Erinaceus_europaeus Locus ENSEEUG00000001701
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ENSEEUG00000001701
Erinaceus_europaeus
ENSEEUG00000001701
GeneScaffold_8103
SNORD49, SNORD49
1225..1302, 2355..2422
4235
AGGGCTAGTGGGGGTTATATTGGTTATACGGAAACTGGGAAATGCTATGCATGTACAAA
CTATTGTATTACTGTCGAATGTAAAACATTAATCTCCAATAAATAAAATTTTTTTTAAAA
AAGCGGGAAAGGCTTGACCATGCACCTACACTGAAAGGAAAGCTTGGGGGGGGGGGTAGT
TGCCCAGGAAGGAGAATTAGGGGCAGGAGGGCTGGAAGGGGCAGCAGAGGGGAGTCACGC
GCTGCTCTGCCACGTGTGGGACCCAGGTTCGAGCACCGCGCCCCCGCACCGCAGGAAGCA
TCGGTGCTGCTGCCGTCTCTCCAGGGATAAATGGATGCCAGGCGGGGTAAAGAGCAGAAT
GCTTATGCAAAGAGACTCTCATGCCTGAGGTTCCGAGGTCCCAGGTTCAATCCCCTGCAC
CCCCATCCGTTGGAGCTGAGCAGGGCTCAGATAAAAATAATAATAATAATAAACCAAACC
AAAAGAAAAAATAATAATCGAGCTGCCTGCACTCCTGAGGCTGCCCCTTCTTGGAACGAC
AGCAGCTGTCTGTGAATGCTCGCGGCGTGCCCAGGCTCTCTCTGCCTGGACGGTTGCGCA
TGTCCCCGCGACCCTCGGAAGGCGCCGCCTCCGCCTGCCCGAGACCACCCAGGAGGGGCT
GCAGCACCGCCCGGGCTCGCGGACGCGCTTCCGACTCGCGAGACCAGAAACCCGCGCACG
CGCATGCGCACGCGCGCTGCGTATCCCAGAATCCCCTGCCGGTGGGAGAGACCATATCGC
GGGGCCGGGGGGGGGGAGCAGGGCGGCGTGGCGGCGTCTGTCTCGGGAAACAAGCAGGAC
GTTCCCATGAGCCTTTGCGAGGATCCCCCCCTTCCCGTAAGAAATGGGACGTTCCGACGG
CTTAAGAAGCGAGGACGCGGTGTGGACCGTCTCTTATTGCGGCTGTTAGGCAGGTTGGTG
TTGCTGCTTTGTCCCGCGGGCTCGTTGGGCAGGCTAGGCGGGTGTTCGCGCGGGAAACCT
TGAGGACAGAGCCGGCGTGTGTGGCCCGCGGGCTGCAGGCAGAGTCTCACGAGCCGCGTG
CGTGTGTTTGTGTCTTGCAGGGCGGCCGCCATCATGGAAGAAGCCCTTGGAGGCTGCAGT
GCGCAGACTCCGCGCAGCCGGGTGAGAGGCTGGGGGCCCCCACGTGGGTGGGCTTGACGC
GGGCCCCTCGGGGAGCGCGGCGGCTCGTCGTGATGACACCGGGAACTAATGTTAGGAAGT
GCCGTCAGAGTCGACAAGTGACGAGACTTCAGGCCCGCTGACCCACAGCCGCGGCCGCCT
CAGCGGCTGACACCGACCGCGAGGACCCGCCCCGTAACGCGTGTCCTTCATGTTTCAGAT
GGCGGGGCCGCCGCTGCGGGGACCAGAAGTTCCAACCGGCCCAGGTGAGCCCTTCGGGTC
CGGGCCCTAGTGAACCTGCCCAGGAAAAGCGGGCTTCTGATTGGTGGCAGGTTTTCTTAA
AAGTTTTTTTTCTACTATGTAAGGGGAGGAGCTTAGCTCGTCTGGCCAATGAAAAGTGAG
CTCGGCGTGACGTAAGCAGTGGCTAGGTCAGAACCGATCCCGAAGGAGGAAGGAAAGGGG
CTTTGGCGCGGGTCGCACTGACCTTGGTTTTCGTCAGGGTCTCAGGAATAGCAGCGAGCC
GGGGGTTGGTTACTCCGCTCTGGGCCGCAGTGGTGACATTCAGCGCAGCCCTATGGAGAA
ATCCCAGTCCAGGGGGCGGGCGGTGGGCGCACGTGTTGCACAAAGCGCAAGGACCCGGGT
TCAAACCCCCCCTCCCCCGTCGTGCCCCACCTGCAGTAGCGCTGGAGCGGGGTATAGAGA
TAATGGGATCCTTTTTTTAAATGAAAAAAAATGGTTCCAGAAGTGACACTTAGGTGGCCC
GAGAGGTGGCGCAGTGGGTAAAGCACTGGGCTTTTCAAGCATGACGTCCCGAGTTAAATC
CCTGGCAGCACATGTGCCAGAGTGATGTCTGGTTCTTGATCTCCTTGCTCATGAATAACT
TATGTTGCTTCGTCTATCGGGTAGAGACCGCCAGAAGTCGAGAGGAGGGAGGGAAGTGGG
TGACGACAGAGGGGAAGAGACCCCTGTAGCCCTGCTTCACCACTGCAAAGCTCTCGCCCT
GCAGCCCTGGGGATGTGGGGCCTCGAACTGGGGTCCTTAGGCCGGTCCTTGCGCTCTGTT
CCGCCTGCCCTTGACCTGCTGCGCTGCTACCTGGCCCCCCATAAATGCTTTAAAAAAATA
ATGACGCTGAAGTGTCTCTGGTCCCCAGAGCGGTTTCTAGCTCAGTTTCTAGGTGCAGGG
GGCTTGAGGCGAGACTGCTCTGATGAAATCACTCATAGGAAGTGCCGTCAGATGCGACAG
CTGACGAGAATTCCTGGCTGATGGCAGTCCACAAGCCCCCGCACGCTGTGCTGTGAGGAT
TAGGCGGTGGCAAACTGCCGCTGACACTGCACTCAGCCAGGTCGCCGTGAGAGAGTGGCC
GGGTATGAGATGCGGGAGCCCTGTCCCTCAGGATGGCAGCCTTCGCCCGCCGAGAGTTCA
GCTGCGGTCTGTGGGGAGAAGTGACTGGACCGGCCCGACCTGGAGAGTTCTGGCAGGTGT
GGTACCCGGATGGGACTCCGGCCTTTATTCGTTGCGCCACTTGCCAGGCTGCGGTGTCCT
GGACTTCAGGGACTGCCGGTTTACCACATGTGTCAGTGATCAAAGGCACTTGGGATGAGT
TTACAATAATGTGTGCCACTTTTGTGGGTTTTTTTTTTTTTTAAGCAGAGCACTGTTCAG
TTCTGGCTTATGGTGGTGCGGGGGACTGAACCTGGGACTTTGGAGCCTTCAGGCATGAGT
CTGTTTGCAGAACCATTATGCTGTCTACCCTCGTCCCCACGGTGGTTTTAATGAAAACAC
TGTTCAGCTCTGGTGGTGCTGGGGATTGAACCTGGGGCCTCAGGGTGGTTTTCCCATGAC
CCTTTATGCTCTCTCCGGCCCTGGATTTTCTTTGGCAGCCCTGGCTGTTCTCTTTTTTGG
TCAAGAGGTCACAGTGGGTGCTCCCATGTAGTGCCCTGAAAGAGGAGTAGAGCTGTTGCC
CTACCCAGCAAGGTTTGGGCAGCGTCAAGATAAGACAGGTTCTCTCATTGAAACCATCAC
ATAAGTGAATTTCTTTTCTGTTCTCAGCATCTGCTTGGTGTAGGCTGATGCCTTAAGAGA
TGAGAACTGCTGGAGAATGAGCAGTGAGGTCACAACTCGAGGTAAGGGTAAGCTCTGACC
CGCCAGTGATCCCTCCTCAGACCAGAGTGGGCATGTTCGGGGTGGCATGGGCATAGACTA
CGGAAAGGATATCAAATGATGAGATCACCCAAAATAGCTGGAATTACCGGCAGAGTGTGC
AGTGGTGAGCCTAAGGTTTTCTGAAGATATCCTGTAGTGCTGTGCATGAGGGTGGACAGG
AGTAGATGAGACTGATGCTTAGTTTCTTTGCAGGTCTCTTCACCAGAGGATACAGCTGGA
GCGAATCTGAAGGTGCAGACCTGTGGGCTGTCCACTAGTTTGGACAGAAAAATCAGTAAC
AGTTGTAGAAATGTGCCTCTTGTATCAGTGCCCTACGACCTGTGAATCTGCATCCTAGGA
GCACTATTTATTCAGTTAGAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1005, 1008..1020, 1023..1025, 1027..1035, 1038..1052, 1054..1062, 1065..1070, 1072..1089, 1091..1102, 1107..1124, 1127..1135, 1137..1160, 1378..1392, 2501..2503, 2505..2518, 2524..2524, 2528..2537, 2546..2559, 2562..2575, 3229..3235
1001..1005, 1008..1020, 1023..1025, 1027..1035, 1038..1052, 1054..1062, 1065..1070, 1072..1089, 1091..1102, 1107..1124, 1127..1135, 1137..1160, 1378..1392, 2501..2503, 2505..2518, 2524..2524, 2528..2537, 2546..2559, 2562..2575, 3229..3232
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved