Erinaceus_europaeus Locus RPL23A
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus RPL23A
Erinaceus_europaeus
RPL23A
GeneScaffold_8836
SNORD42
1328..1391
4592
ATACAAGAAATCTCACCGTGGTTCGGGAGGTGGCGTAGTGGATAAAGCATTGGACTCTC
AAGCATGAGGTCCTGAGTTCAATCCCCGGCAGCACATGTACCAGAGTGATATCTGGTTCT
TTCTCTCATGAATAAATTAAAAAAAAAAGAAATCTCGCCGTCAAAGGGAAAAATCAGGCT
CCAACAGGGGAGTGGAAAGGCAGGGCGGGATCTTGGTAGGACAGGCTCTTAGCTGCCTCA
GAGAAGCAAACTAGGGCTAAACTAGATACTAAACCTTGGTCAGTGTCAGGTACTGAATTT
GAGAATGCACAGGCGACTGGAGTCGGGAAGGTATAGGCGTATGAATAAACTTGCAAGAAC
TAACAAATGGAAGCACTCTGCACTGAAGTTTGTAATACTGGTCTGTTTCCTTGAGACCTG
TCAGGAAAACTGCATGAAACTTAGTTGTCACAGATAAAGAGGGGCAGATGTGGCCGCCTC
TTACCTCCGCTGACACTTGGCTTCTCCTCTGCCTCACTTTTGTTTTTTCTTTCCTTCTTG
TCGCCTCATCCCCTCGCAGAAAGTCAATTTCTACAGACTATCTACGGGAATTGAACAGAG
AGCAAATTCTGATCCAACGTTATGGAACTTTGTTTCACTCTCCCTGAGTCCATCAACAGT
GTTACTGTCAGTAATCTTTCCTGACACTGAAGTCGCTGGAGATGGAAATTGTTCAGGTCT
AGACCGGAGTTGCAGACAGCTACACTATTCATCCGCCCGAGCAAGTAAACACGTGTCTCT
AAAAAAACTACAATCCCCAATAAGCTCTAGTGTTTTTCTCGAGGGGCGGGATGACGCATG
CTTAGTCCCTCTCGCGAGGAGGGTAAATCTAACTACCATTCCCAGAAAGCATCACGCTGA
AAATTACCCAATCATCACTCAGTATAAAACATCGCGAGATTTGGGTGCGCCTTGGGTCTA
TAAGCCCGTGGGCCCGGCTACCAGAAAGTCTTTCTACGAAGATGGCGCCGAAAGCAAAGA
AGGAAGGTGTGTGCTGGGGCCATGGGGGCCACAGCTGGCTGGTCTGGGGTTTCTACACTG
TGAGTGAACCGGGAGGACTGTATGGGGATTTTTCTGGAGCTGTTCCTGGCCTTTCGGTTA
CGCTGAGGTCGGTGTGGGGCCAGCCGCGTGGTCTGGGTAGGCCGTCCTGCCAGCATTGCT
TGCCGGAGCTAACTAGATAATCAGCTCTCGGGGAGCTTAACCGACCCATTCCCAAGAGCT
GTAAGCAGTCAGTGCTTTACTTACTTTCTCCTTTCTTTGTATTAGGCGGATATATATAGC
CTCATTACGTGCAAATGATAGAAAAATTTTAATCTGAGACTGGTGATGTCTTCAAAGGAA
CCACTGATGCACGTGTGGGCTGGAGCGCCCACTGCCGGTCTTGAGGCCGGAAGTGATCAG
CGCTGGTATATACGGTAACGTTCTTTTCTTCTCCTATCAGCCCCTGCCCCTCCCAAAGCT
GAAGCCAAAGCCAAAGCTTTGAAGGCCAAGAAAGCAGTGCTGAAAGGCGTCCACAGCCAT
AAGAAAAAGAAGATCCGCACGTCACCTACCTTCCGTCGGCCCAAGACACTGCGGCTCCGA
AGACAGCCCAAGTATCCTCGCAAGAGCGCCCCCAGGAGAAACAAGTAAGTACTGTAATTT
GTGGGGGTTAATTTTGTTTTCATAAGTGATGGAATATAAGGTTAAACTTTTTGGGAACAT
ATATTTGTGTCCTTGTGCCACTAAGTATGTAAATAGTGGGCAGTCTACGGGAGTGAGCAT
AGCTGCATTTGACAGACCTTGCAGCAACAGTCAGTGTAAGCTTCACCCCGCCCCTGAACT
TTACTCTCAAGGAACAGCTGGAAGTGGGCAAAATACATCAACATCCCAAACACGATTGGG
GATTAGTGGGAGGTTGGTGGGTTTCAAGCCTTTTAAGTAAAATGGCTAACTTTTGTCTAT
CTTACTTTTACTTCCTCGATGTTTACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCT
GCTTCAACTTTGAAAAAACTTCCCTTGCGGATGGAGTAGCCCCATAAAAAATCACACTGT
CAGATTACCTGGTTGAGTTCTGGACCTAGGGCGAGGTCTAGCGACTCCTTAGCTGCACAT
TCCACATTATGGCGGGGGGGGGGTACCTTGACAATAGATATACACAACGGAACCATGATG
CCTGTCCCAGAAACTGGGGCAGTAAGGGCACGTGGGCAGCAGACACTTAGATCTCCCTTC
TTCCGCCATAGACCTGATGGAGAGAAGAAGGCATATGTTCGATTGGCTCCTGACCTACGA
TGCCTTGGATGTTGCCAACAAAGTAAGCCTTCTTTGCTACAAACTTTCTTTACCCCTAAC
TCCCTCCTCACCCTGGGTTATTGACCAAAGCCTGGCTTTAATTAATTAGTTTTAAATGGG
CAGGTCCCTTGTTTTGCTTTTTTATTTTTAACCTTGATATTTTAGTTGAATCTTAAAATT
TCAGCTTCTAGTAATGAAATTCTCATTTTGTTTTTCAGATTGGGATCATCTAGACTGAGT
CCAGCTGCCTAATTCTAAATATAACTTTTCACTGTATATATTTATGTTTCTTGTCTTCAT
GTGAATTTTCTGGTTGGGATAGAGGGAGGTCATTCATACACATTGTCCTAGCTAGGACAC
TAAACACTATCACCTCTGCATGGTTTTCTGGGGGTGGGAACTCGCGTGTGTTGGATATGA
CCCAGTTGTGGGATTAAAACAAAAAAGCCCCTTATGAAACCAGTACCCATTGTTTTCATG
TTGCATCTATTTTGGGGCAGTGTGGGTTGGTTGCTTACAACTACTTGATCTTTACACCCA
TCTACCATGCCCAACCGGTCTGTCTGCATCCCTTGCCCAAGAGAAAGGACAAGGACTTCA
GAGGAGTGCTTTCATTAGTGTTTTTCAATAGTGGATACTGAGCTTCAAAGGCAGACATGC
CAGTCCCAGGGGACACACCACACCCTAAGTTAAGGCTGGTCTCATCTCAGGTTAAGGCCT
TTCTTGGCTGTTTGCTGTCCTTGTCACCAGTCCATTGCCAGGCTCTTACTCTCATTCAGT
TAAAAACTTGTCTTTGTGTTGCCTGCTGGGAGCCCGATCAGGGCAAAAGTCTGAACGGAG
GAGGCGAGAAAAGTAGATGAGGATCATAACATCCAGCATTAACAGGATACTAAGCAGAAA
ACTTCCAAGAGTCCTCTCGCCAGCGTAACGTAGGAAGAAATGGGTGAGGTAGGCCTGTGG
AGCCAGGCGGAAGAGAAAGTACATCACTAGGTTGACATACTTGTTGACCTGGTAGAGGAG
ATGATCCTGGGCATTATTAATCTTCATCATCATTCTTATGGTGAGGAAGATGTTGCTGAC
TTCCACTAGTAGTGTTAAGACACCTCCTCCAACAAAACGGGTCAAAAAGATGCCAGAAAA
AAAGGCACCCATGGCCTTGAGGGAGGAAAAAAAAAAAAAGGTTAGGAACACAAGCAATAC
AAGGACTGGTGGGGAAATATCAATGATACTAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1480..1663, 2444..2620, 3311..3353, 3355..3381, 3578..3592
1001..1025, 1480..1663, 2444..2620, 3311..3353, 3355..3381, 3578..3589
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved