Erinaceus_europaeus Locus ENSEEUG00000004927
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ENSEEUG00000004927
Erinaceus_europaeus
ENSEEUG00000004927
GeneScaffold_1949
SNORA19
14483..14612
30119
GATTGAACCTGGGACTTTGGAGCATCAGGCATGAATGTCCTTGCATAACCACTACATTA
TCTCTCCAGTTCCTAGTGTGTCTGCCATAACTATGAACAAATATCAATTTACTATAAGTG
GAAGTCCATACTTGCTCCTGTTTCACAACTTTCCCAAATCCTTATATGTGCTAAGGTCAC
ATATTACATTTGATTGTCACTGGGTAGATGTTGCAATTTCTTAGACTTGTTTCTGATGAA
CTTGATGTTGGAGTACTAGTCTGGTGTTATATAGAAGAAGGTTTGTCTTATTTTTTTTTT
TCATTCATCTAAGTATTGTCTTCATAGTTAAGAGGACTAACAGTCAATTCTCCCAAACCT
TATATAACTTAATATAATCCTGATAGAAAGCCAAGCGCAGTGAGCATTATTTTGTCAATA
TTTACAAACGACAACTCTAGATTTTATGAAAAGGCACAAGATAACATTACTAAAAGACAG
AGTTGAGATAGTCACACTACATCAAGTCTTCAGTGATCACAGTGAGTTATTAGCAAAAGA
CCACATATGTAGATCAGTAAAGAATTGTCAGAATAGAGAGCCCAGACATAGATCCATCAT
CAGTTGATCTTAAAAGAAAAAAGGAATTTTAATGTGATATCTCAAGTCCGGCATGAACTA
ACAAACTTCTTCAGCCAGATGATTGTGGCCAGTGTTATTCTTGAGCTGTGTTTGCTTGGT
GGTGGTGGGGTGTCCTCAATTTCAGAAGCTTTCAATAACGTAAAATAGAACTGTGGGAAC
TGTAGTTTTTGTCTGTGGACCATATTTTGAGTTGGCATGATTTTTTCATTATTTTTCCTT
GGATAATTTTGGCACAGCTCTAGAAGTTAAAAATAAATCTGACCTAAAAAAGAAGATAGT
GAAGAGTTCAGAAATAATAAAACAGCCAATTATGATAGCAAGTTTTAGATTTTTGTGGTA
TGAATAATTGATCTGAACTCTCTTGAATTACTTTTTCAGAATTTCTGGAAGTTGGCAAAA
AGCAACCTGCTTTGGATGTTCTTTATGATGTTATGAAAAGTAAGAAACACAGAACATGGC
AGAAGATACACGAGCCAATTATGTTGAAATACTTGGAACTTTGTGTGGATCTTCGCAAGA
GCCACCTGGCTAAGGAAGGGTTATACCAGTATAAGAACATATGTCAACAGGTATGAAGAA
AGCTGAGGTTTACGTTTTTAGCAAATAAATGCTTGTTTCAAATTAGAGTTATATCTCATA
AAATGTGCTTTAAAGTCTTTTGTGGTTATTGGAAAACCCTTGATTTTTTTTTCTTTCTCT
TGGGTGGGATTTAGGTGAACATCAAATCTCTAGAGGATGTGGTTAGGGCATATTTGAAGT
TGGCAGAGGAAAAAACTGAAGCTGCCAAAGAGGAATCCCAGCAGATGGTCCTGGACATCG
AAGACCTGGACAATATTCAAACGCCCGAGAGGTGTGTGGGGTGTAAAGGCCTAATACACA
CAGTCATTGTCTCTGTCTGCACCTCTTGAAGTAGATGCTTTTTTGGAAATACCGGATATG
GGGGGGCCAGATGGTAGCGCAGTGGGTTGAGCGCACGTGGTGCAAAGTGCAAGGACTGGT
GCAGGTGTCCCGGTTCGAGCCCCCGGCTCCCTGCCTGCTGGGGGGGTTGCTTCATAGGTG
GTGAAGCAGGTCTGCAGGTGTCTTACCTTTCTCTCTCCCTCTCTGGTTTCCCCTCCTCTC
AACTTCTCTGTCTTACCCAACAGCAATAACAATAATAATAATAAGACCAACAGAAATGGA
GAGAAATGGCCTCCAGGAGGAGTGGATTTATAGTGCAGGCAATGAGTCCCAACAGTAACC
CTGGAGACGAAAGAAAGAAAGAAAAGACAAAGAAATATATGAGATGCAATAGTTTACTTT
TTTAAATTTCTCTAATATTGGAGAGAGAAAGAGAACCAGAGCATCACTTTGGTACATGTA
TTGCTGGGGATTGAATTTAGAACCTCATGCTTATAAATCCAATGGTTTTTCCACTGCGCC
ACCTCCTGGGCCACTTTCGAAGTATTTTTAAAAAATACTTTAATATAAGAAGTGCAGAGG
GGGGGGGAGTCGTCGGTAGCACAGCGGGCTAAGCGTAGGTGGCGCAAAGCACTAGGACTG
GCTTAAGGATCCTGGTTCCAGCCTCGGCTCCCACTGCAGGAAGTCGCTTCACAGGCGGTG
AAGCAGGTCTGCGTGTGTCTGTCTTTCTCTCCCCCTCTCTTTCAACAATAACTACAACAA
CAATAAAACAACAAGGGCAACAAAGGGGTAAAAAATAAATTTAAAAAAAGTGCAGAGGGA
GTCGGGCAATAGTGCAACAGGTTAAGGGCACGTGGAGCAAAGCACAAAGACTGGCTTAAG
GATCCCGGTTCGAGCCCCCGGCTTCCCACCTGCAGGGGCATCACTTCACAGGCAGTGAAG
CAGGCCTGCGGGTGTCTCTTTCTCTCCCCCTCTCTGTCTTCCCCTCCTCCTCTCTGTCTT
CCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAACGACGACATCAATAACAACAAT
AAAAAACAAGGGCAACAAAAGGGAGTAAATAAATAAATATATAAAGAAGTGCAGAGAGGG
CAGGGCTAGATAGCATAATTGTTATGCAAACAGGCCGAGGCTCCACAGAGTCCCAGGTTC
AATCCCCTGGATAAGCTAGAGCTGAGCAGTGCTTTGGTTTAAAAAAAAAAAAAGTGCAGA
GGAAATTCATACACCACACACACCAGTGCATTGCTCAGCTCTACCTTGTGATGGTGCTGG
GATTGAACCTTTGATCTCAGAGTCATAGACATGGAAGTTTTGCATAATCCTGCTGTCTTC
CTGGCACTGTTTGATTTTTAAGGATTTATTTGCTAGATAGGGAACTAGAGCATCACTGCT
GTATGGGATGCCTTAAAGTCCAACACTGTCCACTGTGCCACCTCCTGGGTCCTTGGGGGC
CTTACATGTAACGAACCCCCAAAGACTCAAATTATTATTCCAAATTCATAAAAAGAAAAA
ACCACTATCTCCGGATATGGAGGATTTGGTTAATTTATTGTTGTATTTATTACTGTTTAT
GCTATTGATGTCATTGTTGGATAGGACAGAGAGAAATGGAGAGAGGAGGGTAAGACAGAC
AGGGGGAGAGAAAGATAGACACTTGTATAGACCTCCACTGCTTGTGAAGCAACTCCCCTG
CAGGTGGGAAACCTGGGGCTCGAACCAGGATCCTTCCTCTGGTCCTTGTGCTTTGTGCCA
CATGCGTGCACTTAACCTGCTGCACTACCGCCCTGGTTTTGATTAATTTAAAATGGCTTA
ATACAGATTGAAGATTAAAGTACTTGAAGTGACTGTACAAAGCTGTAGAAAACCCATACA
CGATGTTACACACATACTGGTGATTTTTGAAATGATAGACTAAATGGCTTAAAGTATTTT
TTTTCTTTTATTGTCTGTACTGTTTTCAGTTTCTTTTTTGTGTCTTTGCAGTGTTCTCCT
AAGTGCTGTAAGTGGTGAAGACACTCAGGATCGAACTGACAGATTACTTCTGACACCATG
GGTTAAGTTCCTGTGGGAATCTTATAGACAGTGCTTGGATCTTCTTAGAAACAATTCTAG
AGTTGAGCGGCTCTACCATGATATTGCCCAACAAGGTAAAACAACTGACGGGAAACATGG
CTTGAATGGATTTTGTAAATAATTAGCCAGTTTTTTGTTCTTTTTTTTAAAAAATTTTAT
TGATTTACTGAATAGTGACAAATTGAGAGCAGTGGGGAGACAGGGAGGGAGAGAGACAGA
AACACGCCCGCAGCCCTGCTTCACCACTTGGGAAGCTTTCCCCCTGCTGGTGGGGACCGG
GGACTTGAACCTAGGTCCTTGCGCACTGTGATGTGTGTGCTCAACCAGGTGCGCCACTGT
GTAGCCCCCTATTTTTTTTTAAATTTTCCTTTTTGTTACCCTTGTTTTTTATTGTTGTAG
TCATTGATGCTGTTGTTGTTAGATAGGACAGAGAAATGGAGAGAGGAGGTGAAGATGGGG
AGAGAAAGATAGACACCTGCAGACCTGCTTCATCTCTTGTGAAGCGAATCCCCTGTAGGT
GGGGAGCTGGGGGCTCGAACTGTGATCCTTAAGCCGGTCCTTGCGCTTTGTGCCACCTGT
GCTTATCCCGCTGTGCTACCACCCAACTCCCCAATTTTTTATTCTTTTTTTTAAATTTAC
TTTATTTATTCCCTTTTGTTGCCCTTGTTTTTTCATTGTTGTAGTTATTATTGTTGTCAT
CATTGTTGGATAGGACAGAGAGAAGTGGAGAGAGGAGGGGGAAGACGGGGAGAGAAAGAT
AGACACCTGCAGACCTGCCTCACCTCTTGTGAAGGGCCTCCCCTGCAGGTGGGGAGCCAG
GGCTCAAATCAAGATCCTTACACTGGTCCTTGTGCTTTGCGCCACCTGTGCTTAACCCGC
TGCGCTACAGCCCGACTCCCGAATTTTTTTATTCTTATCCAAAGCTGATTGACACCAGTT
TGAATATTGAATGTTAAATAAAAAAGAAAAAAACTGCTAAAATTTCCCCTTTTCCAAAAC
TTTTATTAGTTAAAACTTTCCATTTATGCCAGAAAGTCATTTTAGAATTTACAGGTTATT
GAGAAAACTTTCATAGAGATTTCTGGTAAAATTGAAGTCTGCTTTTGACTCCACACCTAA
TAGTGCACTGGGTTTATGAGAGATTTTTTTTTAACTCTGGGCTTCTTCCATGAAAAACAC
ATAATTTTAATTTCTTAAGCAGTATTACCAAGTAGAGTCAAACTTTATTAATGACTTAGA
ATAATCATAGTGTGTTCAGTTATGTTATATACCGTTAAAATGTGAAATTATGCCTGCTTA
TAATCTTACCTCTTAGACTCCTGCAGACCTGCTTCACTGCTTATGAAGCGACCCGCCCTC
CCCCCCCACAGGTGGGGAAATGGAGGCTCAAAGCGGGAGCCTTAAGCCGGTCCTTGAGCT
CTGCACCATGTGTGCTTAAACCAATGCCCCCTAAGTGTTTTTTAAATTTTTCTCTTTAGT
ACCAAATCTTGTTGCTTTCTTTGTAAGTTAGATCACAACTTTAGTATACCTCAGGCTGAT
TTTTAAAAAAACAATCTTGCTTCAATTTTATTAGACAAAATTAAAAGAAAATTTATTTTC
CCTTTTGTTGCCCTTGTTTAACATTGTTGTGGTTATTGATATTGTTGTATAGGACAGAGA
GAAATGAAGAGAGGAGGGGAAGACAGAGGGGGAGAGAAAGACAGACACCTGCAGACCTGC
TTCACTGCCTGTGAATTGACTCCCCTGCAGGTGGGGAGCCCGGGGCTCGAACCGGGATCC
TTATGCTGGTCCTTGAGCTTTGCACCATGTGTGCTTAACCCGCTGCGCCACCGCCTGACT
CCCCTCAGACTGATTTTTATTGCTTAGAATTTGAAGTGGTGTAGAAATAGGCCTAAATTT
GACCTGGTCATTTGTAAATTCCCAGAACTATATTTTATTTCTAGGCCAGAATAATTAGGG
TGTATCTAGTTTTTTATCAAGATACATTCAAAAAGGTCATTTGTTGTCCTGACAACAGTG
GTCTGGGACTGATGAATTCTGAGGACTGGTGAATTTGGTAAATATTGTCAAAATAGCTTT
GGCTTATCTTAATATGTATGAAATAAAATCTACTTAAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGTTGGTCGTGGAAGTACCTAATATATTTTACAATTATACTTACAGCT
TTCAAATTCTGCCTCCAATATACTCGTAAGGCCGAATTCCGCAAACTGTGTGACAATCTG
AGAATGCACTTGTCACAGATTCAGCGCCACCATAACCAGAGCACGGCAATCAATCTCAAT
AATCCCGAGAGCCAGTCTATGCACCTGGAAACCAGGCTTGTTCAGTTGGACAGTGCCATC
AGCATGGAATTGTGGCAGGTATGTTGTAAACTGCTAGTGTTTCTTCAGATTAATGACTGA
GTAACTTCTAAATCGCCCTACACTCCTCAAGAGTATCTTTTTTTTGGTAGCAGTTTTATG
GTAATCTTGTCAGTCATACTTACTGTATTCTGCTGTTAGTAATTCTGCTGTTAGTAATGA
ATTTGGAAATCAAGGGCCAGATATGTTCCTTACTCCAGATACCTGGAGAAACGCTACACT
GGATTGTTCCTTAGTTTTCTTAGTGTCTCTTTGGCTTAGTAAGCCCTGTATAGTAAGTTT
GTGGCACTGGAGATAACTCCCTCCCCTCCCCTCCCTTCCTTTCCCTTCTCCTCAATCAGA
GCACTGATCAGCTCTGCTTTATGGTGGTGAGGGGATTGAACCCAGGACTTCGGAGCCTCA
GGCATGAGAGCCTCTTTGTATAACCATTATGCTACCTAACCCCCTACTCCCAACTTGACT
TTTTAAAAAATATTTTATTTGTTCATGAGGAAGATAGTAGAAAGAACCAGACATCACTCT
GCTACATGTGCTGCCGGGGATTGAACACAGGACCTCGTGCTTGAGAGTCCAATACCATAT
ATACTGCGCCAGCTCACGGACCACACAACTTGGCTTTTTTACCATTAAGAGTTATACAAA
AATATTTTCAAAATGGCTTATTAGTAATACCTTGAGGTGCTTATATATCTGACAGAATAT
CAAATGGCGTATAGTAAAACTAGTTTCCAGCTAGGTGAAAATGGGGCTTGATTGCCTGTT
CTCTCCTGTCATATTCCCCTTGAGAAAAATATTGTAACATACAAGTACAGTCACTATAGA
AACACATGGAGGCTCAGCAAGGGGCTCACTTGGCCAGCGCACTGCTTTGCCCTGTGCACG
AGACAGATTCCAGCCTAGCCGCCGCCAGCTTGGAGGAAGCTGTGCTGTGGCTTTTGCCCA
TTTGTCTACCTGAGACAGTCACCCAGAACGGTGAAGCTCTGGTGAGGCTCTAGTTTTATG
CCTTTCCAGACAGTTTTTCTATTTTCTCAATTGATAAAATGATGATGCACTTTTTATTTT
CGCCTCTCTTGTTTTCTGTTTTCTTTGACAGGTTTACGGATTTAGTACTTTTTTTTTTTC
TTTTTATTTATTTTATTTATTATTGGACAGAGAGAGAAATTGAAAGGGGGAAGGAGAGAA
ACAGAAAGACACCTACAGCCCTGCTTCACCACTTATGAAGCTTTCCTCCTGCAGGTGGGG
ACCAGGGGCTTGAACCTGTGTCCTTGTGCACTGTAATGTGTGCGCTTAACTGGGTGCGCC
ACCACCTGGCCCCGATTTAGTACTTTTGTAGTTTTGGCAGTTTTCAGAAACATCAAATCT
AGTGAGTCAAAAGAGTTATATAAAAAAGCCTTTTGTTAATTTTTAAAAAAAATTTAGTGA
TTTAATAGTGGCTTACAATATTGCAGAGCTCTATAAAGAGCTCTGAGCCCACATTAAGGA
AATGTTTTAAGATTGAGTTGTTGTTGTTTAGAATGCAGATGATTATAATCTATACTATTA
AATTTAGGAAGCATTCAAAGCTGTGGAGGATATTCATGGACTGTTTTCCTTGTCTAAAAA
ACCACCTAAACCTCAACTGATGGCAAATTACTACAACAAAGTCTCAACTGTGTTCTGGAA
ATCTGGAAATGTTCTTTTCCACGCCTCTACCCTCCATCGCCTTTACCACCTCTCTAGAGA
AATGAGGAAGAACCTTACACAGGAAGAGATGCAAAGGTAAGAAGGCTGTAGCAGTATAGT
GTTGAAATTAAGAAGCAGTGGGCCGGTAGATGCTTCAGCGGATGAAGTGCTGGACTTTAA
CCCACAAGGTCCTGAGTTCAATCCCCAGCAGTACACGTGCCAGAGTGATGTCTGATTTCC
TCCCTCTCTCCCTCCCTCATTAATAAATAATTAAAAAAAAATTTATTTATTCCCTTTTGT
TGCCCTTGTTGTTTTTATCATTGTAGGTTATTGTTGTCATTGATGTCTTTGTTGGATAGG
ACAGAGAGAAATGGAGAGGGGAGGGGAAGACAGAGAGGGGGAGAGAAAGACAGACACCTG
CAGACCTGCTTCACCGCCTGTGAAGCGACTCCCCTGCAGGTGGGGAGCCGGGGGCTCGAA
CCGGGATCCTTAAGCCAGCTCTTGCGCTTAGCGCCACCTGCGCTTAACCCGCTGCGCTGC
CGCCCGACTCCCATAAAATAGTTTTTAAAAGAAATTAAGATACAATTGGTTCTTAAAAAA
TACTTTGTGCACAGACTTCACACTGCCAGGGAAATAGTACCCCAGGTCAGGTTTTTTTCA
CTCCTCATTTTTAGAAAGAGGATAGAGACAGAAGAGACACTAGCTCTCCTATGTGTGGCG
TTTTTTTGCTTCCATCATCTATGGTGCTCTCATGGAGAATTGGGGGCTCGAGCCCCACCT
GTCCCATCCCTGGAAACAACTATTTTCTACCAAATGGCACAGTGTAGCGTGTTCTAGATC
AGAATCTCTTAGTCTGCTCTGCTGCCATGTGAGCTCAGAGGGTTTTTAGTGGGAGGAGGG
TGCAGTCAGGGCGTTAGTGCCCCTGGACTCCACTGCCGGTTGCCATTCCCTTCAACTTTG
ACTTGCAACACTATTCTCTTAGGTTTTCAGTAGCTGTTTTATGACTAACCAGGTCTGTCA
AAAATCTCAGTTGAGATCTGTGAATATTCAGAACCACAGTTGAGGCCTGAGCTTTCTGTT
TGCATGAAGTTTATCCTTATAGTGTAAACGCAAAGGCTCTCTAAAGACCATTTTTATTTG
ATTGTGATGTTTATTAGTGACTTTATACTGATTTGTGAGATTATGGGGGAAATGTGGGTC
TCTGTGTATCCCTGCACTGTCACTTTGGCTACTTTGCAAGTTCATGTGTTTCAATTCTTT
ATTCTACATAGGAACAAAAACCACCCAGTTCTTTGTCTCCTTACTTCCCAGCGTCCTTGT
TAATTGCAGAGTAATACTCCGCAGAGCATGTACCACACAGTTTCTGTATTTGGTGATCTG
CGACCATTCAAAGAGTTCTGAGTCATTCTTTTTAGGTTTTGAAACTTAACATTATTTGAT
TTTTGGATTGAGAGAGAAATATCTATAGTGATGCTCCTTCTGTGCACGTGGGCATCTGGG
AACTTGAATCTGGGTCCTTGTGCATTGTAACGTGTGTGCACAACCGGCTTTCTGCGCCCA
GCCCCAAAGGATTTATTAATGGGGGGGGGGGAGACAGACACACTAGATTGCTGATCTGAC
GCATACAGTGCATGGATCGTGCTCTGAGTTGAATGCTTTAGCCACTGAGCCACTTAACTA
GGATGGTGAAAGACCACAGTTTTTTTTTTTTAACTTTTAAATAGTTATTTTCTCTTTTGT
TGCCCGTGTTTTACTGTTGTAGTTATTGTTGTTATTGATGTTGTTGTAGTGGATAGGACA
GAGAGAAATGGAGAAAGGAGGGGAAGACAGTGGGAGAGACAGACACCTGCAGACCTGCTT
CACCGCTTGTGAAGCGACTCCCCTGCAAATGGGGAGCCAGGGGCTCAAACCGGGATCCTT
AAGCTGGTTCTTGCGCTTTGCGCCATCGCCCGACTCTGCTTTGTTAATTTTGATCTCAAG
TCAAGTTACTTACACTAAATCAACATTGAACTTGCAGAAATAGGTGGAGCTAACTCAAAT
GAATACTGCTAGTATGTTTTCTTTGACTTCTTGAAACACTTCATTATGTCGGTCATACTT
TTTATGTAATTCAGCTTGCTTGAGATAGAGGGGAAAAATCCCAGTCTCTTTTCATGACCA
TTTCTATACCAGTCCTGTTGGCATCGCTATTATCATGGTAAGTGCTAGAGGAGTTAAGTT
AGCTCTTTGTTACTTTGTTTTCACAAAGTCTTTATGACTCAGAAAACTAAGTATCTTATC
TGAGGTTACCACCTTAGAAATGGTGAAACTCAGCTTCTCATTCTTGAGTCTGCAGGCTCC
TCCACGTCATAATTCCTAGTGGTGCTCGCCATCCAGCTTAACTTCCTCTTAAGATTGAAT
TACTGGGGCAGTGGGTAAAGTGTTTTCCTCGTCGGCCTGACGTGTACTGAGTTTCACCCT
GACACCACATTTGGTAGAGTGATGCTGTAGTTCTCTGTCTTATAAATAAGTAAATATTTT
TTTGAAAAATTATTTTTAACTTATTTGGGTCTGAATCTTAGGTCACTCAGTAGAAGGGCG
AAGCGTCACAGAAACGGGACAGTGCGGCAGTGTCTCTTTCTTCCCCTCTTGGTTCCTAAA
GTAAATAGAGGGAGTCTGGCGGTAGTGCAGCGGGATAAGCACATGTCGTGCAAGGATTGG
TGTAAGAATGCCCAGTTCAAGCCCCCGGCTCCCCACCTTCAGGGGAGTCTCTTCACAGTG
AAGCAGGTCTGCAGGTGTCTGTCTTTCCCTTCCCCTCTCTGTCTTCCCCTCCTCTCTCCA
TTTCTCTCTGTCCTATCTAATAACGGTGACATCAATAACAACAATAAAAAAAATAAAGGC
AACAAAAGGAAAAATAAATAAATTTAAAAAAAAAAGAATCTGCCGGGAGTGGTGGAATCA
TAAAACTTGCTCGCCCCTGTGCTCCACAGATTCTTTCTACAGTTTTAACAAACGCTGGTG
ACCTTTGTTTCTTCTCAGGATGTCCACTAGAGTCCTTCTGGCCACCCTTTCAATCCCCAT
CACCCCCGAGCGCACTGACATCGCTCGTCTTCTGGGACATGGATGGCATCATTGTTGGAG
AAACAGCGTCTGACTTGCAACACTGCTGGGTCTTCAAAGCCCCACCCACACGAATCGGGC
TTATTAATTGAAAGGGTTGGATAAACCTTGAATTTTAAAAGAGAGCAAGGAACGTTATTT
TATTGAGAAACACCCAGAGACCGGAATACTGCCAGCAGTTCTCCTGGTACAAGTTGGGAT
GATTTTAAAAAAAACTTATTTATCCCCTCTGGTGGCCCTGGTTTTATTATTGGTGGTCAT
TGTTGGATAGGACAGAGAGAAATGGAGAGAGGAGGGGGAAGACAGAGAAGGGGAGAGAAA
AGACACCTGCAGACCTGCTTCACTGCCTGTGAAGAGACTCCCCTGCAGGTGGGAAGCCGG
AGTCTCCAACTGGGATCTTTACGCCGGTCCTTGCGCTTTGCACCACCTGTACTTAACCTG
CTGTGCTACTGCCCGACTCCTGGGATGATTTTTATAGCTTTGAACAGAAAGGGTATATTG
TTGGGGTTTTCTAACAGACTGTGAAATACATACTGACAGTTTGACTTACTGCTGGGAGCC
CTGAGACGTGAACAGGTCTGAGAGCCAGTGGTGAAACTCAGGCACAGTTACACACTTGGT
TGAGGCAGTCTGTCTGTGGGTGAGCTGGTGGCAGCAGTCAATTTAGACTAACTCTGAGTA
TCAGGACCAGAAGTCAGTCCCGCTCTGCAGGACTTTTTTTTTTTTTTTTTTCCCACTTAA
GGGCGAGGTAGGGAAACTGAAGCTGATGCAATTTGGAAACATCAGATGAGTTTATGAAGG
AAGATGAATTAGGTCAGACCTGATTCTAGAAAGTTAAAGAAAAGTCCAGCCTTTTTCTCT
GAGAATTTCAATTCACATTATTAAAATATTGACTCTGTACAATGAGATGTTTGGGGTATT
CTTTTTTAAAATTAATAACTTTGGGTTGGGGCAGAACTAGAGAGATCATCACTCAGACAC
ATGGGATGCCAAGGTGCAAACTTGGAACCTATTAATAGTTTGAGAGTGTAGCACTCAAGT
GAAGCGCTCTTACTTGGAAGTCAGACTTCTATGCTTTACCCACAAAAACCATGAACTTGA
TTGACAGTCTTTGGTGCCTGAGGTTATGCATCATTCCACTGCTTTACCTCGACAGAAAAC
TTTTTTTGCCTCCAGGGTTATTGCTGGGGCTCATTGCCTGCACTACAACCTGCTGTGCTA
CCACCCCGGCAGCATGCTATCTTAGTGAGCTATTTTGACTCAAGGTTTTTTGTTTTTTGC
TTATTAGAGTTGGATGTGATAACAAGGGAGCCATTGCTCCACTCCACTCCACTCCACTCC
ACTCCACTCCACTCCACTCCACTCCACTCCACTCCACTCAGTGCTGGGGATTGAACCAGG
AGCCTTAGGCATACAAGTTGAGTGAGTGCTGTGCCAGTTGAGCCATTTCCCCAGCTTTGA
AGTATGCTTTGAAGATCTCTCTTTTAAAGTGGAGACATGACATTCTGAAAGTATTATCCA
TTATCTCCTGAGCCCCTTGTCTGTACATAATATACTTTGGTCAGAGTTGGTCTGCGATGC
TGATTCAGGGCTCATTGTTGGAGAGCACTGAGAGCGTTGGGCCTTTTTAAAAAATTTATT
TCTTTTTTGTTGCCCTTGTTATTGTTGTTATTATTTTTTTTTTAGAAGAATTTATTTATT
CATGAGAAAGGTAGGAGAGAGAAAGAACCAGACATTACTCTGGTATATGTGCCACCGGGG
ATTGAACTCAGGACCTCATGCTTGAGAGTCCAACGCTTTATCTACTGCACCACCTCCCGG
ACCACTATTGTTATTATTATCATTTTTGTTGGATAGGACAGAGAGAAATGGAGAGAGGAG
GGTAAGATAGAGAGGGGGAGAGAAAGACAGACACCTGCAGACCTGTTTCACCACTTGTGA
AGCGATCCCCTGCAGTTGGGGAGTCGGGGGCTTGAACCGGGATCCTTGAATTTTTTTCTG
GCTTAGTTCTCTGGTGAATAGTGTGCTGTCAAGAAAATTTTCATGTGATAGCTATTTGTG
AACATCGGTTTTCCTTATTAATCTATGCTGGCTGTTTCTGTAAATATAATACAGATTTTG
AATTTTAATACATTTCCTTTCTAAGTTCTTGTGGGGCTTTTCACTATAGGTGAATGCATA
ATTTTGGACAAGAAACTTAACATAGTGGGTGAGGGTAGGTAGTATAATGGTTATGCAGAA
ACTCTCATGCCTAAGGCTCCACAATCCCAGGTTCAGTCCCCTGTACCACCATAAGCCAGA
GCTGGGCAGTGCTCTGGTAAAGGAGAAAAGAAAGAAAGAAACTCAACATAGTTGTCTTTT
ACTGGGGCGGGCTAACTGAATCATTTTGCAGATTTGCAATCCTCTGTATTTAATTTATAC
TCAGTTCAGCGTTCCAGTTGGTAAGCGACGTTTAGCAATAACTCTTCCATCTCCCTTATA
GGTCAGATTCAATGTGCTGCAGTATGTGGTCCCAGAAGTAAAAGACCTTTACAATTGGCT
GGAGGTAGAGTTTAACCCATTAAAACTCTGTGAGAGAGTCACAAAGGTAAGCCTTATCCT
TAGCTTTGGTTAGATAAGCATGTACCTGGCCCTGTTGGGGTCTGAGTGTACGTTTATATT
TATTGGGAGAGAGCAATGTCCCATTTATACCAACACCGCACATTTCATTGTCCTTTTTCG
TTACGTTGTCAAGACAAAGGATATTTCTGATGTGCTAAATAAACCGTTGGAGGTAAATTA
GCAGCATGAAGAATTTAGTCATTGCTGTCAGTCACCTTCAGACAGTCCCAGTCACTTCAT
TGTACGTCCTGTATTTCTCTGTGTTTTATGATGTTGTGTCGTGCTGAGTATTGGAGGGAT
TTCATAGTTCCTGGAATATCTACTGCATAGAAATTATGAGTATGACTCAATTGAATGGAT
TTTACAGGTTCTAAACTGGGTTAGAGAGCAACCTGAAAAGGAGCCAGAATTGCAACAGTA
CGTTGCACAGCTGCAAAACAACACTATCCTCCGTCTTCTGCAGCAGGTAAACAGCCGGAA
TGGGCGATTTATGTAAGAATTAGGCTGATTGTTCTGACCACAAAATTTAAAGATCTTTTT
TATATATATACTACCCCCCGACTCCCCAAAATAATTCCTAATTTCATATTTGTTCTGGAA
GAATAATTGTACATCACAGACTTTTTTCTCTTGTTTATGCTACCACATTGGTGTCTCTTT
AGATGATTTTCATTCATTGCTGCTTGTGGTTTTGTTGGACAAAGTTGCCAAGGTTTATTT
GTGGAAGTCTGTTTCTAGGTATTTTGCTATTTAAAAATGTTGCAACACTGAGTCTCTTCC
ATATGCTTACCGTTTTCTGTCCTGTGCTTTTTCCCTGTGACACAAGTGAACGGTACGCAC
TTAAGCTTCAAGACCCTTACAAGACACTGTGTTAATAGACCTCCCGCCAGTAGTGACTGA
GGAAAGCTTTTCTACTGCTAACACTGTTACAGTCCTTGAAGCGTTTTAAGTCATTCTACT
CATATTTTAAGGGTTCTTTTTTGGTGCACATTTCATTGACCTGCTTTCTTCTGCTGGTGT
TAGCAGTGTTATTTCTGATGTGCTATAGAAATAGCTGAAGGTTAATTAGCAGTGTAACTA
AATAGTCGCGCTGCCAGTCTCCTTCAGACAGTTTCAGAAAATGACTCAGATGAATTAACA
CATCGTGGTGTTTAGGAATAGGTGACTGTTTTACTTCTTTATGAAGCTAAGATTTGAAAA
GATTATACTCTTTGAGGGATACAGTATATTGTGATGGTTGTGAACGCACAGAGTATGGGG
TCAGTAATTCGGGTTCAATTCCAGCTCCAGTAATACAAGTGCTCTGAGCTACTAATTCAG
TTTTCTCTGAAATAAGGGCATACTCTTAAATTCCCATGTTTGCCATAAAACAACACATTT
AAAATGTATTTAAAATAATCGCTATAATTATATATATATTTTAAATGCAGGTGGCACAAA
TTTATCAGAGCATTGAATTTTCTCGTTTGACTTCCCTGGTTCCATTCGTTGACGCTTTCC
AATTGGAAAGGGCCATAGTAGATGCCGCCAGGCACTGTGACCTGCAGGTATGTGCTGGAG
TTGGGGTAAGGTGGGAAGCCTTTGTGCTAGAAAGCTTGCCTTTTGCTACAGTGCTACAGT
GCGCACCTGGTCGAGCATACACATTAACGTACTCCAGGGCCCGGCTCAAGCCCTTGATCC
CCACCTGCAGTGGGGAGGTTTCACAGGTGGGTTAAGTAAAGCACTGCAGTTTTCTCTTTC
CGCTTTCCTCTCAGCTTGTCTGTCTTTATCCAAAACAAATAAAAAATACTGTGAAAAAAA
GACTTTCCTGAGTCAGTCTTACACCTTCCATATTTCACATTCGGTTGTTAATTTGTCTTT
AGTCAAAGTTTTTGAGTCCAGGCACTTGTTTGCATTGTGACATGTTCGCATATATTACAG
TGACACATTTACTTGATTTTCAAAGGTTCGTATTGACCACACTTCCCGGACCCTGAGTTT
TGGATCTGATTTGAATTATGCTACTCGAGAAGATGCTCCAATTGGTCCTCATTTACAAAG
TATGCCTTCAGAGCAGATTAGGAATCAGCTGACGGCTATGTCTTCAGTACTTGCGAAAGC
ACTTGAAGTCATTAAACCAAGCTCATATACTGGTATGTGAGTCTTTCGGCGGGGAAGAAG
CCACAGTATTTGTGGATGGTCATGCTTTGGCCTTTTCCAAAAAGCTTGTGAAGCCGGGAT
TGCTTTGGTTCATTTTGTACTTTGAACTTTCATCAAAAGTCGTCACTTACACAGATCCTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGGGGCTCCTACCTTTAACGCACCGGTGCCAGAGTGTG
TCAGTTAGACTTTTTTTTTTTTTTTTAAGCAAGAGAAAGAAGAACAGCATCAGTTGGCTG
TTACCGCATACCTTAAAAATTCACGGAAAGAGCATCAGCGCATCCTGGCTCGACGGCAGA
CAATTGAGGAAAGGAAAGAACGGTTGGAGAGTCTGAATATTCAGCGAGAGAAAGAAGAAT
TGGAGCAAAGGGAAGCTGAACTTCAGAAAGTACGGAAGGCTGAAGAGGAGAGACTGCGAC
AGGAGGCTCAAGAGAGGGAGAAAGAACGTATCTTACAGGAACATGAACAAATCAAAAAGA
AAACTGTTCGTGAGCGTTTGGAACAGATCAAGAAGACAGAACTGGGTGCCAAAGCATTCA
AAGACTTCGATATTGAAGTATGTGACGCAGTCATCACAGTCTGTGTGGTCTCTGAGCAAG
CAGCCCATTACCATTCATTGCTTAGCTTTGGACCAGTTGTTTATTGATGTCCAACTGTCT
CATCATCTTTTTTTTTTTTTTTTAATAATTTAAAAAACATTTATTCCCTTTTTTGTTTTT
TATTGATGTTGTTGTTGTAAGATAGGACAGAGAGAAGTGGGGAGAGGAGGGGAAGATAGG
AGGAGAGAAAGATAGACACCTGCAGACCTGCTTCACTGCTTGTGAAGTGACTCTCCTGCA
GGTGGGGAGCCGGGGGCTCAAACCGGGATCCTTATGCCCGTCCTTGTGCTTCGGCCACCT
GCGCTTAACCCCCTGTGCTTCCACCCGACTCCCTGTCTCATCATCTGTAATCTGAAGTAA
GCATTTGTTTTGAATGGTTCTCCAGTTTTGTTTTTTTGATAGGTCACACATATATTCATT
GTGGGTATGGGCAGATTAGATGAGTAAGAAACATGTCAAGGCTAAATGCTTGTTTTACAC
ATAAGTGGGACTAAGGTAATTTTGAAAGATTTTCACATTTCCTAAATTGACACCCATTGT
TTAAAAAAAATGTAATTTGTGATTTTTTACTTTAGAATGAAGTGTTCCTATTCCATGCAT
TTTTTTTTTTTTTTTTTTTTAAGATTTTATTTTGTGAGAGAGACCAGAGCAGCACTCTGC
CATGTACTCTGTGAGGGTTTGGATTAATGCTTTAAGCCCAGCACTTATGTTCACTGTGAC
ACTTCCCAGGCTTTTTCCTATTCTTGTTGATGTTGTGTTTCCACTATTTTCAGGACCTTG
AAGAACTGGATACTGATTTCATCATGGCTAAACAGGTTGAGCAACTGGAGAAAGAAAAGA
AGGAGCTTCAGGAACGCTTAAAGAATCAAGAGAAGAAGGTAATGATTGATGGGATAAATT
TGTGACATGACATAGTTAGAGAGATTATATTAAAGCCAGTGTTTTCATCTTTCAGATTGA
CTATTTTGAAAGAGCAAAGCGTTTGGAAGAAATTCCTTTGATAAAGAGTGCTTATGAAGA
ACAGCGGATAAAAGACATGGACCTGTGGGAGCAACAAGAAGAAGAAAGGGTAAGTTTTTC
ATGTGATATTTAAGTCTGTAAAGTTGTGATTAGGCTCTTACCTGATACCAGTCCAGCTCA
GGTCTTTGGCTACGCTGATTCGAGGCATGGAACCGGAGACTTTGCAGCCTAAGGCACAAA
AGTCCTTCTGTACGATCAAGGTGATAACTAGCCCCTCCCCGTGGTTAGATCTTCTATCAG
GAATGGAACCAGGGTTTCTGTCCTCCTTTTCAAATTAATGACTAATAGTAGGCTCTAAGA
TTGTAAGATTACAGTGTGCCGCTCCACACCACACCCGCCGTCAAAGTTCTCTTGTCATCT
TTCTCTCAATCTTAGAACAACCATAATTCTCAAAAGTCTTAAGAAAGTTTGCTTGCTTCT
GGTTTTTTTTGTTGTTGTTGTTTGTTTGTTTTGGTTTGTTTTTTTACCAGAACACTGTTC
AGTTCTGGCTTATGGTGTTGCAGGGGATTGAACCTGGGATGTTGGAGCCTCAGACATGAG
AGCCTCTTTGCATAACCATTATGCTATCTACCCTCCGCCCCCTCCCCTTTTTTCAAGTTC
ATGTGTATCAGACCTCTAGATTCCACACAGGAGTGAAACCATCCAAGAGCTGTCTTTCAG
CTCTTTGCTTAATTCACTAAACATGATCACCTTCACGGAACCAAGGTCTCTAAACTGATT
TGGTTGGTCTTCATCTTGTTGGTCATGGTGCTGATGTTGCATCGCAATTGATTGTTTGCA
GACACAGCTTCATAATAGATAAGGTACCAGCGAAAAGCTCATTAGCAAGAAACCAGCCTT
TACAGACATGCGTGCAGCTCACTCACCTGGTGGAGCGCCTACCACCCATGCACAGGGAGC
TGAGATCAAAGCCTGGTCCCTGTCTGCACGGGAGAAGCTTCATGAGGGACTGAGAGCATT
GCTGCAGGTGTCTCTTCTCTGTCTATCCTCGAACCCCACTTCTCCCCTCTAAAAACTGGA
AAAGGGGGAAAAAATATGGTGGCCAGGAGTGATGGAACTAAGTCCCAGCCAATTAACCCT
GGCGGTGAAAAAAATAAAACAAATACACCCATTCAAATGCAGTGTACAATTTATTTTTAG
ATTATAGGGCCACACAACCATCGGATTTTAGGGTCAGTCCACGTAAGCTGTACTTGTTAG
ACTTCACTTCCTACTGTGGTTCTTTCTGCCTTGGCCAAAAGTAACCACTAGTCTCCTTTG
TGTTAGGTTTGCCTGACCATTTCAGGCATTTAATACAGCGAATGCGCCTTCAACCCATTC
TGTTAATTTAATAATATCAAAGGCAATGTTTGCTGATGCCTGCAGGAGCTAAATTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAGATGAGTAGCTGCACTCTGTGCGTGGAGCCTTTTATCT
TTCACGGGAAGCGTAAAAGGGGAAGCATTCCTCTTTGATAGTTAATTAAAAGCAGATGAA
TGCTTTCTATTTTGCTTGAGTTCAGACGTGGATCTTCTGGCATCCAAGTCACTGCCCTAC
AGCTATGTAGCTGCCTGGCACTGAAAAGTTACTAGTGAGTAGTTCATCCGGCCTTGACTT
CAGTTTTGTTATATTGTATCTTTACTTACTAAGAGGTATTGTTTTCAGGTATATTGTGAT
TTCTCTGATAAAGTACTTTCTGACGCCAGTGAGACTAAACTTTCATGGGAACCCCATAAC
TCGTCCGCCTCATGTCCCGGGTCGCTTCCCTAGACACTGTCAGTCTGGAGATTAGCTGCC
CTTCCATTTTCTCGCAAGATGGGAAGGGGCAGAGATCCTGCTTGTACAAATACACCTCCT
AGAAATTTGTGTTTTTATAATAATCAAGTGATAAATGCTCTGAAACTTGACTGTCTGATG
TATTTGCAGATTACTACCATGCAGCTAGAACGCGAAAAGGCTCTTGAACACAAGAATCGA
ATGTCACGGATGCTTGAAGACAGAGACTTATTTGTGATGCGACTCAAGGCAGCGCGGCAG
TCTGTTTATGAGGTGAATTTTTACTGACCTCAGAGAAACATTCACCAGCCCTTTAGTTTT
GTCTTGAAATTAAGAGAATTCTATAAAGGAAAAAGCTTGGCTTCTTGCTGTGCTGCTTCC
TGCCTTGGCCAAAAGTAACCACTAGTCTCCTTCGTGTTGTCAGGTTTGCCTGACCATTTC
AGGCATGTCATACAAGGGGACTTTACGATGTCCTGTGATGGTAGTTTCTCTTAAGCTAAC
GTTTCGAATGATCATTCACGCTGTTTTAGCGTACGTTTTCATGAAATATTTTATGAGCTT
GGATAACTATCATAAAAGTTTTAAGAGTAAGTGGACCATATATAGGTTTTTTTTGACAAA
AGCCTTTACTAGTCAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCGGGCATGCGTTTTTGGATTGCGATGAAGCCTTTTACCCCCCCCTCTCCAGTTT
GTGTCTTTCTCCTTCAAAATCACCACAGAGTCCTTTTCGTGCTGGGAGTTTCCCTTATGG
CTAGTATTTCGAAGCCCGGAAACGCCGGTTCGCGTTTTGACTTAAATGATGTTTCGATGC
TGGCTGCCCATGGAATGTAGACTTCGAGAAGGACGCGACGAGGAGAGGCTCACCGCAGAG
AAGACGACGAGAGAGAGTCCTCACTCCGGCCCGACGAAGACCGAGCTCCCCGGCGTGGCC
CGGACGAGGACAGAGGCCCTAGACGCGGCCCCGACGAAGACCGATTCCCCCGCCGCGGGG
CGGACGACGACAGGCCTTCCTGGCGCGGCGCAGGCACAGGCGCAGGCGCAGAGGACGACA
GGCCCCCCCGGCGTCTGGATGAGGACAGGGGAGGCAGCTGGCGCCACGCCGATGACGACC
GGCCGCCACGGCGGGGACCAGACGAGGACCGAGCAAGCTGGAGGGCGGCCGATGAGGACA
GAGGGCCGAGACGAGGGCCAGACGAGGACCGGGGGCCTAGGCGCGGGGGCCCGGACGACG
AGCGCTCCTCCTGGCGGAACCCTGCCGACGACGAGCGGGGGCCGCGGCGGGGGCTGGACG
ACAACCGGGGACCTTGGAGGAGCGCCGACGACGACCGGATGTCCAGGCGCGGCGCCGACG
ACGACAGGGGCCCTTGGCGCAACGCGGATGACGACCGAGTCCCCAGGAGGGGCGAGGACT
CCAGGCCCGCTCCCTGGAGGCCCTTCGTGCGGCCCGGTGAGTTCTGTGTCGGGGCCCTGC
TGGGGGACGCAGGGGTCTGCTGGCCTCTGACAGGTGACAGGCACAGGGTGGAACCCCCAC
CGCCAGCACCCTCCCCCGTGCAGCCTGGCAGGTTGACCACCCAACAGGCCTGGATTTTTC
GGATTTTCTAGTAAAAAGGGGTAGAAAGTGAACGTTTTCGTGCCTTTCCAGAAGAACTGG
GCTTTACTTTCGAACCATTCTTCTGCAGGGGCCTTTCGGCACGGGGGAGGGGTGTGGGCT
TTCCTGGGTGTGCCGCCACCTGGGTCCCTCCCTTTGANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGCGTTTCATTCCGGTCTTGCCGGACGGCCTGTTATCTAGCCG
CACACTACATGGCACATCTGCCCAGTTGCAGGTGTCGCTCCTTCAGAGCCAGCCTTTGAA
ACCAGCCTTTGTCCGGCTGGTGCTGGGGCTGGGGCTGACAGGACCCTCACCCGTCTGCTG
CAGGAGCTAGACACAGACAGACACACACACATCTTGTGCCCCGTGCTCTACTTCCTTAAT
CCTTTTAAATCTTTCCTTTAGTTTAATTCAGTTCTGCCTGCCTTCACTACTATTACTGGT
CTCTGCTGACTTCCCCACTCTTAGTTCTAGTATTTATGCAGTAACTGAACTATAATCTGT
TCTGAATGGGCATTTGTGGGCAACTCCTTGCTTTTATGCTGAACTGATGTCTCTGCTTCT
TCTGAGTCACATTATTCTACTGTCTCGCTGTGACCCTGGAGCCACTCACATGTCCTGTGC
TACGGGAATAGCAGATGCTCATTAATTTGTGATTGGTTAATATGTTTTTTTAACACAAAG
TTAATCTGTCTTTTTTTTAATATTTTTTTTTATTTATTCCCTTTTGTTGCCCTTGTTTTA
TTGTTGTAGTTATTATTATTGTTGTTGTCGTTGTTGGATAGGACAGAGAGAAATGGAAAG
AGGGAGGGGAAGACAGAGAGGAGGAGAGAGAGATAGACACCTGCAGACCTGCTTCACCGC
CTGTGAAGCGACTCCCCTGCAGGTGGGGAGCTGGGGTTCGAACCGGGATCTTATGCCGGT
CCTTGTGCTTTGCGCCACCTGCGCTTAACCCGTTGCACTACAGCCCGACTCCCGATTGGT
TAATATTTTATATTTACGTTACTGGGAAAGGTTCCCATGATCTCTTTATGAACTTCTATT
CAGGCAAATGAATGCACACACCTTGTTTTATGTATACTTGCTTTAAAATAATTAGGTTAC
ACACACACACACACATCTTGAATTATAACTGAATTCATGACATGTCACTGTAACTCATTC
TGAATGAAATGAACAGGGCTGGGAAGTGGCGCCCCTGGTAGAGTGCATGTCACCACGTGG
GAGACTGTCCTCCTCTCTCACACTGTTGAAAGCAGTGGTTGCTGTGAGCGCTGAGTCCAC
GCAGGGAGAGACCGAAAGGCAGGCAGCCACGGCTGGCAGGTGCGTCTTGCCCTGAAGCTC
CGTCTGTCGGCTTCTCGCCGGGAGCACAGAGGCTGAGGCCGGCAGACCTCGGCGGTAGTC
AGTGCAGCCGCGTTACCGTTGCTGCTGGCGCCTGTGCCGTCCCGTTGATGAACTCATTCA
CTCCTGCCCGTGACTCTCACACTCCCAGCCTCCCAGGTCCCACTCTTGCTTGGATTCGCT
CGCCATTCTCGAAGCGGTCCTGAGGCGCGGTGCGGGCTTGTGTAGGGTGGGCAGGTGTGT
TTCCACCAGCCAGCCCGTTGCCAGCTGAAGCCAGTGCTCAGGCCTCTTGTCTTGTCTCGG
CTCTCATACTTTTAAGTGTTGTTGGTGACCTGCTTATTCAGTGCCGCACTCTCTGCTCTT
TGCTGGTGATTCACTGTTTACAACAGCTGCCGACAGAGCGCTGAGGGAAACGATGGGGAG
CAAAGCGAGGAGGAGGAAAAGGTAATTTCGGTTATAAATGTAAAAGTGTTGCAGGGTAAG
AATGAAGTCACGCTTAGAGCTGTAGTTCTTAGCATACTAGAAATCTTCCCGACGTTTTAA
GCTTTCTGCTTGAGTTCCTGCTTATCACTGGAACAGGCTTTTGATACCCGAAGGCTGTGC
ACACACACAGACAGTACCTGTTTCTTGTGAGTAAAACCATAACAGTCCTAAATTAGAGCT
GCAGAGTCTCTCAACAGAAATTACTGTTTTTTTCTTCTTAATATAGGTGGATGGAGAGAG
AAAGAAAAAGCCAGAGAAGAGAGCTGGGGTCCTCCTCGAGAGACAAGATCAACAGAAGAT
GTGGAATGGGATAGAGACAAGGAGAGAGATAATCAGGATCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGATTAACTCTGGCAA
GTCTGGTGGTGTCTGAGAATGAACCTGGGATCTCTGAGGTGTCAGTCGTGCAAGTTGACC
ACTCTCTTGTTTGTGTACATTAAATACATGACTGATCTTTTCACCTTTAATTTCATTTAA
AAATTTTTTTATTTTTAAAATATTTGTCTTATATGAGAAAGATGCGAGAAGAGGAAGAAC
CAGGTGTCACTCTGGTACCTGTGCTACCAGTGATTGAACTCGGGACCTCATGCTTGAATC
CAGTGCTTCATTGACAGAGCCACTTTGCAGACCACTTCACCTTTACTTTTATTAGTGGTG
CAAGTTTTTTTTTTAATATTCCCTTTTGTTGCCCTTATTTTATTGTTGTTGTTGTTAACT
GATGTCGTTTGTTGTTGGATAGGACAGAGAGAAAAGGGGGGGTGGAGACAGAGATGGGGA
GAGAAAGAGAGACACCTGCAGATCTACTTCATCGCCTGTGAAGCGACTCCCCTGCAGGTG
GAGAACCGGGGGCTCAAACCGGGATCCTTACACCGGTCCTTGCGCTTCACACCATGTGCA
CTTAACCTGCTGTGCTACCACCCGACTCCCAGCACCAGCACAATTCTATAGCTTTCTTTT
TCTTTAATAAGATTTTCTTGCAAGTTTTTTTTTTTAGTTAACTTTAAAAAAAATATTTAT
TCCCTTTTGTTGTTTTATTGTTGCAATTATTGTTGTTTTTGTTGTTGGATAGGACAGAGA
AATGGAGAGGGGGGAGAGAAAGATAGACACCTGCAGACCTGCTTCACCGCCTGTGAAAGC
GACTCCCTTGCAGGTGGGGAGCCAGGGCTCGAACCAGCATCCTTGCGCTTTGCGCCACGT
GCACTTAACCCGCTGCGCTACCGCTGGACTCCCCCCCCCCTTTAAAAAGAATTTATTTAT
TCATGAGAAAGGAGAGTAAAAACCAGCCATCTCTCTGGTACATGTGCTGCTGGGGATTGA
GTTCAGGACCTCATGTTTAAAAGTCCAGTGCTGTAGCCTCTGTGCCACCTCCCAGACCAC
TTTTTAAAAACATATCTTTTATAGACGGCCAGAATTGAGAGGGAAGGGAGTGGTAGGGCA
GGGGAGAGACACTTGGCAGCACTGCTTCACCACTTGTGGAGCTTTCTCCCCGCAGGTGAG
GCTCGAACCTGGGTTTTTGTGCACTGTAACATGCGCTCAACCAGGTGCACCACCACCTGC
TCTCAGTTCTACAGTTCCCTGCAGGGTGAAAATGCTGTATCTGCGGTGTTAAGTATGGTA
GCCAGGCGTCCGCTGGACGTTGGATAAGAGGTTAGTGCCGGGGAGCATGCTGGTTTTATT
CAGTTAAGGAGCCACTTGTGGGGAGACAACAGACATCCGGCTGTGCCCACGTGCCCTGCA
TACCCGGAGGCATCACATTTAGGTCAAGCCTTGAGTTTACACTGACGTTTTCTAAAGCCG
CCAGTTTGGGTTTGACACGCTCACTCAGAGTTTCCTGTGTAGTCTAACGACAGCACTTGT
CTTGAACTGCTCAGGGACGAGGGTGGCTGGAGAAGAGGACCAGCTGAGGAAGCATCTAGC
TGGAGAGATTCAGGTCGACGTGATGACAGGGACGACCGCCGTCGAGATGATCGTCGTGAT
CTGAGAGAAAGACGTGATCTAAGAGACGACAGAGACCGGAGAGGCCCTCCTCTCAGATCA
GAACGGGAAGAAGGTAGAGTAGAGAGCTCTGTACAGCAGCAGACAGTGTTGTGGAGGGAG
CCGCGGCATCTTGGGCTGGGCTCATGCACTTTCTGAGCGTATGAATTTGAACACGAGTAG
TCTTTTTTTTTTTTGAAACAGTAAATACTCACTTTTGAAATACTACCCTCATTTACCTAT
TGGTTACTCTGAAGTTAGCACATCTGTAATTCAGAGTACTTAGTAGACTGAATTGGATTA
TGACAATATAAAAATTTGCTTAGATGAGGAAACAATATATCTTGAGGAAACACTTTTTCA
GTTATTTGAAGTAAGGTCCCGGTAGACACAGGTGTAAGAACCCTTTTTTTGGAGACGAGA
TGGTTCAGTCATTAGTAGAAAATAATTTCAGTATGTCTGACGCGATCATTGCACTTGAGT
TAATGTATGTTTGCACACCTTGACTCTAAGGTTATTTCTTTTGCTGTAGACATCAGAATA
CTCCCAAGACTTGGCTATTGAAATGGTTTTGACAAGAACAAAAAGTCCTTCGTTTTTTGT
TGTTGTTTTTGTTAAGCTGGATTTTTTAGGTCATCTTGGCCTTCCCCCCTCTCCCCCTCC
AGTGAGGACATGATTAAACTAATATCTTCTTTTTTCTCTAAAGATTTTTTTTTTTTTTCC
TAAAGATTTTTTAAAAAATTTATTCATGAGAAAGCTAGGAGGAGAGAAAGAACCAGACAT
CACTCTGGTACATGTGCTGCTAGGGATGGAACTTGGGACCTCATGGTTGAGAGTCCAATG
CTTTATCCACTGTGCCACCTCCTGGATCACGGCTAATGATTTTCTCATTTGCATCGTATC
TCTCAACCTGTATTTTCAAGAAGTTGTATCAGAACTTTTATCAAAATGTTTAAAAAAAAT
GCCTTAGCTTACATTAGTTTTTATGGAGATTGTCTTAGTAAAAGACCGATGAGTAATTTG
TGGCATTCCTTTTTGCTGAAGGTCTGACTAGTATGAACCAGTAGACTGGAGCCCAAACTT
AACACTTGTTCTTTGAATTCAACCTTTTAGTGAGTTCTTGGAGGCGTGCCGATGACAGGA
AGGATGACCGGGCAGAGGAACGGGAGGCCCCCCGTCGCATTCCTCCCCCAGCTCTGTCAC
GAGACCGAGAAAGAGACCGGGAGAGAGAGAGAGAAGGTGACAAAGAGAAGGCCTCGTGGC
GAGCAGAGAAAGAGAAGGAGTCTCTTCGTCGTACTAAAAACGAGACTGATGAGGATGGGT
GGACCACAGTGCGGCGTTAATTCTCAAGATGATGGATTCAAACTTGTGTCTTACCTAGGT
CTGACCACATTCGAGGATTATTACACTTGTGCTTCAACCAGTCTCAACTGGATTCTTTAA
TGTTGTCTCACCATAACACAAAAGCATGAACTTGTATTAACCCCGTGTAATAGATTGATC
ATGCGCCATATCCGCAGAAGGTTGGGAAACCATGCTGTTTTTTTCTGGAATTTAAGGTGT
TGCATTATTTCATCAATCATTTGTTTACAAAAAAGGAAAAAAAAAAACTAAAAAATAAAT
TTGAAATGTGAACCCTTCAGGTCTGAGTAACACCTGTATCTTGGTATAGAACTTTTTTTT
TAAATTTTGAAATAATTAATTTGCAGCAAGGTAAGGTTCTGTTATAGGGGATGTATTTGA
AGATCGTTTAATAAAAACAGGGAGCTGAAATTCACACCATTAGCAGTTGACATTACCTCC
ATGTAGTTTGGGGTATTTGCTGTTCAAACTAAATTTCTAGTTTAGGTTCACTGTAAGTGC
GGTAAGCTTCGCAAGCATTGGATACAATGGGACTTTTTAGCTTTTACTTGAGGTGAGTAT
AAAGCAATTTGCAGTCTTTGTAATGACAACAGTACTGCTCAGGTGTGAATCCAAAACAGT
TACAACTTTTAAATTTTAAGATATTTGGTAAACTATTGCTGAGGGTTTTTTTTTTTTTTT
CCTGTTGCCAATAGCAAACTGCTTTTCCGTTCATGGAGAATTCATGCCTTTCAAACATTT
TAAATATGACCATATTTATAAATGTGTGGTTTGGAGGACTCATTTAAATTCTTTTTCCTA
ATTTCCTTTCTCTTCAGGATAGATTCTTTCAACAAGTAATTTGTAGTAATGACTGTGTTG
ACTTCAATTTTGGAGTGCAGTAGCTGTGTTAAAGGTTATTTGGTTTTATTGAAGCCAACA
CAGAACTTGCTGCTGTGGTTTTTCTTCAATGATAAATAAAATACTTACAGAATTTGTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1189, 1334..1470, 3531..3694, 5938..6137, 7687..7895, 10818..10892, 10894..10915, 10917..10929, 10931..10954, 10956..10986, 10988..10994, 13381..13485, 13867..13965, 14930..15046, 15445..15617, 15619..15631, 16229..16576, 17393..17497, 17575..17688, 20649..20771, 21238..21391, 21492..21676, 21777..21865, 22151..22187, 22190..22352, 22371..22729, 25068..25261, 27674..27852, 28890..29119
1001..1189, 1334..1470, 3531..3694, 5938..6137, 7687..7895, 10818..10892, 10894..10915, 10917..10929, 10931..10954, 10956..10986, 10988..10994, 13381..13485, 13867..13965, 14930..15046, 15445..15617, 15619..15631, 16229..16576, 17393..17497, 17575..17688, 20649..20771, 21238..21391, 21492..21676, 21777..21865, 22151..22187, 22190..22352, 22371..22729, 25068..25261, 27674..27852, 28890..29116
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved