTGGATTGGGAGCAAAAAATTTTAGATGTCTGATAGATACCTGGACAGGCTGA
GATCACCCAAACCCTGCTTTTTTTTTTTTTTTTTTTTGTCTAGCATAACTGTCAGTAGAA
ACATTTATTTGGAATGTTTGAAATTTCAGGCAAGCTATACTGTTTTTGTGAAGGAGACCT
AAATTATAGTGTCAAATCACACTAAATTTTATTTTCTCTTAATAGTCCCAGGCGGGTCAG
ATGGTCCCAGTGGAGTGCTGATCTGCTCTGAAAATTACATCACTTACAAGAATTTTGGTG
ACCAGCCAGATATCCGCTGTCCAATCCCAAGGAGACGGGTAAGGTCTTTGGTTCCTATAA
GGAGAGGGAGATGAGTTTAATTTTTTACAACTATAGCATAGTCATCTGGTTTATCTGATA
AAAATTTTATTGTTAATTAATTTTTTTTAGCCAGAGCATTGCTCAGCTCTGGTTTATGGT
GGTGCGGGGGATTGAATCTGGGATTTGACAGAGCCTCAGGCATGAGAGTCTGTTTGCATG
ACTATTATGCTATCTACCCCGCCCCTCATTTACTTTTGATTCACCCACTGCTTTGGGGAG
GTGGCGGGGGGCTTTTGTCTTTGGCAGACTTTTCTCCCCTTTCTTTGAAAATCAGCTATT
AAGAGGGGGAGAGAGGAGAAATAAGATGAGCTATACACAGCATCACTGATGAAGCTTCCC
TTTTGCTTGGAGATCAAACCCAGGTCCTTCCACATGGTAAAATGTGTGCTCTATCAGCTG
AACCATTTACCAGTTCTCTTGTTTTTAATGAAACATAAGTATTTTAAGAAAGGCAAAACA
TTTTTTTTGAGGGGAGCTAAGAACATGTTCTAGTTCAAGACCCTGTGACATTACTGGTTT
GAAATTTCCAAAAGTTTGTACTTTGAAAAAGCCAGGTTTGCAGGTAAAGCTTATTCCTTA
TTATGCACAAGGTCCTGAGTTCAATCTCATGCATCTGTCACATGGGAGCATGGTGATCAA
CACAAAATTACTTAATTTTTTTTTTTTTAATTTTATTTAAGACTGCCGAGCTGGTGTAGT
GGCTCTGCCTGTGGATTCTGAGACAGGCAGACAGGGCTTCAGGCTCAAAGCCTATCCTCC
CCAGAAGCCAGTGGTTCACCACTCCTTGGGGAGGATGGGGGGGGGACTTTTGCGGCTGGT
GGTGGTACACCTGGTGAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
ACTTCACAAGTGGTAAGCAGTTCTGCAGGTGTCTCTGTCCTCTCTACGCGCTCTCTATCC
CTCCCTTTCCTCGCTTTCTGACTGTCTCTATCTAATAAATAAAGATAATAATAAATATTT
ATTAATTTATTTTTACCAGAGCACTGATCAGCTCTGGCTTATAGTGGTGCAGGGGGTTGA
ACGAGGGACTTTGGAGCCTCAGGCATGAGAATCTCTTTGCATAATTTATGCTGTCTACTC
CCACTCAAATGTTTATTTGGGAGAGAAAGAGCCAGAGCATCATTCTGACACATGCAGTGC
TAGGGATAAAACTCAGAATGAGTCTAGTACTTTATTCAGTGTGCCATCTCCTAGCTAGCT
CATAAATCTTTTTTTAAAATTGGGTCAAAGAGACTTCTCAGTGTATGTCAATCTCCCCTC
AAACTTTTGTTACTATCTAATACAAGTTTTTTTAGAAAATAGTTTGTCTAATATGTGGCA
TCTGAGTAAGATCCTGTACTTCAGACAGTCTGAGGAGAAATTTAGCAAGTTTTTTAAAAA
ATATTTATTCCTTTTTTTGTTTTATTGTTATAGTTATTGTTGTCATTGTTGGATAGGACA
GAGAAATGAGAGAGGAAGGGAAGACAGGGAGAGAAAGACACCTGCAAACCTGCTTCACTG
CTTATGAAGTAACTCCCCTGTAGGTGGGGAGTCGGGGCCTCAAACTGGGATCCTGATGCC
AGTCCTTATGCTTTGTGCCACCTGTACTTACCACTGCCTGACTCTCAGCAGGTTAAGTTT
TTAGTAAGGGATTAGGTGTTCAAACTTCCAAAAACTTGGTTGCTTAAACATTTGTTGAGT
ATTTGCCCGGTAAGTATACTTGCACTGTAGATTTTGGGGCTATAGAGAAGTGTAAAACAT
GTTTTGTCCGGGAAAGATCTTACTCATTGGTAATGTATAAATTATTAGAAGCACTAAAGA
TAATGTATTGGTGTATTGCACTAAACTAAAGGCTTTGGGGTGGGGTAGGGGTTCAGGTCC
TTGGAGCTTTATGGTGGAGGAGTTGAGTGTCATGCAAAAAAACTGAAAAATGTTACACAT
GTACCAACTGCTATATTTACTGTCGACTGTAAACCATTGATACCTCCAATTAAAGAACAA
GAAAGAAAATTTAAGTTGATAACCAAGAGGACTCATTTTAGGAGTCAAGGAAGCTGAAGT
TTAGACATGATGGTGAATGCTATGGATGGTAGTGCTGTGGGCATTTTAGATGTTTACTTA
CAGCCTGAAATGATGATTCTTTAAATTTCATGTCTCTTCTCTGACATTTCTCTGGAGATA
GTTTTTGCCTTACTGTTCTGATCAGGCTGTAGAGTGAAATTTTTGAGGTTTTTTTTTTTT
TTTTGCCATTCAAGCTTTATTCTGTTTTTATGTAGACAGTAGTTTTGAGCTTTTGTGTTT
TATTTCTGTGACTTGCAAATTGCTTGTTCTAAGTCAAAACTTAGATTCCAGGTGCTTTTT
AACCTTGGGTGGCATGTATGGTAAGGTAGTGATTTCCAGAAATATGAAATGCTAATTTTC
ATCATGTTGTATGTTCTTGACTTTGCTAGAATGATCTGGATGACCCTGAAAGAGGAATGA
TTTTTGTTTGCTCTGCAACACATAAGACCAAGTCAATGTTCTTCTTTTTGGCTCAAACTG
AGCAGGGAGATATCTTCAAGATCACTTTGGAGACGGATGAAGATATGGTAAGCAGACAAT
CGCTGAAGCAGAATAGAATGAAAAACAAACCATAAAACTATTAGTTATGCTTTGTCTAGT
TTGATAAAAACTTTTAGTGTCATTCTAATTTTCTATCTCCCAGCCCCCATTACCTTATAA
TTTATAAAATGCAAAAAAAAAGCTTTTTAAAAAAGATTTTGTTTATTAATGAGAAACATA
GGTGGAGAGAGAGAAGGAGCCAGACATCACTCTCGTACATGTGCTTCTGGGGATTGAACT
CGGGACCTCATGTTTGAGAGTCCGATGCTTCATCCGCTGCACTACCTCCCAGACCACTAA
AAAAATGCTTTTTCAAGTCATTTGAGGTGTTAAAGCATTTAAAGCTTGGGAATAGTATTT
GAATGTAGGGTTTTCTCCCTTTAGTCTGGTTGTCTCATAATTTGAGACTGGGTAATGCCG
CATTAGTAAGTAAAAGTAAGAGGCACTTACCATATCTACTGAAAACAGACACTACAAATG
TTATCTCTTTCATCCTGTGAACAACTGCAATTTCTTAAATATGTATAGATCAGATGTTGG
CAGATGTTTGTAAAGACCCAAGTAGCAAACATTTCCAGGTCAAATTATTCACCTCTACAA
TTATTTCACAAAAACAGCAATAAACGTAAATAGGGCAATGAGTAAATACTCTGGTCTATG
CGTGGTAGTCTGCTGATCCTTGGTTTAAATGCTAAATAACTGTCTTAAAATACTGGTCGT
CCTTCTGTGGCCTGGCATTATTTGCTTATTCTAGAATCTTTATACTCTAGGTTACTGAGA
TCCCGTCTCAAGTATTTTGATACTGTGCCCAGTTGCTGCTGCGATGTGTGTGCTTAAAAC
AGGATTCCTCTTTGTGGCATCAGAATTTGGAAACCAGTGAGTGATCTTTTTATTGCTACA
GTTTATCCTGGCTAGTGTAAAAGTTGGCAGGGGAGATATATGACTTCAGGCCATGGAACT
CTTCATTAGAAAGCTTTTGTTTCTTCAAAAACAAAAATTATACCTTCCTTTCCCTTTTGC
ATATATTCTTTTAGTTATTTTCCAGCTCAGTGGCTTAAATCAGCACCTATGGGTGGCTGC
AACAATATTTTTAATAGTGAGATCTGCTCATCAATTTTCTAGACATTTTATTGAATACTT
ATTGAACTACTTAGTTCTATCTAAGTAGATGGCTCACAAACACTTTGACTTGTACACATC
CAAAGTTGAAACTTGTCAGTACGCACAGCTGCCCAGCCACATCACCACTTCTCCTGTCAT
CAGTATATCTATAAAGACTAATGGTGCGGGACCAGACGGTGGCATACCTGATTAAGTACT
CACATTACAGTACGTAAGGTCCTAGGTTCAAGCCCCTGGTTCCCACCTGCAGGGGGAAAG
CTTCACAAGTGGTGAAGCAGTGCAGCAGGTCTTTTTCCCTCTGTATCTCACTTTCCCCTC
TCAATTTCTTTTTAGCCAATAAAAATTAAAAATTATTTAAATAAATAAAAAATGAGAAAA
GGGACCAGGAGGATGAAAATGTTAACATTTTTTAAAAAAGACTAATGGTACAATCTGCGT
ATGAAATATTGAGGGATTTTTTCTTTCCAATGTGGTTTAGGCAATGAATTCAGGTTCTTT
GCATGCATGATTATTTTTAATACTCTTATTATTGGGTAGGGGACAGAGAAATTGAGATAG
GAGAGGGAGAGAGACACCTGCAGCACTACTTCACCATTCGTGAAACTTTCTCCTGCAGGT
GGGGACCAGGGCCTTAAATCTGGGTTCTTGTGCATAGTATTGTGTGTGCTTAACCAGGTG
CACCACCACCTGGCCCCTGCACACATGATTCCACTGAGTAGCCTAGTAGGTGCACCCTCT
TATTTATTTATTTATTTATTTATTTAGTCTAGAGACTGAGAGGAGAGATACCATAGTACT
TTTCTGTCATCTGGAGGCCACCACCTCCTACCTCCATGGTGCCTCCATGTAGTGCTGCGA
CCCTCACACATTATGAGGTGTGTGGTTCTACCAGGTGAACTTTTAGTTTCTTTATCCCTG
ATTTTTTTTTTTTTTAAGTGGCCAGAAGCTCACCCAGTAGAGCTTGTACCTTAGCATATA
TAAGCTATTGGGTTTAACCTCAACATCTCTTGGGAACATCATGATACATTAGAAGAAAAG
GAAGGAGGCTTCACTCTAATAAGCAATGACTGATTCAATAATGCATGCTATGATTAGATA
TATTTTAAAGGCTTACTAATAAGACAGCATCACTCCAGCACATGTGGTGCTAGCAACTGA
ACTCAGCACCTCTTGCCTAAGAATCTTAATGCTGGGGTCAGGTAGTGGCGCACCTGATTG
AGAGCATGTCAGAGCGGCAAGGACTCAGGTTCAAGCCCCTAGTCCCCACCTGCAGGAGGA
AAACTTCACAAATGGTGAAGCAGTGCTGCAGGTGTCTGTCTCTTTCCCTCTTTATATTCC
CCCTTTCGCTTGATTTCTGGTTGTCTATCAAATAAAGATAATTTTTAAAAAATGAAAAAA
AAAAGGGATCTTAATGTTTTGGGGTCTGGGTGATGGTGTACTCAAGTTAAGTGCACACAG
TACTAAATGCAAAGACCTGGGTTAAAGCCCTTGCTCCTCCCTATCTTACAGGGGGTATGC
TTCACTAGCTGTGAAGCAGGTCTGCAAGTGCCTTTCTCTGTCTTCCCCTCCCTTCTCAAT
TTCTTTTTATTCTGTCAAATAAAATGGGGGTGGTGGGTAGGGGGGATCCAATGTTTTATC
TGCTGTGCCACCTCCCAGGCTACTGCTTAGATTTATAAAGTGTGTTATGTTTATAACATG
CATTCTTTTCAGATAGAAAATGCTTAACCAATGTCGTCTTTGCTTCTCCTCAGCTACTTA
TATCAAATTGCACATCTTGGAGATGATGATGAAGAACCCGAGTTTTCATCTGCCATGCCT
TTGGAAGAAGGAGACACCTTCTTCTTTCAGCCAAGACCACTCAAAAACCTTGTGTTGGTG
GATGAGTTGGACAGCCTCTCTCCCATTTTGTTTTGCCAGGTGTGAGTCTTTTCAATCTCC
ACAGTGAACTATGAGTTTAAAGTTTTTCACCAGTTAAAGTCTTGTCTAATAGTGAGTTTT
GTCAGTTTGTGGAATTCCTACTGTAAAGATAGAGCAGCTAATAATAGAAAATCAAGAGTT
ATTAGCCCCAAAACATTTTAATTATTATATACAAGAGAGTTTTGCGTGATGCAGAGGAGA
GAGAGAAACCAAGCACCACTGATACATGATGTGTTGGGATTTGAACTGGGAATCTCAAGC
ATGATAGGCAGCCCAATGTTCTTAACAGTTGAGCCAACTTAGGACTGTGATTGGTACAAA
AAGTCCAGTTATACAAAAGGTACAAAGTGTAAGTCTTCTGCTGCAGGTTTTTTTCCCCCC
TTTGATTTCTTTTTTTTTAGTACTATTTCTTTTTTATTGGGGAATTAATGTTTTACATTC
AACAGTAAGTACAATAGTTTGTACATGCATAACATTCCCCAGATTCCCATATAACAATAC
AACCCCCACTAGGTCCTCTGAATCCTTCTTGGACCTGTATTCTCCCCACCCACCCACCCA
CCCCAGAGTCTTTTACTTTGGTGAGATATGCCAATTCCATTTCAGGTTCTACTTCTGTTT
TCTTTTCTGATTTTGTTTTTCACTTCTGCCTAAGAGTGAGATCATCCCATATTCATCGTT
CTGTTTTTGACTTATTTCACTCAACATGATTTTTTAATTTCTTTTTTTTAATATTTTATT
TTATTTATTCCCTTTTGTTGCCCTTGTTGTTTTATTGTTGTAGTTATTATTGTTGTTGTC
TTCGTTGTTGGATAAGACAGAGAGAAATGGAGAGAGGAGGGGGAGACAGAGGGGAGGAGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTATG
CTATCTACCCCCACCCTGTTTTTAAAAATTATTTATTGGATAGAAACAAAAATTGAGAGG
GAAAGGTGGGGGCAGGGTAAAAGGAGAATTCCAGCACTGCTTCACCACTTATGAAGGTAG
AAACTTGGGCCTTGAATTAAGTCCTTGCACATTGTAACGTGTGCTCTATTATGTGCACCA
CTACCTGCCCCCCTTGTGCTAGTCTTTTCCTTTATTAACTGAAATTGTTGTTATTAAATA
AGTTAATTTCTAGAGATTTTCTCAATCTTGGTGTGTATGTGTCTATATGTACATACATAT
ATATTACATTTTTCTTAATTGCTTGTATACTTTGCATTACTATAAGATTGACCTTTAATA
GTTTGTGAATATTTATAGGTCACATTTTAACATTTAGTTCTTTAAAATACTCCCACTGGG
ATTTGTAACAGAAATTTTAAATAGGCGCAGGAATCTAAGATTGTCCATATGAAAAGTTGT
GTTCCTCACAACTGAAGGTGTGCCACTGTAGTACAGGTTTACCATGTCACTGCTTACTGA
ATTGCTGGGGTTTGAGTTTGAGTGACCGTTAGAGACCACCCTACCCTTCCTAGCTGGTTA
AATTATATTGTGAGAGCAGCATGTAGTTATTGTATTGAGGAAACAAGTCAGCGTTTATGC
ATACTTCCTTATTTTAAAAAGTCACTTTTGAAATTAACTTCTTTTTGAGAAAGGCTTAGT
CCTTTTTTTTATATATATATATTCTTCTTTTTTTTTTTTTTTTTTCCCTCCAGGGTTTTT
GCTGGGCTTGATGCCTGCACCATGAATCCACCGCTCCTGGAGGCCATTTTTTTCCCCCTT
TTTGTTGCCCTTGTTGTTGTAGCCTCGTTGTGGTTCTTATTATTGCCATTGTTGATGTTG
TTCATTGTTGGATAGGACAGAGAGAAATTGAGAGAGGAGGGGAAGACGGGGAGAGAAAGA
CAGACACCTGCAGACCTGCTTCACCGCCTGTGAAGCGACTCCTCTGCGGGTGGGGAACTG
GGATCCTTACGTCGGCTAGGAGGGATCGTCAGTTTCCCCAATAAATGGGTACTCACGGGA
TGCACCACGAGAAGGTCGATCCAATGCATCCCAGATTAATGAACAGCATGTTCTCCAGCT
GAGCACTTTCGGTGACCCAGTTTTAAAAAAAAAAAGCCATCCTACTGCTCAGCTCTGGCA
TAAGGTAATGTTGAGGATTGAACCTGGGACCTCACATGCAAATCCTGTACTCTGTCATCA
TGCTATTTTTACTAGTCTCCACACATGCCACCACCCCCCATTTGATAGGACAGAAATTGA
GATGGGGGAGATACCTGCATCACTGCTTTACCCTTGTGAAATGTCCCTCATGTAGATGGG
GATCAGGACCTTGAACCCAGGTCTTTGTGCATGATAACCTGGTCTCCTGGTCCACCAGTT
TTAATGTTGTGTCAAAGTAAATGTATGGCGTGTGCCTTGAGTATGGCTTAAAGCCATACA
AAGATGGCACATTTAAAATAGATGAGTTACATTATTTTTTAGGGATATCAGTGTATAGTG
GCTGTATACCTGCAGGAGGGGTGCTTCATAAATGGCAAAGCAGGTCTGTAGGTGTGTGTC
TTACTTCCTCTCTATCTCCTCCACCCTCAGTTTCTCTTCTTTCAAATAAAAGAAGGAACA
AAGGGTGGCCTCCACGAGCAGTGGTTCATAATGCAGGCACCAAATCTCAATAATTATGGG
GGCAATAAAACAAACATAACCTACAGATTTAAAAAAAATAATAGTAATTTAAGTCTTTCA
TTGGAAAACTTTGCCACTTTAACTGGTTTGTTCTTTCTGACTTTAGGGTTTCTTTTCCCT
TCATATAGCCTGGGCTTATCAGCCGTGTGTAAACTTAAATTGTTACCTGTGAATAATCCA
GGTTGGGTGTGACACAACTGAACATTTTTTTTTCCTTTATCTATTTCGTTGTAGATAGCT
GATCTGGCCAATGAAGATACTCCACAACTCTATGTGGCTTGTGGTAGGGGCCCTCGCTCA
TCTCTGAGAGTTTTAAGGCATGGACTTGAGGTAAGGTTGGCATTTCTCTCCAGCAGGGCA
TGGAGGGAGGCATTGACAAATTCTGCCTATGGATGGAGAGAGAAATCCAGTTACTATGAA
AGAAAAAAATGTATTTTCCCCTAATTCCATGAAGTTTAGAGTTTAAATTTCTTTTTATTA
TGTTAGCCTGAATAAGCTGTTTTTAAAAAATGCAAATGAGAATAAAAGAAAAACACTTTA
GTTCTAGATTTACTAATTACGACATAAATGTTTAAGTTAGAAAATATGTAGGGAACATTT
TATTCTGTTTCCTTCTAGCCTGGATCTTTATTCAAAGATTTTAGATACTTATATTACTGT
GTAAATGCTGTGTATGCATTTTTGTGTCTTGTCAAATTTATTCCATATATACCTTGTTGA
TTTTAGTGTTTCTATGATATTTCATCCCAGTAAATACATTGTAATTCATTAAATATCTTC
TATTCGTTTGGTAGTTATTTTCTGAAGTTCTGAACATTCGTCATGGTGTTCTCTTTTAGC
AAATGTCCTAGACTTGATTTTGTTAGTATATAAAGCTTCATGCTTTTAGAACAGTCTAGC
TCTGAGACCCACTGCCTGTCTTTATTACTTATTTTTAAAAAATCATGTACACATTGGTGG
TAAAGACAGAGAGCAAAGAGAGGGATGGGGAAGATAAAAGAGGAGAGAAAAAAAAAAGAG
ATACTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAAGCTTTACTTCCTTTTCTGAGAAACTTAGTTATGAAACGGTAAAGGAGGGATTGTT
GTGTGAACCAAGTAGTACATAGGTTTGAGGGGGGCTTCAGTTATGCCATATTGTAACTAT
TTGATAAATACAAGCTATTATTATTGCTATGTCAGGGAATTAAAAAAATTAGATTGCTAA
ATTATTCATTCATCTACCTAATATTCTTAAATAGGTTCTGATACATACAAAACAGTCTTT
AACACTAAGTTATTCCTAGCCCGTCCACTTAATTTTCAATGATCTGAGCCCAATTTTGAT
TTTTTAAAATTATCTTTATTTATTGCATAGAGATAGCCAGAAATCAAGAGGGAAAGGGGA
AATAGACACCTGCAGTCCTGCTTTCCCCTTGCAGGTGTGGACTAATGGCTTGACCTGGGT
CCTTGCATATTGTAACGTGTACTCAACCAGGTATGCCACCACCTGGCCCCAAAAGTAATA
ACCGGACTGAGATTTTTGTTTGTTTTTGTTACCAGAGGTATCACTGTTCAACTCTGGCTT
ATGGTGGTGTGGGGGATTGAACCTGGGACTTTGTTGCCTCAAGCATGAGAGAGTCCATTT
GCGTAACCGTTACGCTATCTACCCTCTGCTCTGAGCCCAATTTTGACAGACATTTTTTTA
ATTTAGATTTATTTATCTTGACATTATACATTTATTTTGACTAGATGATTTTTCTGGCAT
ATATAATACTCGGGGTTGAATTTTGATATCTTCATGAGAATTCAGTACTTTACCTACTGC
CATTTCCTAACAATTCTTAAGAGCTGTGACATTTTAATTGATTTATGAAAAAAGAGAGGT
TGAACAGGGGAAACAGCATAATAGCTATGGTTACGAACAAAGTTTTTATGTTGAGGAAAA
GAGGTCAAATTTAAGCTTATGGAAAGTAAATAGGATTTTCACTTAGATGATCTGTTTCAA
TTTCAAGTGCTGTGCTTTTTTTCTCTTTTTTTTGAGAAAGATGCAGGTTGCTTTTGGCTG
CAACAACTTCTCCCAGCATCTTGTTAAAATCTTTTCATGGGGATTGCCAATAACTCCGGT
GTTTTGGTTTGAGTTGTGTGCATGTGTGTGTGATGAGAGTATTCATCAAACACCTCTACC
ATTCATGGAGTTCTCATTTTGTCTTTTGTTACTTTGTGTGTTGCTGGGGGGGTGCATGCA
GATCTGCTTGACTAGGTGTTTTCATGCTTTTAATGTAGCATATAAAGTGAACATTACCTT
TAAGGCCTTATGTAGAGTGGTTGTGAATTAGAAGCTTAGTTCCCTGTTCACTGGATCTGT
GGTTTTTCTTTCAGGTATCAGAAATGGCTGTCTCTGAGCTACCCGGTAATCCCAATGCTG
TCTGGACAGTACGTCGACACATTGAAGGTAAGCAGACCTTTTCCAACCGTCAAAAATGAG
GGTCTGAGTGCCCTTGATAAGAAAGATTTAGGAGACTACATTCATAATCTTTCCTTCTCT
CCCTGTCACTCTCCCTTCCCCCCCCTTCCTACCTCTTTTTCTCTTCTCCCCCCCCCCCCC
ACCCCAGTATACTTTTAAAATGTATTTGCTTTTGTGGTACACACACACATACCCACCCAC
CTCTGCCTTGGATTGAATTTGGTACTTCTGAGACCTCGGACATGCAAGTGCTATGCTCCA
GCATCTTGAGTTATTGCCCTGGCTCCATAATATTTCTAAAATCACTTCATCTAGCACTAT
ATACTAGACTTTTTTTTTCCCCCCTAGCCTGACACCATGCTTTTACGGTCGTCCAAATTA
GTGTTCCATGCTTACTACTTTTTGTACTTTTTCTATGTAAAGGGATACATAGAGTGGTTG
TTAATTTTAGTGTCACAGAGTTGTCAATTTGGTGTTTGACTTTATTGATACTTGAGAAAC
TTACTAGATCTCTCATAACTTACTAGATATGTGAAGAACAGTTCTTTTTGTCTATTGCGC
TACAGTCACAGTAAAATTTAAGTTTATTCTAAGTGTTAAAGAGATTTACTAAATCAGGTT
AATCCTTTTCTGAGACTAGTTGTGTTTCAAGGAAGCAGAGATTGAATGGATCCAGGATGT
TAGAGTGAGTGGAAAAAAAGGATTGGAGAAGAGAGGGCATAGTCATTTTCCTTTTGAATC
ACTTTGGGGCTATAGGTCATTTTTATTCCTAAAATGTACTTTTTGCCCAGGAATGTGAGA
ATGGTGATTGAGACCTGACCACCAAACAACACTTTCTTGAGAAAATAGCTAATTTTTTCC
TGATACTTAGATATTTGGGTTGAATGGAACAAGTTTGGAATTGAACATAAATGGGAGAAC
TTTGCATTGGTAGAATATAGATTTTGATATTTAGTTTGCATTGAGGCAGTGAAGTCAAAT
CTCAGACAAAAGCAAAAGTGAATAGAAATTTAGGTTTATTTTAGCTGGAGATAGATACAT
CCTCACTCACAAAAGTTTTTTTTCTCATTTATTTTTACCAAAGCACTGCTCAGCTCTGCC
TTGTGGTGGTGGGGGATTGAACTTGGGACCTTTGGTGCCTCAGGCATGAAAGTCCTTTTT
GTATAGCCATTATAGCTCCTTAACCCAAGATAGTTGATTGTGTGACAAACCAACTGGCCA
TCTTTAGTTGGCCATTGTTCTTCTTTAGTTTGATGACATAACTTGTTAGCATTGCTTAGA
CTGTTTGAACTGTAAAGGTATCTTGAGATAAAACTTAGTACTTTTCCTTTTTGTTTTGTT
TTATTTCTTAGCTTAATTTTAAAATGGATTTATAGAAGTTACCACTCTTAAGCCAGCGAT
TGAGTGTCCAAAGATAGTGCATTTAGGTAATGAATGGAGAGTAAAAGCCCTGTTTTCCTG
AATCCAGTCCAATGCTCAGTTGACCAACCCTGCAGAAGAGTCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGATGTGACAAATGGCATCAGCATGTTCCCAGCACGTTT
CTCGATGTTAGAGAAGGTTTGTAGTATGTTGTATGACTGAGTTTTTTTTAAAGTATTTAT
TTATTTACTTATTTATTTTATTTTTGAGACAGTTGGAGAGAGAACAACAGAAACACCAGA
GCACTGCTCAGCTCTGGCTTATGGTGGTGCAGGGGAATTGAACCTGGGACTTTGGAGCCT
CAGGCATGAGAATCTTTTTGCATAACCATTTTGCTATCTACCCCCACCCTATGACTGAAT
TTGTAGGTGAATATTCTTCTCTAAAATATCACAATCTAAGAAAAGATCCATCTGATCGAG
TTTGCTCTTTAGTAATTAAAATTTGAGCTATCAACTATAAAAGCAGGTCAGGTTTTCTCT
GTTCATTCTCTTCAGATTTCCCAAATTACTGTTGAGTAAACATCCCACATGTCCACACAT
GCTGCAGTCTTCCTGGAAACTACTAACCTTGGCTGGTACTTGGTGATGCACACTACCAAT
ACCAAGCCTTTTTTTCTCTTCCACAGGTGGCTGGTGAAGGTGCTGATCACCACAGGTGTG
TACTTCCTGTTAGGGTCTATAATGGGGTCTTAGAGTTTCTCCAGGGAGAGGGAACTTACA
CAAAATAGTGAGAAAGCCCTGAAGTCATCTCTCAGAGGATAATTATACAGTTGCATGTCC
ACATGCATTCTCAGCGTTCCTTTGTACTGAGTGGTCTGAGGCAGGATTCAGCTTCTCTTC
TCAAAAACGTGAGGAATATGAAGATTTACTCATCTGAAAGAACCTATAGCTAGAAAACCT
TAATTTAATACTCTGCTAGATGGTTTTTCATTTTTCAAGTGTACTGATTAATGGATCTTG
TAGAAAAATTAAGTAATATTCAGAACTATAAAAGCAAGATAAGCACTGAGTAGTTTAACA
CAAAGAATGAATGAGTCTTTGTATGCTTAAATCATCTGAATGCTGATGGTTACTTTACCT
GATGCGTATTGAGCTTTAGCGTTTCATGTAGGGGAAAGAAGCATAGAACATTGCCTTTGT
GCTAACAAAGCCATTCTAGAAGGTGCCCCTAAAGCATTTATATGTTAGTAATTGTAATAA
AATAATGTAAAATCAACTTGCTGCTTGTTTACCATTCCTCCTTATGATTTGGAAAATGAG
CCCTTATTGTGGTTTTCTGCTGTAAAAGTATTAGATTATATCCATTGGGAAAAGATCTTT
GGTCCTTGTCTTTCAGCCACTCAGTACACGTGTATTCATTTATTTTTAATAATTCAGTTT
TTTTCCCCACCACCACTGGGGCTTGATGCCTGCACTACTGAAATCCACTGCTCCCAGTGG
TCATATATATTTTTTCTTTCTTTCTTTTCCTTCTATTTTGTATTGGATAGGACAAAGAAA
TCAAGAAGAGAGAGGGACAGAGACATCTGCAGACCTTCACTGCTTGTGAAGCATTCATTA
TACCCCCAACAGATGGGGAGTGGGGACTTGAACTCAGGTCCTTGCACATGGTAATATGTG
TACTTAACCTGGGACACCACCACCTGGCTCCCAATTTAATTAAAAAAAAAATTTTTTTTA
ATTTGGATAGAGACCAAGAGCAATTGAGAGGGAAGGCGGAAATAGAGCAAAAAAGAAAGG
TCTACAGCACTGCTTCACTACTTGCAAAGCTTCCCCCCTGCAGATGGGGGCTCGAACCCA
GGTTCTTGAGCATTGAAACATGGGCTTAACCAGCTGCATCACCCCCTGGTGGCCCCTCCC
CTTTAAAAATTTTTTTTTTTTTAACCCAGAGTATTGCTCAGCTTTGGTTTATGGTGGGGC
AAGGGATTAAACCTGGGACTTTAGAGCCTAGAGCCTCAGGCATGAGTCTCTTTGCATAAC
CATTGTGCTATCTACCCCTATTCCTCCCCCTCCCCCAGTTTAATTTTCTAAGATTGATTT
AGGGCCAGAAAAGTAGCATGCTTGAGTAGTATGTTACTTTGCCATGTGTTCAAACCAGGC
CTGTTTCCCATTGCATTGAAGGAAACTGGTGCTGTAGTAACTATCCCTTTCTTTTTGCCT
CTCTGTCTCAATATTTTCATCTAAAAAATAAAATAATTTATTAGAAGGAAAAGCACAAAC
GGTGCTGGTGATGAACTCAGGACCTCATGCTTGGGAGTCTACCACACCACCTCCTGGGCT
GCATACATGTCTGTTATTAGCTGAACCAAAAGCCATGCACAAATAGTCCTTACTATGTTA
TATGTGAAACAGTTTTATTTAAAATGCTGATTACAGTAAACCAAATTGATTTTATCCCAC
TAACAGGTCAGAACATTATTGTAGATTAGATCGATGATACATCCTCACCTGGTCCCTTTT
TCCCCTAAAGAACACTGATTCTGTTGAAATAGTCAAGTAACCTTAGTTCAGCTAGACCAC
ATTTGGAGCAAACAAATCCTAAACTGTGATTGATGTGGGTGAAGTGGATCAGCCAGAGGA
CTTTTGAACTCTGTCAAGGCCTCTTGGAATGTGTCCTATCCTTCTGCTCCAATTCAGTAC
CTTTTTTATTTGCTGGCCAGTTCCTTGTTTCCTTGATTTCTGTCTGATGAAGACCAGAAA
GAAGTCCATAAAGAAAATTCAACTGTAAAGTAGGCAAGCATTAACTCCTTATTAAAAATT
AGTATCTTCATGAGCTTGAAAAAAAGGCACATAGATATAGTAAACCTATAACTATGATCT
TGGGAGAGCTATGGTGGTTACTGTTGCTGAAGGATACAACTATGCTAGTGGGAGTGGTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAAGGGGAAAATTTACTAATATTACCTCCATCAATAAATAGGGTAACAAAAA
GGGAATAAATATTTTTTTTAAAAATTTAAAAAGCTATCATTCTATAATTATAGATCAATA
AATTAATTTTGAAAAGTAAAAATAAATATCTTTGTCTATGGAGGCTTAATCTTTTTTTAT
TCATCAAGTCTTACATCCCCACATAAGCTGGGGACCTTTCCTGGTTATACAGACTATTTT
TTAGTAATGGCTTGTGATTGGCTACTGATTTAATTAAATGAGTTGTAACTTGAATGTGTA
AAAATATTGTATTCAAAATTTCCTGTGCCTCTTATTCCCTTGCTTTGTACTCTTGTATCT
TTTCTAGCAACTATCTCAAGGAAATAATACCTTTTGGAGGTAATGGTGGACATGTCTGTT
CAGTGTATTTAAACAATTGAAGAAGCAGTGTATATATGTAGGCTGTTACCCTTAATATCT
TTTGGATGATCCTCTCCTTCTTGCCATATGAACAAATAAATATGTTAACAACACATTAAA
GTATCTTGGAAAATTTCTAGGAGAAAACTTGTAGTCTTATTTGCCTTGTTCTTAGCTAAC
CAACTTTGTCTTTTTCCTTTTTCAGATGAGTTTGATGCCTATATCATTGTATCTTTCGTT
AATGCCACACTTGTTTTGTCCATCGGAGAGACTGTGGAAGAAGTGACTGATTCTGGCTTT
CTGGGGACCACCCCAACCTTGTCCTGTTCCTTGCTAGGAGATGATGCCTTAGTACAGGTA
AGGATTCTCAGCTGCTTCTCTTACTTCACTTTATCCTTTCTTTGCCCTCATTGTGAACTA
GGGTGCTTATTCATTTTAATGAACTTTGCACTTTGAAAGAACTTTTAAAGGAAGTTGAGC
TTGCCTGGGGCCTACTAACTTTTTTGTCATTGACCCAAGTGATACCTCAAATGCCTTGGG
TTGTTTCCAGATGTGATACGAGTGAGGGTCATTCTGAGTGACAAGTCAAATTGCTAAAAA
GTCAGGTTTCCTTTTGTTACTGATTCTAGGTATATCTGACGGCATTCGCCATATAAGAGC
AGACAAGAGAGTCAATGAGTGGAAAACCCCTGGAAAAAAAACAATTGTGAAATGTGCAGT
GAACCAACGACAAGTGGTGATTGCCCTCACAGGAGGAGAATTGGTCTATTTTGAGATGGA
TCCTGTAAGTTACTGTATCATTCATTGTGGGTCCAGAAGGTAAACCTGTGAATAATAGTC
TGGGCGTCTAGATTGTATTCAAGAAAATTAAAGAGAGGAGCAATCTATTTGACCCTAACC
AGCTGCCCATGAAAAGGGTGTGTGTGTGTGTTGGGGGGCTCATGTATTCATNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGGGTTCTATTGGTTTCCTATACCTGAATATTGGACTACACGGTGAGCAGTCCACAG
GGTCACAGTATTGGTGCTAGGTCTCTACGTTTCATGTATTCTTTATTGCCTCCAGTCCTA
TCACCATGGCCAGCACTATGAATCCACCTCTCCCAGCACCTACTTTTTCCTTATTTTCTC
CCTCCTTTCTGTTTTATTGTGGGCGTGGGGGTGGGGATAGAGAGAAAATAGACAACTGCA
GACCTGCTTCACCCTTTGTGAGGTGTGTTCCTCTGCCCCCTGCAGGTGGGGATCAGGTAA
CTTGAACTAACCTGGGTCCTTACATATGGTGATTTGTGCACTTAACCAGGTGTACCAGCA
CCTAGCCACTTAGTGCACTCTTGTTCATTATGGACATTATCTATACTCAAGTCTTTGAAA
ATAGAATGGTGCTGTTAGATTTTTCTTAACTTGATTTAGAGAAAGAAAGCCAGGAAAGGC
TTTTGGCCAGATCTAGATGAGTTTCTCAGGAGTCATCAGTAGTTCTCAAAATGTGCAACT
TTTGAAAATAATACGTCACAATTCATAATGGAGTCCATTGCAGTAAAGCATCACTGGCTA
CAATTTAGCAGTTAGTTAACATAAACCATGGCTTCCTGTCATTAAAAGTAGGAACTTGAG
AATCAGATAGTGTTGTGTTGTTAAATGCCTATTTTTCATTTTCTTTAATGATTACTTACT
CAGTTATATAAATAACCATTAAATCAGTTTGATGGGAAGTTAAATAAAGTAGACAAATAT
TCTAACATGATGTAAGTGGGATAAACAAACATGAACTTCATACTTTTTAATTTAGAAGAT
CTCAAATGTGTCCAGAAGTTAGGCTACTATGTAGTGAACCTTCATATATCCATCACCAAT
TAACAAAACTGCATTTTTCTTCTTGCTTTATCAAACCTATCTACCCCCCTTTTGGGGGGT
GTTGGGTAGACTTGGAAGTATTTTATTAGCAAATACAAGAATAGATAACGTTCACTCTTT
TTTTTTTTTTTAATTACTGGGTAGAGATGGAGAGAAATTAGGAGAGGGACAGAAAGACAT
CTACAGCTTTGCTTCACCACTTTTGAAGCTTTCCCCTTGGGGTTGGGGACTAGAGACTTG
AACCCGGGTCCTTGCACTCTATAATGTGAGTGCTTAACCAGGTGTGCCACCATCTAGTCC
CATTCCATCTATTAATACCTGAGAAGGTAACTCTTAACAGATGGATGTTTCAGGTCTCCC
TGTCCCCCAATTTAACAGTTGTTCAAGAGTTTATCATTGGGTACATTGGATATGCTTTTT
TTTTTTTTTTTTAATGTTTCCATTTGGGGAGTTGGGTGGTAGCACAGCGGATTAAGCACA
CGTGGGGCAAAGCACAAGGACCAGCATAAGGATCCTGGTTCGAGCCCCTGGCTCCCCACC
TGTAGGGTTTGCTTCACAGGCGGTGAAGCAGGTCTGCAGGTGTCTATCTTTCTCTCCCCC
TCTGTCTTTCCCTTCTTTCTACATATCTCTGTATCCTATACAACATGATAACAACAATAA
CTACAACACCAATGAAAAACAAGGGCAGCAAAAGGGAAAATAAATATAAAAAAAATTTTA
AAAAGGAAATCAAAAATGTTTGCATTTGGTTCCACTCATGATTTAGCAGAAAGTTATCCC
ACAATTTGTACTTGCTTAATCAACCTTTTTGCTCTTTTTCATTCTGCTCCTTTCTGCCTT
TTTTTTTTAACCAGATTTAAAAAAAAAAAAAAAAAAAAGATTGCCGTGCAGGATTTCCCA
CCTTCTGAGTTTGGCAAAGTCATTTCATGTGTTTATTGTTTTTCTTTTTTGTATTTCCTG
TAAGCTAGTGGTAGATTAGAAATATAATGCAGGGGTTGGGCGAAAAGCGCAGTGAGTTAA
GCACACATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAAATACTTGTGTGGATGT
GGAGAGGGGAGCTCAAGACCTGACCCTTCCTAAGATAAGCCGTGCTCTTAACTGAGTGTG
CCATCACACTCTTCAATAATTTTATTTTTATTGTTGAACAGGGCACAGTTCGTCTCTGGT
TTATTGTGGTGTGCGAGATTGAATCTGGGACTTTGGAGCCTCAGGCATGGAAATCTCTTC
CTATCGCTCCGCCCTTTTTTTTCTTCTCTTTTTTTTTGTAGTGGTGCTAGGGATTCTTTC
TGGAGCTTTGGAGCCTCAGAGAAGAAGATATTTTTGCATAACCATTATGCTATCTTCCCG
GTCTCAATAATTTACTTTTACTAATGAGTGAGTGAGCCTGTGTGTGTGCAGGAGAGAGGA
CCAGAGCATCTTGCTGGCAAAATACTGCTGGTAATCAAACTCAGAACCTTATGCTAGAGG
ATCCAATTCTTTATCCACTTTGCCACTTCCTGAGTAAGAGTTAGTGGTTTAGCACCTCCA
AAGAAAACAGGATGAAATTTCTCTTTTCAGATTTTTTTTTTTCATTAGTGAAGCGGAGGG
AGTAGGGAGTAAGAGATGAAACCTAGAGCTGTGTTCTAGCATGTATTTTGTTGGAAGAGT
AACAGACATGGTGAAACAAAAAGAAGCTGAGTGCTTTTTCGCTAGTTGAGTGACTTAGTG
GAAATAGGAATGAATGGTTAAACATAGTTTTTAAATCACCAAGTCATTTCCTTGCTTTTG
CTCTGAAAGTATTATGGGCATTTCCTTCATGGACAACTTTAACCCATTCCTCTCTTTACT
AGAATGGTGTGCTATTGAGAACGGTCCTGGACCCTGTCACTGGGGACCTGTCTGATACTC
GTACTAGATATCTTGGTTCCCGCCCTGTGAAACTCTTTCGTGTTCGGATGCAAGGACAGG
AGGCAGTAAGTAACGAAAGGGGCAGGTTGCATGTTTGTTAGTGACATCATTTGAGAAAGA
TCCCCTGGTAGAAGCCTTTTGGATATTTCACTAGTGTATTATGTGTTGGCTCTGTTTGAC
TAGTTAGTTTCCTTCATGTGGAAACTCTTGTGTCCCTTAATTCAAAGCTCCTTAACTCTG
GTTCCTTAACTTGATGATGTCATGATTTAGTTATTGAAATGTCAATCCCTTTGATCCTTA
CACTGGGCAAATGCAGGGAGCTGGGAGTTACCTGGAAAACTAATTTAGGCACTACCTGAG
CAAACTTGTATCAATATGGCTTATAAGACAAAGCATACCCTCCAATAGCAATTTTATTGT
AACAATAACCCAGCTGTTGAACACCCCCATTCCCAGGACCTACAGTTTCCAGGAACATAA
ATCTTTTAATATAAAAGAGGTTGCAAGATTTTTTTTTCATTGTAGCTAATTCTTGGGGTT
TCTGAGTGTTATGCTAATTTTTAACTATCCTCCAGATAGTAGCCCCATTTTATATGGAGG
TGTGGAAAGATTGGCTAATTAAACTAGGTCACATGAATACTAATCCAAGTGTTACTGGTT
TTGGTCCTTTGAAAATTGGTTTCGAGTGAGAGGAAAAAATAAATGCTGCGGATTATTCTC
TAAACCTGAGTCATGATTATCCTAACTCTTTCGTCTGATTTTTTATCTTGCACAGAGTAC
TTATGGATAAAATATAGGTAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNACCTTTTTGCTCTTTTTCTTCTGCTCCTTTCTGCCTTTTTTTTTTAGCCAGATTTAA
AAAAAAAAAAAAAAAAAAGATTGCCGTGCAGGATTTCCCACCTTCTGAGTTTGGCAAAGT
CATTTCATGTGTTTATTGTTTTTCTTTTTTGTATTTCCTGTAAGCTAGTGGTAGATTAGA
AATATAATGCAGGGGTTGGGCGGTAACGCAGTGAGTTAAGCACACATGGCACCAAGCACA
AGGACCGGTGCAAGCATCCTGGTTCGGTTCGAGCCCCCAGCTCCCCAACTGCAGGGGAGT
CGCTTCACAAGCAGTGAAGCAGGTCTGCAGGTGTCTTTCTCTCCCCCTGTCTTTCCCTCC
TCTCTCCGTTTCTCTCTGTCCTATCCAACAACAACAACATCAATAATAACTACAATAACT
ATAAAAAATTAATAAATAATAATAAAAGGAAGTATATTGCAAGCTACATGTGTGGTTTAA
ATTTTTCAGTAGCCACAAGAAAGGAAGAGATGATGTTGATTTTTTTTAAAAGAAGTTTTT
TTTGTTTGGTTGGTTGGTTTTTAAAAAATATTTATTCATTCCCTTTTTTTGCCCTTGTTT
TATTGTTGTACTTACAATTGTTGTCATTGTTGGATAGGACAGAGAGAAATGGAGAGAGGA
GGGGAGAGAAAGATAGACACCTGTAGACCTGCTTCACCGCTTATGAAGCGACTCCCCTGC
AGGTGGAGAGCCAGGGGCTCAAAGTGGGGTCCTTATTCCTGTCCTTGTGCTTTGTGCCTC
ATGCGCTTAACCCACTGTGTTACCGCTCCCTTTGTTTGTTTTTTTAATATTTATTATTAG
ATAGAGATAGAGAACCATTGAAAGGAGTTAGAGATAGGGAGAGTGTTGTTAAAGTTCGGG
AGCTCCAGCATGCCGGGCTGGCGTCGCGGCAGTGGAGAGAGACTCGGCGACACACGGCTG
GGCTGAGAAGCTGCAGTTTAACCTTTATTCACAAACGGGCAAATCACCACACCATGTGCT
TCCCAATCATTCTCCTGGGACTCTGCCCATCCTTAGCATAGGGGGTGGGGAGGAAGGGGG
CGCGAAACTAGCAAGGGCCAAACCAATTCTCTCAGAGTTGGAAGGGGAACAAACCAATAT
GAAACATAGCAACAGGAGAGGAAGACAGAGAGACATCTGTAGCCCTACTTCACCACTTGT
GAAACTTTCCTCCTACAGGAGGGACCGGGGGCTTGAACCTATGACCTTATGCACTGTAAT
GTGTGCACTTAACCAGTTGCGTCACTGCCTGGCCCCAGATGATGTTGATTTTAATGTTTT
ATTTACCTAACATACCTAAAATATTTCATCTTGTAATCTGTGATAGCTAAGCTGTTGTGT
ATTTATGTATATGTATGGTTATATATGTAAATATATTTGAAATATGTTTTATACTTATTT
TTTTTAAATCTTTAACTTTGGGGTTTAGATGGAAAGAGATGGGTGTAAAGAGAGAAACCC
GCAGCATGAATTATTTATTCTTGTGAAATACTCCTCTGCATGTGGGGAGTGGGGGCTCAA
ACCCAGATCCTTGCACAAGGTAAGAGGTGCACTTAACTGAGTGTGCCACCACACACCTCA
ATTATTTTATTTTATTTATTTACCAGGGCACTGCTCGGCTCTGGTTTATGGTGGTGTGGG
AGATTGAATCTGGGACTTTGGAGCCTCAGGCATGGAAATCTCTTCCTATCTCTCTACCCT
TTTTTTTCTTCTCTTTTTTTTTGTAGTGGTGCTAGGGATTGAACCTGGAGCTTTGGAGCC
TCAGAGAAGAAGATATTTTTGCATAACCATTATGCTATCTTCCCGGTCTCAATAATTTAC
TTTTACTAATGAGTGAGTGAGCCTGTGTGTGTGCAGGAGAGAGGACCAGAGCATCTTGCT
GGCAAAATACTGCTGGTAATCAAACTCAGAACCTTATGCTAGAGGATCCAATTCTTTATC
CACTTTGCCACTTCCTGAGTAAGAGTTAGTGGTTTAGCACCTCCAAAGAAAACAGGATGA
AATTTCTCTTTTCAGATTTTTTTTTTTCATTAGTGAAGCGGAGGGAGTAGGGAGTAAGAG
ATGAAACCTAGAGCTGTGTTCTAGCATGTATTTTTGTTGCAGAGTAACAGACATGGTGAA
ACAAAAAGAAGCTGAGTGCTTTTCGCTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGCTAATTAATCTAGGTCACATGACTAGTAATCCAAGTGTTACTTGTTTTGGT
TCTTTTAAACTTGTTTTCTAGTGAGAGGGGAAAATAGATCCTGGGGATTATACTCCCAAC
CTTATTCTTGAGGATCCCAACTCTTTCCATTGTGTTACATCTTGGGCTGTGTACTTCAGG
CTTTTTTTTTTTTTAATTTTTTTTAAATTAATTTTATTTTTGAGAGAGATGAAGAGAGAG
AGAAACACCAGAGCACTGCTCAGCTCAGGTGGTGCGGGGGATTGAACCTGGGATTTAGGA
GCCTCAGGCATGAGAGTCTGTTTGCATAACCACAATGCTGTCTCTCCCGCCCGTACTTCA
GGCTTTTAACAAATACTAACTTACACTACCTTCTCTCTAAACCTAGCCTTTTAGGTTTCT
GAAATTCCTTGGAATATTCCATGGACTGGAATTGGGAGTTTAGCCAGCATACTATATATA
TATGTATATATATTTTTTTCTTTACTTTTTATCAGAGCACTGATCAGCTCTGGCTTATGG
TGGTATGGGGGATTGAACCTGGGATTTTGAAACCTCAGGCATTAGAATCTCTTTGCATAA
CCATTATGCTACCTACCCCATTCCTCTATATTTTCCCTGAGCCAATTGCAAGTGTTGTGC
TTTCTTCAGGTGTTGGCTATGTCAAGCCGATCATGGTTGAGCTATTCTTACCAGTCTCGT
TTCCATCTCACTCCACTGTCTTACGAGACCCTGGAGTTTGCATCTGGTTTTGCCTCTGAA
CAGTGTCCTGAGGGGATTGTGGCCATCTCCACTAATACTCTGAGGTGAGTGGCTTGGAGG
GAAATGTTTCTGGAGAGGACTTGGGCCAGGTTTTGCCAGTGTTGGAAGAAGCCATAAAGA
GATGGCAGAAAACCAACTTTACCATAAGACTAGTGTGTTGAAATTGAAACCTTCCATTTG
GCTCATGAGTTAAGTTCCTGGTAGCCAAGTTTCGGTGTTTTTTATTTTTTTAATCAGTAT
TGCTCAGCTCTGGCTTATGGTGGTGCGGGGGATTGAGCCTGGGAATTTAGAGCCTCAGGC
ATGAGAGTCTGTTTGCATAACCATTATGCTATCTACCCCCCCCCTTGGTGTTTTTTATAT
TTAGCTTGTGTTTATACTTTCAGGACTAAATTTTAATAGTATAGTTCAGTCTTCCTGAGA
CTCAAGGACAATGACATTAAACAGTTGTAGAGTGGGCATTGACCTTTTTTCTGATTTGTT
ATTTCTAGTATTACATCTTGACATCTTGAGTTTTAGCTTGATTATAAGGTGTTTTTTTTT
TTTTTTTTGGCAAGTTTACAGATTTATTGGTACTGATAGTGATGGAGTAAGTGCTGCCTG
TAGTACAAAATCTATTCACTTTGGCTTTTCCAAATTTTTGCTAATGGTTATTTTATTATT
TTTACTTGGATAGAGACAGCCAGAAATTAAGAGGGAAGGGGTAATAGGGAGACAGACACT
TGAAACATTTTTTTACCACTTGCAAAGCTTTCCCTCTGCAGGTAGAGATGGGGACTAGAA
CCTGGGCCCTTGCACATTGTAACATGTGCACTCAACCAGGTCAGGTACACCACCACTCGA
CCCCTAAAATGAGGAAAAGAAACAGGGACATCACTGTCACATTTAATACCTGGGCTTGAA
CTGTTATTATCAGAACTATTATTATCAGAACTATTATCAGAGGAATACTGAGCTCTGGTT
TATGGTGGTATGGGGATTGAACCTGAGACCTTGTAGCCTCAGGCAGGCTAGTCTGTTTGC
ATAACCATTATGCAATCTATCCTCATCTTTATTATTTTTTTTACTAGAGCATTGCTCAAC
TCTGGCTTGGGAGAGGGTGGTATTGGATTTAGTACTTTAAAGCCTCAGGTGTAATCATTA
TGCTATCTCCCCCACTCTCCACTTTAAGAAAAGTTTTAATAGTATCCCTGGAGGTGGTGC
AGTAGCTAAAATGTTGGGCTCTCAAGCATGAGGTCTTGAGTTTGACCCCTGGCATCATAT
AAACACAGTGATAGTCTGATTCTCTATCTTCCCCCAATAAATAAGACAGGTGATAAGTGA
TTTTTTTTTGAATTGTCAACACATGTTGTGTATACTCTGTTTATATCTATCAACTACCCC
CCAGTGGACTGTGACCTCTTAGCATAGGAATCAAAAATAAAAAAATTACCACTAAGAATG
CAAGCGCTGGGTCCTAGTGATGATCCTGGTAGCAATAATATATATATATATTTGTTTATT
TACTAGTGAAAGTGATAAACAAAGACCAGAGTACTTCTAGACCTCTGGCTTATATTAGTG
CTGGGAGTTGAACCCGGGACCTCCGAGCCTCAAGCATGAAAGTCTTCTATATCTATTATG
CTATCTCCCCAGCCCTTCATTGTTTTTATTTATTTTCCCTTTTGTTGCCTTTGTTGTTGT
TGATATCATCGTTGTTGGATAGGACAGGGAGAAATGGAGAGAGATGGGGAAGACGGGGAG
AGAAAGATACCTGCAGACCTGCTTCGCTGCCTGTGAAGCTACTCCCCTGCAGGTGGGGAG
CCGGGGGCTCGAACCAGGATCCTGACAGTGGTCTTTGCACCATGTACACTTAACCCACTG
TGCTACCGCCCAACCCCCCACTATTATTATTACTATTTTATACCAGAGCACTGTTCCTTT
GTGGTTTATGGTGGTGCGGGGATTGAACCTGGGACTTCGGAGCCTCAGGCATGAGTCTAT
TATTATTACTTCATTTCTGTTTGTGGAATGGGGCCTTATATATATGTGTGATTTCGCCAC
TCTGGACCACTTTTTTATTTGGATGTGGTGGGAGACACCATAGCATTCCTGTTGCCATAG
CATGTGGTGATGGGCTGAAACCTCTCTGTGCACATGACAATTAAGGTTCTCTACCCAGAA
AGCTATCTTCTGCCCCCTTCCTGGAACTCCTTGTCAGCTATGTCGAATCCTCTGGAATGG
GCTGCTATTTAGTGTTGCTTCATACTGACATTAGAGCTTCAGGGATTGCTGTGTTTGCTG
TGATTGCTCATGGATCATTTCAGGACAAGTTTCTAGACCTTGTGGGTGACCTTTTAACTT
GCTTGTCTTTTCCCATAGGATTTTGGCGTTAGAGAAATTAGGTGCTGTCTTCAATCAAGT
AGCCTTTCCCCTTCAGTATACACCTAGGAAATTTGTCATTCATCCTGAGAGTAATAACCT
TATTATCATTGAGACTGACCACAATGCCTACACTGAGGCCACAAAAGCTCAGAGGAAGCA
ACAGATGGCAGAGGTAATGAGACTGAGCTTCAGGTTCAGTTAAAAAGCATGAGAAATTTA
AAACCTATTTGTTGATTACATTATTTGTTTTATTTAAAAACCCTGACTTTAAGTTTTTTA
AGCTCTTGAGTCCTTGTTTAATTTTTTAACCATAGCACTGCTCAACTCTGATTTATGGAT
TAATCCATTTTAATCCGGATTAAAATCTGATCCCTCTCTTAAACCCTCTTCATTTCTGGA
ACTTTCAAAAGTAGCCTGTAAAAACTTTCCTGGATTTGGATTCTAAGAAAATGTCTTTCA
TATTCTCCATAATTCTAGCCCACTCCAGAATTGATTTCCCAGTCAAAAAACAAATATCCT
CACCATGTAAATCTAACTGGTTTAGGAGAGGAGGTAAATAGTCGTAGCAAAGGAAATAAA
TGGTTTAAGTAGTAAAATGGCATTTTCATTCTTTGTTTATCAAAGCACCGATCAGGTATT
TGCCACAACAGATTCTTTTGGGCATTAAAAAAGAAATGCCTGATTTTTACTTTATTGTTT
CCCCTCCCTCAGCTGTACATCTTAATCTAATCTTTATTTTAGGTAATCCTGCTTTTGATC
CAAAGACTTCTGTTTATCTGCTATAAGTCCTTGGGGGGGGGGGGTTGCTTCTTGTTCACT
TCTCATTTAGCACCCACCTGAACTCGGCAACGTTTCCTTTTGTTTGGATTTAGGAAATGG
TGGAAGCAGCAGGGGAAGATGAGCGGGAGCTGGCTGCAGAGATGGCAGCAGCATTCCTCA
ATGAAAACCTCCCAGAATCCATTTTTGGAGCTCCTAAGGCTGGCAATGGGCAGTGGGCTT
CTGTGATCCGAGTGATGAATCCTATTCAGGGCAACACACTGGACCTCGTCCAACTAGAAC
AGAATGAAGCTGCCTTTAGGTAAGGCGTCCAATGTGATCCAGAGCTTTGGAGCCTGGGGC
AGAAATATTCTGACAAGTGACTAATACCAGGCTCTGCTTCTTTCTCTTGTGTACAGTGTG
GCTGTGTGCAGGTTCTCCAATACTGGTGATGACTGGTATGTGCTGGTGGGCGTAGCCAAA
GACCTGATACTGAACCCCCGATCTGTAGCAGGAGGCTTTGTATATACCTACAAGCTTGTG
AACAGTGGGGAAAAACTGGAGTTTTTGCACAAGGTAAGAACCAACCAGTAGTTCTCTGGA
TCTTAGATCCTACTGTGCTGTCTTACCTTTCCTTAAGTTGTGGGTCAGAATCTGCTGTTT
GATTCTGTATCTTGGTGCTGCACAGGAAGTGCTGGGGTATTCATTGCTCCAGTGATGTTC
TGATGCCTATAAGTCCCACAGGAAGCCTGTTGCTAACTGCCATAATGGGGAGATAGATGC
ACACTGAATTGACCCGTTGTTTAACTAGGCTTACTAAGCAGGCCAAAATCCTACAGTTCT
AAAGAATGTATTCTTTGAGCAGTGAATTTTATGGGGGTGCAGTTTTCATTTGAAAAGATG
AAATGTCCTGGGGATGGAGCGTTGTGGTGGTTGCACAATAATATGAATATGTTTAAGGCC
ACTAACTGGATGCCTCCACACTGCAACATGTGAATTCGACCCCTACAGCCCTTTTTTATA
AAGGGTGTGTCCTCTAGGGAATAATTACTTCACATAGCCTTCTTTGTGCTAAACTCACTT
TTCTCCTACAAATGAGCTATGTCACTTATCTAGATTCCTTTCCTTTTCCTCAACAGACTG
CAGTCATTTCTTAGATATTGAGGCTTTGATTAGGTAATGACAGTGCCATTTTAACTAACA
TTAGCTCTGGAGCCAGTCCTTATTAGACACTAGACCCTTTCCACTGTTGTTTGTCTTCTC
TTTCTCCTCCCTCCCCTTTTTTGTTTTTCTTTCTTCCTTTCTTTTTTTTTTTTTTTTAAA
GATTTTATTTATTTATAAGAAAGGGGAGAGAGAAAGAACCAGACATTAATCTACTACATG
TGCTACTGGGGTCTGAACTCAGGACCTCATGCTTGAGTCCAGTGCTTTATCCACTGCATC
ACCTCCCAAACTACTCTGTTTTCTCTTCTCACCAGAACACTGCTCAACTCTCTCTTGATG
GTAGTGTTGGGGATTGAACCTGGAAACTTGGAGTTTCAGGAATGAAAATCATTTTGCGGG
AGTCGGGCGGTAGCGCAGCAGGTTAAGTGCACGTGGTCCTAAGCGCAGGGACTGGAGTAA
GGATCCTGGTTCGAGCCCCCTGGGTCCCCACCTGCAAGGGGGTCCCCACCTGCAAGGGGG
TCACTTCACAGGCAGTGAACCAGGTCTGTAGGTATCTGTCTTTTTCTCCCCCTTTCTATC
TTCCCCATCTGTCTCCATTTCTCTCTGTTCTATCCAACAACAATGACATCAGTAACAACA
ACAATAATAACTACCACAATTAAACAAGGGCAACAAAAGGGGATAAATAAATAAACATTA
AAAAAAGAAGGAAAAGAGAAAATCATTTTGCCTGTTAGGCTGTTTCCACGGCTCATTATT
GGGTCTGCTTATTAGATGAAATAGAGCCTGTGAAACCTTACTCTTAAACATTTCTGATTT
TGTAGAGATGTTTGTTTGTTTGTTTATTCTGCCTCCAGGGTTATCGCTTGGGCTTGGTGG
CAGCACTACGAATCCACTGCTTTTGGTGGTCATCTTTTCCCCCCCATTATTATTGTTGCT
GCTGTCATTGTTGGGTAGGACAGAGAGAAATTGAGAAAGATAGACACCTGCAGACCTGCT
TTACCCACTTTCAAAGTGTGCCCCTGCAGGTGGGGAGCCAGGGGCTTGAGTCAGGATCCT
TGTGCTTCGTACTATGTGCACTTATTCCTGTATTTTTTTTTTCTTTTTTTAAGGTTAACA
TGGGAGAAAGAGGAGAACCTGTGCATCACTCTGGCAGTTGGGGTGCTAGGAACCTTATAC
TTACGGGTCTCATGCTTTAGCCACTACACCACCTCCCAGACCTGGTCATATGTCTTAATA
GTTGCATTACCTGCTTTTCTTGTTACAGACTCCAGTAGAAGAGGTTCCTGCTGCCATTGC
CCCATTCCAGGGGAGGGTATTGATTGGTGTGGGGAAGCTTCTGCGAGTTTATGACCTAGG
AAAGAAGAAATTACTGCGAAAATGTGAGAATAAGGTAAATATATTAATAGAGCGCCTTGG
ACCTAGCTAGTGAGGGGGCAGGAGTAGGTAGGGATGTGAATGTGTCTTTATATGGTCTTG
TTACGGGCCCCTAATTCTACCCTTGAGGTTGGAGAAGGGCAGGAAGCATGCGCTCGTGTA
TGTGTGTTTTAAGAGTTGGAGTTTGGGGGCCAGGGTGTTGGCACAGCAGCTTAAGCGCAC
ATAGCACAAAGCACCTGGACCAGCATCAGGATCCCGGTTCAAGCTCCCAGCTCCTCACCT
GCAGGGGGTTCGCTTCACAGGTGAAGCAGGTCTGCAGGTGTCTTATCTTTCTCTCTCCGT
CTTCCCATCCTCTCTTGATTTCTCTCTGTCCTATCCAACAACGACAATGATAAACAACAA
GGGCAACAAAGGGGGGGGGGTTGGGATTTGCCATATTTGCTACTTAGTTCTTTTTCACCT
GGGAATGTATTGCTCATTGCTGTTTTTTTTTTTAATTTTTTTTTATATTTATTTTAAATT
TATTTATTCCCTTTTGTTGCCCTTGTTGTTTTATTGTTGTAGTTATTATTGTTGTTGTCG
TTGTTGGATAGGACAGAGAGAAATGGAGAGAGGAGGGGAAGACAGAGGGGGAGAGAAAGA
CAGACACCTGCAGACCTGCTTCACCGCCTGTGAAGCAACTCCCCTGCAGGTGGGGAGCCT
GGGTTCGAACCGGGATCCTTATGCCGGTCCTTGTGCTTTGCGCCACCTGCGCTTAACCCG
CTGCGCTACAGCCCGACTCCCCATTGCTGTTTTTTTTTAACTGTGCCATCATCCAGCTCC
TACATCTGTTGAGTTGGGGATGGCTGGGATTTCTGTGGGGTCAGAACCCAAAGGTTACAC
TCATTCTACTTGTATTACCAGCATATTGCCAATTACATCTCTGGGATCCAGACTATTGGA
CACAGAGTAATTGTGTCTGATGTCCAAGAAAGTTTCATTTGGGTTCGCTACAAGCGTAAT
GAGAACCAGCTCATCATCTTTGCTGATGACACCTACCCACGGTGGGTCACTACGGCTAGC
CTCCTTGATTATGACACAGTGGCTGGAGCAGACAAGTTTGGCAACATTTGTGTGGTGAGT
TGATGTTGAATTTAGTTTTAGTGGTTTGTGGGAAACCTGACAGTACTGACTTCTAATATG
GAAAGTAAAAAGTTCAGTCTACTAAGGCCAGCTCTAAAAAGAAATGTGTTCTTTAAGCCT
TTTTGCAAGTCTTTTAGGAGTTGCCCCCCTCCCCACACACCCTTTCCTCCCCCATGGAAC
ATGATTTAGTAATGATAGATTTAGTTTGTGTTAATGACTAGTACTTATTTTCATTGGCTT
ACCTTTTTAAGCCAAGACTGTTTTCTTTTATGTTTTGTGGTCTTTTGTGTTTTACTCTTG
CTGTAAAAACCCTTTGCTTATGGGTTGATTTGCTTGAATTTCTCTTCAGACACCAGACAG
GTGCAGGAGACTTAAACTTGGTCTCTGAGGGGCTATACCTCTAGTCTTGCTTGCAAGGAC
TTAGGGCAAGCATATTGCTTGGTGAGCAGATATAGGGCCCAACCTTGTGCTTTGTGTCAA
TTCCTTATAGGTGAGGCTTCCACCTAACACAAATGATGAAGTTGATGAGGATCCCACAGG
AAACAAAGCCCTCTGGGACCGAGGCTTGCTCAACGGGGCTTCTCAGAAGGTAAGATATTC
AAGAGAGAGGCACTAGCCTACATATGTTCCTTGTGACTATGGTGATTCCCTCATGATGCT
CTTTAGTGAATTATCCAGTGCATATTACTGTGTTAAGTTCTCTCCTATATATGGTCCTTT
CCTCTTGGGAAATCCTAAGGTGATGCAAAAGGTCACCACCATAAGATGACCAAGTTGCTC
TCTTGTCTTAATGACTATGGAGTATGACAACTTAGCAATGTAAGATACATGTGGAGAATA
GCAAGTTCTGTTAGAAGGCGGTTGTATAGGTTTATTAGTGGTACTGACCAACCTTCTCTG
GCTGTGTCTAAACTTTACTCTAGTTGGCATGTACTATTTAGGTGGGGACCCGGGGCTCGA
ACCCAGGTCCTTGCACATTTCAGCATGTGTGCTCAACCAGATGCGCCACCACCTGGCGCC
TTATCTTGTTTTTAATATTATATGTTGGATGGAGGTAGAAATTGAGAGGGATGGGGGAGG
GAGAAAGATACCTGCAGGACTACATTACCACTCATGAAACTTCCCTCTGAAGCTAGGGGG
CTGGAGACTCGAACTCCACTTTTACATGTGATAACATATCTGCTCTACTGGGTGCACCAC
TGTTCTGTCCCAGTTGCTGTTTTAATAATTTTTTGTGGGTTCCCCCCCTTTTTTTTTTAA
ATTTCATGTGATGTCTGGGATTCAGCTCAGGGCCTCACAAGGCACGTGCTCTACTTACTA
AACCACCTGGCAGACAAATTTCGTTTTTAAAATATTTTTACATTTTAGTAGTTTGGATTT
TTAAACTTGGCTAAATCTCCTTTAGGGGATACTACTTGCTCTTGGTAAGCCAGAACAGGT
TCTAAGGGCGTCCACAGTTAATAATCTGTTTCTGATTTGCAGGCAGAAGTGATCATGAAC
TATCATGTAGGGGAGACAGTGCTGTCATTACAGAAGACCACGCTGATCCCTGGAGGTTCA
GAATCACTTGTGTACACCACCCTGTCAGGAGGAATTGGAATCCTTGTCCCCTTCACATCC
CATGAGGTGAAATCTCCCATCTTGCTCTGACCTTTGCCTTCCTGGGATTGTTTCTTGATA
CTGAGTCTACCTACAGGGGCAAAACTGTTTGTCCCTGCATATAACTAGAAGTGCCTGGAA
ATTTTATAAAGTCACAAAAGTGACATGGGAAGAATTCCGATCCTTATTACTGCCTCCCCT
TCACACCATTAGGTTTTATACTGTTCTGGGGTTTGGTTCAGTTCTCATAAGGGTATAGGG
TTAGTTGGGCTGAGGCCCACAGGCTAGAATGATGGGACACTTCTCATATGATATTCTCTC
TTGTTTTATAGATATAATGACTTTTAGATATTGACTATCATGGGAAACCTGTGTTTTTCT
TTACTGTATGTCTGCATGATAAAAATCAATGGCTTCATTGTGCTTCTGGAAATGATAGGC
TAGCATTTGAAGTCATTTTCTCCATTTAGTGACTGTTTACTGTTTCTTCCATTAGGACCA
TGACTTTTTCCAGCATGTGGAAATGCATCTGCGTTCTGAGCACCCACCTCTGTGTGGGCG
AGATCACCTCAGCTTTCGTTCCTATTATTTCCCTGTTAAGGTCAGTCTGTTGGAAATTTG
AGTAGAGAAAGAGGGATTCTTTTCTCTAGGCCTCCCTTCCTTAAATCAGCAGGGTGAAGG
TAGAATAGTAATGGGGGTCTGATGTCTACTGATACTCATAATCCTTTCCCTTCAGGACGG
GCTATAATCATAAAAGTTTTGAGTTGTGGCTACTCAGGATTGGCTCAGAATAATGTTCCT
CTGGCTCTGGATGGAGATTTAGTATCTGAGGGAGAAGGAACAACTTTTCCTTGTAGCTAG
CTGCTAGCTTGGTTTAGCATGTGATATTTTCTTTGAATGGCTAACATTTGCCTTTCTCTT
TTTTCTGTGTTTTAGAATGTGATTGATGGAGACCTCTGTGAACAGTTCAACTCCATGGAA
CCCAACAAGCAAAAAAATGTTTCTGAAGAACTGGACCGAACCCCACCCGAGGTGTCCAAG
AAACTTGAGGACATCCGAACCCGATATGCCTTCTGAGGCCTTTTTCCTGTGGGTCTTATC
AGAAACTTGGTTTTGTTTCCCCACCACCATCATAGCCACCTCGCTCTGAACCTATGTAGC
AGAAGAAGGGTGGACGGATAATTAAGACTTTGTAATATTAAAGGTAGTCGCTTTTGCCTA
TTGATTTTTTTTCCCCCTTGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 3437..3751, 3753..3764, 4422..4594, 6549..6617, 6619..6691, 8205..8317, 10889..11026, 11810..11820, 11822..11849, 11851..11915, 13913..14078, 17634..17729, 20534..20606, 26785..26936, 27209..27214, 27217..27363, 28518..28673, 29660..29802, 29804..29804, 33842..33964, 38469..38623, 40938..41112, 41813..42018, 42116..42272, 44128..44253, 45141..45353, 45850..45948, 46842..46985, 47455..47559, 47895..48035
1001..1070, 3437..3751, 3753..3764, 4422..4594, 6549..6617, 6619..6691, 8205..8317, 10889..11026, 11810..11820, 11822..11849, 11851..11915, 13913..14078, 17634..17729, 20534..20606, 26785..26936, 27209..27214, 27217..27363, 28518..28673, 29660..29802, 29804..29804, 33842..33964, 38469..38623, 40938..41112, 41813..42018, 42116..42272, 44128..44253, 45141..45353, 45850..45948, 46842..46985, 47455..47559, 47895..48032
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved