Erinaceus_europaeus Locus PSMA6
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus PSMA6
Erinaceus_europaeus
PSMA6
GeneScaffold_1427
SNORA23
50270..50453
52595
GCTACCAGGAGCTGGGGAAATGCAATAAAAAAAAAAAAAAAAAAACACTAGACCTAGTA
GTGTGTAGTTTCTTAGAAAAGAAAATGCCCCCCACATCTATGGACATCTAATTTTTGACA
GAGGGGCTCAGACTATTACATGGGGAAAGCAGAGTCTCTTCAACAAATGGTGTTGGAAAC
AATGGCTTGAAACATGCAGAAGAATGAAACTGAACCACTGTATTTCACCAAATACAAAAG
TAAATTCCAAGTGGATCAAGGACTTGGATGTTAGACCACAAACTACCAGATACTTAGAGG
AAAATATTGGCAGAACTCTTTTCCGCATAAAAAAAAAAAAAAAAAAAAAAAGGAGTATCT
TGCCTGATTTGGGGGGGGGGTGCCCTTTACAATGGCTGGCTACCTTGAACCAGCTCCTTT
CTTCAAGCAGGTAGGAAGAAGGAAAGTGGTTTATCTTTTCTCTCTCTGTTGCCTATAACC
ATATTGTAAAGCACTAGCCTCCCAGTAAAATTAAAAAAAAAAAATTCCCCCCAAGTCAAG
CTGGAATTGCAATTAGGAACGAGAGAGAGAGAGAGGAGAGAGGGAGAGAGAGAAAAGAAA
GTGGGTGCGTAAAGAAGTGAAATGGAACGTCAACAATCTAAACACAGTCTGGCTATGCAA
GTGCCAAAATTAACAACAGACTTAAACGGGCGACCCACTTAATGCATCGTGATAGGTAAA
CCGCCAGCTACAGGCGTGTGTTCTTGCGTCAGCGACCTGCGCAATAAAGGGCTTGCGCAA
GCGCACTCACTCCGAAAACCTTCACACCCCCCACACCTCCAGGGGAGGGGCGTCGGAGTC
TCGCGCTCGAACTGGCTTTGATTGGGAGCTGCGCGCGCAAGAGCGGAAGAAGCTGGTCTG
TGCCCCGGAAGCATTCGGTGAAAGTTCCGGAGGGAGTCGGAGCGCCTAGTGCGGGAACCC
CGGGGCCCAGCGACCGTGATAAAAGTAGTGGGGTCGCCAAAATGTCCCGCGGTTCCAGTG
CTGGTTTCGACCGTCACATTACTATTTTTTCACCCGAGGGCCGACTCTACCAAGTAGGTG
AGTTCACCAGTTCCGCGGAGCGCTCCCCGAACTGCTCTGTCATTGCGCGGCCTGGAGCCG
GGAGCCGAAGCGTGGCGGCAGCTCTGGCGGGGAAGGGCCGAGCCGGCTGTGTCCCGGCCC
CGGCCCGCGGGGGATGGAGCCCGGGCTGCCCTCCCTGGACACAGTGGGTCGAGGGAGGTG
CAGGTGGGGCTGTGATGCCTGATTCTCGCTTCCCGACGCCCGTTCACTTGCTTGGACTTT
TGGTCTTGGCGGACGCAAGCCTGCTTTCCTGCAGCAGCATCGGCTCCGTAAGTGCGGGGG
GTGCGGAGGCCCCGGGTCCACGCATCGCCTTCAGCTCGGGGGCTCGTCCCCGGTGTGAAA
ACTGCGTCGTCGGCGGGCCCCCGCAGCTTCCCGAAGACGAGCCTCGGTGGAAGCTAAACC
CTCGAACTGTCTGTCGGTGCTTAAGTGTGAACCGTATAGGGGCCAGGCGGTGGCTCACCT
GGCTAACCGCGCACATCACAGTGCACAGGGACCCGGGTTCAAGCCCCCGGCCCCCACCTG
CAGGGAGGACGCTTCACTAGCGGGGAAGCAGGCCTGCGGGTGTGTCTCTGTCTCGCTCCC
TCTCTACCTCCCCCTCCTCCTCCGATTTCTGGCTGTCTCCATCCAAAAAAAAATAAAATG
AGAGTTTACAAATGAAGTTAATAATAAAGGTAGTCATTTGAATAAACCGTATGTAGTATT
GAATGGAAAGATAGCGTGAGGATTGAAGTCATGATTGATACAGTGTAAAAGATAGCCTTG
ACCTCTTGGCATAGAGGATTTGAGTTTAAGGAGAAGCTAATCTACAGCTGAGCCCTGGGC
TCACGCTTGAATAAGAAGAGCAGCTCAGGACGTTGGTGAGGATATGTATNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGCATCAGC
CTACTACTTTGAATATTCTATGCTGTGGTTTCAGTTTGCGAACAGGACACGTTACACTTA
GATCTACACTAGCTTTTGTGTGTGACACTCAGCTTTGAGGTGTAGTGTCAGACGTCCCAG
GTGTGGTGAGTAGAAAGGCCCAAAATGTCTTACTGGGTTTGGAATAGAGCATACAGGTCA
AAACAAGACTCATGTCTACACGAGGAAGCACTGCCTCATTGGACACACTGCTTCTGCTTT
CCGGAACACGGATTAGACATGGCTAGCAAAAGGAAAGCGAAAGCTCAGCTTGAGCAAGCT
GTGTAATGGTCAGGAGCCCAGGCCCTGGAGCCATCTCTGAATTCAAGCCGCCTCTGCTCC
CTCCTGGCCAGCCCAGCAAGTGTTAGGACTTTCGCCTTAGTTTCTGTTTGCAAAGCTGTG
CCAATGATGATTCCTTCCAGTCGGTTATTTTGAGCATTAAGTACTGTGGTGTATGCAAAG
TGCTCAGCACAGTACAGCCCTCATTAGATGCCTGTTTGACTCGACTTTTTTCCCTACTAG
ATTAGTAGTTCTGTAGTCTTGGGATATTTTTCCAAACTTCAGATTATGCCAGAGACAAAG
TGTGTAGAAATTGTCAATTGCAGTTAATTCTGACAGAAGAAAAGACCACTGGAAAGCTAA
GTCTCCTCATCTCTCACACTGGGGCTCAAAGACAGTCTGAAATAAAGGCGCGGATTCAAA
GCCACAGTGCTTGCTCCCAGGGGGTAGGGAGAAAAAAATAGGTGTCTCCTACTTCTGGTA
ACAGTTGAAGCTTTTAAGAGTGCATACTCAAGGTATGTGTTGTATTAAGGGAGGAGTGGG
GAGAACTTACCACCTTAGAGCTGTATACAGGACATCTAGCTTTAAAATATGATTTTTAGA
GGGCTGGTTGGTGGCGCACTTAGTGGAGAGCACATGTTGCAGTGCTCAAGGACCTGGGTT
CATGTCCCCAGTCCCCACTTGCAGGGGGAAAGCTTTGCAAGTGGTGAAGCAGTGCTGCAG
GTGTCTTGTCTCTTTCCCTCTCTGTCTCCCCCTTCCTCACGACTTCTGGCTAGCTCTATC
CAGTAAAGAAAGAAAATAAAAGTAAAATATTAGGAATTCCCCCAAGTTATTATTGGGGAA
ACTACGGCCTTGATGGGACAGGTTAAACTTGAATGCTTTCACCCCCCCACACACAGTCCT
TTGCTGACTTACATCTGGCAAAGAGGAGAGGAGCAGTAACTTAAATTTGTCTGTCAGATG
AATGCTGTCACTGATTGTCTCTTAGCAGGTGCAAGCTAAGTAGAAACAAGAAAAATAGGG
ACTTTGGAGGCAGATTGGGAAGAACAGTTTTATCATCTACAAATGACATTGACAAAGTCA
GAATTCCTGAGTTTGGAGTCCTTGCTCCACATCAACTTTGAGAATTTTCTTCATTTTAAA
GGGAAGTTAATTCCACCTATGCTTTAGGTCTGTAAGGATTTAAAAGTTATTAGTTGTGAA
ATAATTAGAACAGTATCTGTCACATAGTAAGTGATCGGTAAACATTTCTGTAATAAGTGT
TACAGGAACAAGTAACGAGTAAAAATCAAGTTAGCAGTTTCACAAATGAATGAACTGAGA
AATAGCTAATGTTGGCTTCTTGTTATTAAAAAGTTGTGTGGGGTGGTTGTGGAGGAGAGA
CCAGAGCCTGCTTTGCCATTTTGATGTTTTGTTTGTTGTTTTTATGCAGTGCCAGGGAGC
CAAGGCAAGGCATGTGTCCTACCATTGACTCACCTCCCCCTCCTACCTCCAGTTTTTTTT
TTTTTTTTTTTCTTTCCTGGTAGTACTTTTCAGCCTAGGCTTCTGATGTCCTCGTGTGAT
TTGAAATTAAATGTGTGTTTGGGAGATGACTCTGTAAAGTACTTGGGTTTTTTTGAGATT
TATTTATTCGTTGATGAGATAGAACTAGAGGATTGCTCTGGTCCATGAGATAGCAGGAAT
TGAAATTGGAGCCTGATGCCTGATAGTCTACCATTCCACCCACTGCATCACCTCCCAGGC
CATGATGAACATGCCTCACCATGTGGGATGCTCTGGGTTCAATCTCTGAACATCATGTCT
CCTTTTCTCTCTTTATAAGGAATAGAAATTGATCCCAGAAGCCTGCTCAGCAGTATTATG
CATGCACGAGGCTCTGGTTTCATGCCATTGCATTTATTTTAACTTCCGCTGCATTCAAGT
AATAAATGTGTATGTGTGTACATAAATCCATGCTCATATATGTTCACGCACGTGTGTGCA
ATAGGAGCAAACACTGCTGTGCTTTCATGTCTCAGGTTTCATTTCCCTACGCACATTGCC
AACACTCGTAATGATTTCGCCTGTCTTAAAGAGTACAGCATTAGAAAGCGAAAAAATTCC
ATCACTGCAGCTGTGGGGGGGATTCGGGAGCGCTGAAGCAGTGCTGCAGGTGTCTCTCCT
TTCTGTGCTCTCAGCCTTTCCCCCCCTTTGATTGCCGGTGAGAGCACAGAAAGAAGAGAT
ACCTGCAGCACTGCTTCAGCGCTTTCCAGTCCCCACCCCACCCCGCAGCTGCGGTGATGG
ATTTCTTTTTTTTTTTAGGTCAAACTTGCATCCTGAGCAATCATATAATAACAGGCAACA
ACTAGTTGAAAACGTGGTATTGAAATTAGGCAAGGTCCAAGAATGTAATAGAATGTATGG
TTGTTTCAGTTTGCTTTGGTTTTCTTACCCCCAGGCTTGGAAGGGGATATTGCCTTATAT
CCTAAATCTCAATTTTTGTTTTGTTTTGTTTTTTGCCACCAGGGTTATTGCTGGGACGTG
ATACTGACACTACAAAACCGTTGCTCCCGGCAGCCTGCTTCATTCCCGCCCTTTCTTTCT
CCTTTCATTTGATAGGCCAGGGGGAAATTGAAGGGGTGGGGGAGAGAGAGACACGCTCGC
CCCTGCAGGCCTCAATCCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
CGGGTAACAGATGACCCGGGACTCATGGCTGGGTGTAAGCAGTATCTCTTTATTCATGCA
GGACACAGCACAATCTAAGACGAGCTAAGTTAAACTCAAAGTACAGTACTCTAAAACTCA
CAATGCTGTCTTTATATATACTTCCCAAGTAGGGTGGAAACAGGATGTGACATAGAGAGG
GTGGAGAGAAAAGTGACTGGTGAAAATCAGGGTGTGACAAAGAAGGGATCAGGGTGTGAC
AAGGAGGGGGGGTGGAGCAAAAACATATCATGAAACAGTGAGGATTGAACCAATGCCCTG
GAGGGAGGTGCTTGTTAACAGCGGTTATGTAAATAGAATGAAGTGGTTATGTAAATAGAA
TAGTGTTAAGCAGGGGGGATTTAAACCAAATGAAACAGAAGGGGTCTCATGCATACCAAC
AATTCCCCGTTTCTTTTTAACTAATGGCCATTGTGGGGTGAACAGAAATGTATATCGTAC
AGGCGTTTTTCAAAAGAACTGGCATAAGACATGGAAAACAAAATAGGCGAGCAGCAATAA
TCAGTGTGATGCCAAGAGGAACGTTTCTTGCCTCAAAGGGCAAGGCCTAGCAGGCGAAAG
GGCATTTCTTGCCTCTGGGAGTGCTTCATGCCTCTGGGGGCATCTCTTGCCTCTTGGGGT
GCTTCATGCCTCTGTGGGCATAACCTAATAAGGAGGGAGAGTTTTCTACCTCTGGGGCAG
AGCCTGCAGGCGAGGGGACATGGTCTATAAAGTCTCAAGGCAATTGGCTGAAGTTAGTCT
TTGAGAAACACAGCAGCGTGTACCAGTAAGTCCGATGGAGGTGTCAGTCCAAAGTAGCTG
CCCACAGAAGAAAATGCCAAGGGATGAAACGCTGTACGTCTGTCTCGATGGGGAATGTCG
GCCACCAGAATTCTGCTTTTCTGTAGAGAGTGAGCTTTAGGGTCTGTGAATCTGTTTCTT
CAGGTCGTGCCAGGTCTCATCATTGGTTTCCGGGGGTGTGTTGTAATCATTCCATCCTGT
GGGCAATGTCAGAGAACAGGCGTCCAAATGGGTTTCCAGAAATTTTCATTTGAGTAGATG
CTTTTTCGTGTGAAGACTTTGACAGCTGAGATTCACTTACTTGTCAAACAAAACTTGTAG
CAGATTAGAAGTTTACTATAATTGATAACTCCATTAAAATTGGAAGTCCTTTCTAGTATG
ATTTTAAGGTTGTTTAAACAGTTTAAACTCAATAAAATGTGGAAAGGTAAACAGAAGAAC
CACGGTTAAAAGCTTCAGGCATGAGAATAATTAACATAATCAATGCACTATCTGCCCCAC
CCATAACTCATACAGTTTTCAGGATTAAACCTTTCAGATTCATGTCAAGACATAAAAGAG
AAATCAAAGGAGGGAAAAAACAATTTTTTGGATTGTTTCTGGATGTCTCTAGAAACATCA
TGGCTGCGTCCAGCATTTTTTTTTTTAAGTCAATGTCAAACAAAAATTCAGTCATTCAAA
TCATTCTCTTATGAAACGCAACTTGAACCAGATTATCAAGCTCTCACCATGTAGGATTAA
GAATCCCCGGTGGGCGTCCTAGTCCAAAAAGCTCCTCAAAATTCCATTTAGGGTGGTGCT
TCTGACTGTTCCTGCTGGATTGCTTCAGGCACTCATTTTTAAAAGTGTCTTCCCATCAAA
GAAAGAATCCAATCAGGAGAGTAGAACTAACCACGACGTGTCTCCATACTTGGGAACTGC
CAGGGTACTTGAGAATGTTCTTCAAATTAGAGTAGTCCTTCTCCATGGGAAACATGCGAG
AAGAAGTCCAGAAAGTCCCAGTGGAAATCCCCATGCATATCCCAAGGTCTACGATCACGG
TCATAAAGAACCAAACTGTGGCCTGGAGCAAAATGTAGTCCTTTTCCTCAGGAAACATGG
GAGAGGGAATCCAGAAAGTCCAAGGAGAAATCTCTGTGCATCTCCCAAGCTCTATGATCC
CGGTCATAAGAAACCAAAGTTCCCGGTGAGGGAACCGAAGTGTGGCCCAGAGTAAAATGT
TCCAGAGACAGAGAAACTGTCTCATAATGAGACAGTAGAGGCTTTGGCAAACCTCTTCGA
AAGTAGAAGAGAAGACCATAGTGCATAGGTAGGCAAAGTCTTCACTTATCTGGGAGTTGC
GCAGGTCTGGTCCCACGTTGTGGCGCCATATGTTGTTTTCGACGGGTTAGGTTGTTTTCG
CCGGGCTGGCTTCACAGGCGGGTAACAGATGACCCGGGACTCATGGCTGGGTTGTACGCA
GTATCTCTTTATTCATGTAGGACGCAGCACAATCTAAGACGAGCTAAGTTAAACTCAAAG
TACAGTACTCTAAAACTCACAATGCTGTCTTTATATATACTTCCCAAGTAGGGTGGAAAC
AGGATGTGACATAGAGAGGGTGGAGAGAAAAGTGATTGGTGAAAATCAGGGTGTGACAAA
GAAGGGATCAGGGTGTGACAAGGAGGGGGGGGGTGGAGCAAAAACATCATGAAACAGTGA
GGATTGAACCAATGCCCTGGAGGGAGGTGCTTGTTAACAGCGGTTATGTAAATAGAATGA
AGTGGTTATGTAAATAGAATAGTGTTAAGCAGGGGGGATTTAAACCAAATGAAACAGAAG
GGGTCTCATGCATACCAACAGTAGATAGAGGAGGGGAAAACGGGGAGAGAAAGATAGACA
CCTGCAGACTTCACCGCCTGTGAAGCGACTCCCCTGCAGGTGGGGAGTCGGGGGCTCAAC
CGGGATCCTTATGCTGATCCTTACCCTTTGCACCACGTGCGCTTAACCCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCTCTCTCCTCTGTCACTCCCTTCCC
TCTGGATTTCTGGCTGTTACTATACAATAAATAAAAATACCAAAACAAATAAAAACAGAG
ACACCACTCACAAAGTTTCCCCCCTATAGTTGGGGACCAGGGGCTTGAACCAGGGTCTTT
GCGTATGGTAACATGTGCTCTCAACCAGATGCACCACCACCTGGCCCTCTCTCTGAAAAA
AAATCCAGCCAAAGCGGCAAGACCTGACAAAAAGTGTTCCAACAGGGACTGGGGAGGATG
CTACAGTTCAGGGCCATCACGGAGCCACCTCCGCCTCCAGGCACAGTGGGAACTTGTCAG
CTTTTATTGATCAAAAACTAGCTTGAAGCCTCCTAGAAGACACAGCTTGCTCTGCAGTCT
GAGAATACCCTGGGGAGGTATATCCAGGGATTAGGAGTGCAGGTCCTCGCTGAGAGGCCC
TGAGAGGCCTGTGGAGCCTACATCCTGACTGCCTCCCAGTACGCGGGCATCTGCTGGGGC
TGGGGCGCCGCTGAGCCAGCAGCAACCTGGGTGTGAGTGGTGCTGCTCACAGTTCTATTT
TATATATATAATTACGACCAGCATTATTGCTGGGGCACGGTGTTGGCACTACAAACCTAC
TGTTCCTGGTGACTATTTTTCCCCCTATTTTTGACAGGACAGAGAAGAATTGAGAGGAAG
GGGAGTAGGCAGGGAGAAAGACAGACACCTGCAGACCTGCTTCACCGCTCATGAAGTGTC
CTCCCTGCAGGTGGGGAGTGAGGGCTTGAACCTGGGTCCTTGTGATGTGTGCGCTTGACC
GAGTGCACCCCCAAAGGTCCCCCACAACTCTAATTTGTTGTGCATGATAAGCCCCTTTCC
TGCCACAGGTAGGGGAGAGTCCATCTGGGCCTCTATTGAGCGTTTTTTTCCACACGGGCT
GAGGGAGGGAGTCTCCAGTGAAGCAACCCCCTTGCATGCGCTTCCATATCGTGACCGAAG
GCTCGAACCCAGGTTCCTCTACTGGCTGTGCTACCCCTCAGGTCCCTGTTTCTCTACATT
CTTAATGAAACATCTTGTAAAACGGTATTAAGCAGTTTCTTCTTCTAAATCAGGTAGGTA
TTGAGCTCTGGGAACTATGGATAACACAGCAGTTATGCAAAAAGATGCATGCTTGAAGCT
CCAAAGGCCCAGATTCAATCCCCTGCACTCCCACAAGCCAGAGTCAAGCAGTGCTCTGAT
CTTTTGTCTTTCTCAATCTCCCTCATTAAAAAAATAATACTGGGGGTTAAGCGCANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCAGCAAGACTGCAGCTCAGGTGGGAAATCTGTCTTGCATGCTCTCTCTCCAAGGCCTGG
GCCTGCACCCAGGTGCTAGGTTGCAGCCGTGTTCAGAGGCCACTCCCCCCCGACACTGAC
TCTCATCTTCCCGAGGTGCTAGTCGACGAGGCTTCCACTGGGCGGACAACACCTGTGTTT
CCAGGGAGTCCGAATAAGCCGAGCGCCGGGGAAGCAGGAGATGGCTGCCTGGGAGCCTGG
CTGTCTTGCTTGTGCTGCCCTGAGCAGTAACTCCAGCCCAGAGGGTCCTTACCAACCAGA
CTGAAGGAGTGGGGGCCAGGGGTGGACCACCTGGTTAAGCACAAGGACCTGGGTTCCAGC
CCCCCACCCCTTACCCTCGCACCCCACCTGCAGGGGTTCTGCCTCCTGAGCGGTGGGGCA
GGTCTGCAGGCGTCTCTCTCCATTTCCCACCCTCTCTCAACTTCTCTCTGGCCTAGCTAA
TAAAAATTAGGGGAGGGGCGGGGAGAAGAGAATGGCCTCGGAGAGCAATGGAGTGGAGGA
GTCGCAGTTCCAACACAGAGCCTCAGCTAGCAAGCCTGGTGGCAATAAAGAAACACACAG
CTATCAAAGACTGAAGGAGAAAGCGCCACACACAGCAGTGCCTGGTGGACATTCTGCCCC
AGGCCCTGCAAACATGTTCATCACTACTGGTGGAACTTTGAAATGCTGTCTCTTGGCTTT
CCTAGTGGCTTAAATTTAAAATGAGGAGAAGCTGGCAAAATAGTTGGGACTGGATAGTGG
GCTGCTTTGCCATGTGCCACCCAGGTTTGAGCCTGGCCCCCACCGCACTGAAGGAAAGAA
ACCCTTGTGCCATGATCTCTCACACACACTCTCTCGACCTGTGTTTATAGAAAAAAACAG
TATTTTTCCCCCCAAAATTGGGATGCATTTAGTGAAGTGTTTCTTGTTTAGTTCAAATCA
ATGCAGCCCAGTTCTCTCAACCTCTTGCCCTATTTTGAAGGGCTGTTACAACTTTGATTT
ACAGAAAGCTGCTCTGTCTTCTCTCATTTCCTAACCGACACCCTGAACCTCCGTGCCCTC
CACAGACACGCACTAAGCCCACAGGCCAGTCCCCGAGATGCCAGAGCAAAAGGAGAGGTC
CAAGGCTGCACAGGCCCGAGTGGAGCTTGGCCACAACGGGCACAGGGCTTATGCCGTGGG
AACTTTGTCTCAGCAGCAGCCTCCTGCTTAGCTCATCGCCCTGGCTCACCAGGCCTGGCC
AGCTCGCTCCCCTGTAGGTCACTGCCTGGGCCTGCGCTGGCCTCTCCTCCTCTGCAGCCT
GTGAGGGCAGAGGAGGGCTCTGAGGTGCCCCTGGCCCAGGGCCTGCTTCCCCTGCCGCTG
GCAGCTGCTGCCATCCCCTTGCCCAGGCCTGTTTCCACCTGGCCTCCTGCTCACCTGATT
TTCAGCAAAACCTCTGGGCGGCTCCCAGCTCCTCCAAACNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGTCACATTGAAGTTTATGCTGTC
ACATTGAAGTTTTGTTTATAAACAAAATGGCCTTTCAGAATCTTTTGTCTCAGGGACCTT
GAAAGAAGCTTTGGCGAGCTGTAGGTCCAGCCTCCAGGAAGTACATCACCTGGAAAAGGA
AAACTGAACCTCCCAGGATTTTAACAGTGTAACAGACAGAACACACCGTTTACTATAGTT
CTGTAGGCTTTTTATCCCCCTCTTTTCATAAACCAGCTGACCACTGCTCAGCTCTGGTTT
ATGGTGGTGCTGGGGATTAAACCTGGAGCTCAGGGCCTCAGGCCTGAAGGCCATTTGTGC
CACCAATATGCTATTCTCCCCAAAGCATTGTTTTTTAACATGCTAGTAACAAGCCCAGGG
TCTTGTTATACATGTAACTAAGTTGCTTCTCCAGACCGAATTTTATAAGCTTTTGGAGGA
GGAGGTGGGAGGGGAAGGATGTTAATATGCTGCCTCACTGTCTGTGGGGTTCCCTTGGTG
CTCTCTCTGGTGTCCTGTGGGGTGCTGGGGCTCCAACCTAGTATGTCCTGCATGGAAGGC
GTATTCCTTCACCGCTCTGCCGCCTCCTGGGCCCCTTGGAGCGCGCTCCTTATTATAAAG
TATTGTGGGTTTTTTAATTATCTTGCTTTCCCTTGTTCATTAGGACAAATTACTGGATTC
CAGCACAGTGACTCATTTATTCAAGATAACTGAAAGCATTGGATGTGTGATGACGGGAAT
GACAGGTAATCAATTTGATGCCTACTTAGATCTGTTATGATCATATTCGAGTATCGCTAG
TTTTAAGAACTTTAAGTGTTGGGTTTTTAAATAACTGGTGAGTAGGTAAAGCAGTTTTCC
AAGACTAGTGTCTCTGTCTTCAGAGTATGGTGAGCTTTTTTTGAAATGATATCAAATGGC
TATTTTATGTTGCTGTCAGGGAAATAGGGCTGAGACATCCTCAGATGAGTGTAATTAGCT
TACATACTACCACTCTATCTCAAACCTGGTAGCAGTGACACTGGTTTAGAAGTATGTAAG
AACCATAAAAAAATTTTTTTGGTTTCTATTTCCTAAAATTAGGAGAACATCAAGCCTAAA
AAAAAGTTTTCAAAATGTTTTCTTTAAAATGTATTCTTTGGGGGAGTTTTGTCAGCTGAT
GAAGGGTTCAGCTTAATAGGGCAGTCAGTACATGTATACAACCCCATCTTATCTTTCTGG
TCATTAACACAGTGGTTATCTGATATTATATACATACTGTGTGGTGTGTTTGTGTTGGGG
GGTTGGCTCTAAGGATCTTACTTTGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNACATGTGCTTTGGAAATACAGTAGCTCAAAGTGG
ACAGGGCAGGGTTTATGGTGGCATTATCTTTACACTTTAGGCGATACTGAACTTACTACA
CTGTTTCTATTTAGTGATTTGAACGAGCCAGCTCTGTTGTACTAGACCATTGTGAGATTC
TATGGGTAGGCACCATAATGACAGAACCTTTAAGATTTGTTTAACTTTATTATTTTTCTT
ATTTTGTCACCAAGATTCTTGCTGGGGCTCAGTGCCTGCATAATAACTCCACCAGTCCTT
GGTGACCTTTTTATTTTCCAAAAAAGGAAAGATACATACAGCACTACTCTAGCACTCGTG
AAGATTCTCCCCTGCAGGTGGGAGCCAGGGACTTGAACCCAGGGCCACACTCACTGGCCC
CAAGATTGATTTATTCATTTTATGAAAGAGACCAGAACACTGCTCCACTGGGACATATGC
TGTGCTAGGATGGAATCTTGGCAACAGTGTTGTTTTGTTGACTGCCCTAGGGGGAAAAAA
AATCAAGGTTATACACATGCCTGTGACTTCCCCCCACCAAGCCCTCCCTCCATGAGGAAG
CTGGGTGAGCAGTCTCTTTATCTTTTATTTATTTATTTATTCCCTTTTGTTGCCCTTGTT
TTATTGTTGATGTCGTTGTTGGATAGGACAGAGAGAAATGGAGAGAGATGGGGAAGACAG
AGAGGAGGAGAGAAAGATAGACATCTGCAGACCTGCTTCACCGCCTGTGAAGCGACTCCC
CTGCAGGTGGGGAGCCGGGGGCTCGAACCAGGATCCTTACTCCTGTCCTTGCGTTTGGCG
CCACCTGCGCTTAACCTGCTGCGCTACAGCCCGACTCCCGAGCAGTCTCTTTAGGTTCCA
GTTTTTATTAAGTGAGAGAGGTAGGGGAGAAAGAAGACACATGTCATTCCACCATCCAGT
GAGCTTCCTCCTAGGCCCTCTGTGTGGTAAAGTCTGTGTTCTCTTGGCCCTGAAAATTTC
AGTATCTTGTCTGTCTGCCATACATGATGAGATTTGAAGCAGTGTAATTTCTCTTTAACC
TGACTAGTTTCTCTCCCACTTGAAAATTACTTTTTCCCATGCTCCACCCCCTCCCCACCA
TTAGCCAGACCTGAGTAGTGCTCTGGTAAAAAATACCAAACAGCAGATGGGTCTGGGCAG
TGTGAGCATGCATGTTACAGTGGGCAAGGACCTAGATTCAAGCCCGAGGCCCCCATCTGC
AGGGGAGAAATTTCCTGAGTGGTAAAGCAGGGCTGCAGGTGTTTGTGTCTCTCCGTTTCA
GTCCAGAATACTTTTCCCTTTATTCCCTCCATCTAACTCTGTTCTGAGTTATCTTATTCA
TGCATTGGATAGAGTGAGACCCTGCAGGTGGGGACCAGGGGCTTGAACTCAGCCCCTTGG
GCACTGTAGCATGTGCACTCAGAGTTTTCTTGTCTCCCCCTCTTCTGTTGTTCCCTCAAA
TATTGTTGCTAACGAGGCTCTTATGTATTGATATTAGAGACAAATTGAGAACAAAATATT
TGCTGAGCTGTCCCCCTGCAGTGGGGGACTGGGTCCTTATGCATTGTAATGTGTGCGCTC
AAGCAGACGTGCCACTGCCCAGCCCCACATAAGGCTTTTCTATTGCTCTTTTGTTCTGTC
TGAATAACTTCACCCCCTTGGCTGACTACAAGTACTTTAAACTTAAAACTTAAAATCATT
GCTATTTTCTACTTAAAATTTTTTTGGTAGGACAAAGAAATAGGGGGATAGTGAGAGACA
CCTACAGCACTGCCAGTAAACTTCCCCCACAGGTGCCTTGGGCATTGGAACATGCATGCT
CCACCAAGTGCACCACCACTCAGCCCTATAAATACTGTTTAATGAGAGAGACAGCGTAAG
AACAGAGCAGTGCTGAGCTCTGGGTTGTGGTGTTAAGGATTGAACCTGGGAGCTCAGAGT
CTTAAGCATGAAAGTCTTTTGCATAACCATTAAGTTCTCTCCACAACACTCTGAAGTGTG
TTCTGTAGACTTAAGTTTTGGGGACTTGAATTGGTAGTTAGTTCTTACATTTAAAAAGTT
AAAAAGTATTCTTTGGTCAGATAAATTTTAAAAACTAGGGCTTATATTGATTAGCCTATT
GTAAATGAGCACATCCAGTCTGCTGGCTTATATTATTTTCTCTGAAAGTATGTGAGAATT
GTATTTCCCAAACTTATTTGACTAGGTTATATCTTGATGGGATTAGGCTTCAGAGGATCA
TGATGTGGGCATAGCAAGAATTAGAAAATTGTTTGACAATTACATTTATCTGTGGTGATA
ACCTGTTTTACTAGTTTTCATAAAACACATATCCTAAAATTGATGACAAGAGTAAGTAAT
GATCAGCAACGACATGGTGATACCAAGAAAGGAAACCTTTTGTATAGAGGTCTGCAGTAA
CTGTTCTTGCTTTTGAAGGTATGATTTTAATTGGTATTGATGAAGAACAAGGCCCTCAAG
TGTACAAGTGTGATCCTGCGGGCTACTACTGCGGGTTTAAAGCTACTGCAGCAGGAGTCA
AACAAACCGAGTCCACCAGCTTCCTTGAAAAAAAAGTGAAGAAGAAATTTGACTGGACAT
TTGAACAGACAGTGGAAGTAAGTTAGCCCCCAGACAGCTACCATTTTGTTTGTGCTATGT
GAATAGCAGTGGTGAGAATCTGCATAATTGACTGTAAAGGTTGCTCCCGGGTTATATAAC
AAGATAGAAGTACATCAACAAATTGGTTATTTTACTGTTTTTTTTCAGACTGCAATTACG
TGTCTGTCTACTGTGCTATCAATAGATTTCAAACCTTCAGAACTAGAAGTTGGAGTAGTT
ACCATTGATGATCCTAAATTCAGGTGAGTTAGATTTTGTTTACGGGGTCATGCTAAAATC
ATTCTAGCTCATAAAGATAAGGCCTAAGTGTCCACCTAAGTATAGTGTGTGTGTGTGTGT
ATAGACCTCAACTCTGACTTGGTGGTCCAAGAGTGAAACCTAGAATCTTTTCTCATGCAA
GTCCTGTGTCTTCCCTGGAGCAATAGCAGCTCCACCATGTGGAGTTTCCCCAGCTGCTGT
GATGCCCCAGATTAAAAAAAAATAAAACCTGCAATTATGAATTAAGCACCTGCTAGATCT
GTGTGAAGACTTACTGCACCTTTAAGACAGAATATCTAATACCAGAGGAGGTATATCAAC
AAAGCACATTTAGTTTAAGATCAAAAGAAAGCACCTAAATTAATAATTCAAGATTTCCAG
GTGGAACTTGGCCTATAAGTGGAGCTCTTAAGGGCAATAGGGAACACTGCACCCCAGACT
ATAATGCAGTTCGTTGAATTGCAACAGCTTGTGTGTTCTTACTCAGCGACACAGATTTGT
GTTAGTTCATTTAGTGCTTGTGGCTCTGGCTAGTCTAATACATAGTTAGCATCTAAGATT
CAGGAAGGCATCTTAACTCACCACCATAAGGACACATGGTTGGGCAGAAAGATGGGAGAC
CGAGCTTCAGATCCTGAAGTGTTTTGTTAGGATGCATCCTGTTTTACCTGCAGGAAAGTG
ATGTAAACAGAGATTGAACAGTTCTGAGGACTAATTCTACAGATGGCTGCATGGTCATGT
GTGCACAGTTTGCATCTGTGTCTGGTAGCAGTGTCTGTCTGTGTTTTGCATTCAGATTTT
GTTATCCACACAAAAGCCATGCAGCCAAAGAGTAATTTGAGGTCATAGTACTGGCTCTGT
GCTGTCCCTTTGGACACATTCACCACAGGCCAGCCTCCAAATCCCCACACATAGACCTTT
GGAAAATAAGATATTTATAGTGACAGGTGACTGGGTCTATAATGCAACTTAAAAAAAAAA
GATTTAAGGAGAAAGGTACGAGGAAAGAGCCAGACATCATTCTGGTACATGTGCTGCTGG
GGGTTGAGCTCTGGACTTCATGTTTGAGAGTCTAACGCTTTATCTATTGCACCCCTCCTT
TTTGAAAAAAATCCCAACTAGAAAAATTGACACATCTCTTCAAAGACATACACTTTGCCC
TTGTTGGATAGGACAGAGAGAAAGATGAGACACCTGCTTCACTGCTTGTGAAGCAACTCC
CCAGCAGGTGGGGACCCAGGGGCTCAAACCGGGTTCCTTGCGCCACCTGCTGCACTACCG
CCCGACTCCCATCCTTTAAATTTTTAACGTTTATCTGTTAAGAAATCGAAGATCTCTGAC
TTTATCGGTGTAAATCAAGTCTCAATTCTGTGATATACTTAAAAACCAGAAAATACTGCC
AAAGAGGCAATTCAATAGTGTGGCTTTAGCTTACCTACTGGATACAGAGGTGTTTTGACA
TAGATGCTAAAATAGATCAATATGTATGTATAACTAGTGGCGTTTTGTTCTGGTGTATAA
GAAATTTCCTTATTTGAGAACACAAGGCAGAGACACCACTCCTCCGTTTAGGGCATGGTC
TGTCTACCCGACCTCGTGTAATCTGGTACCAGGGCTCAAATCCAAGGGTTAGAGCACAGT
GAGGTTCAGTCTACTGTGTGAGCTGTGTCTTGGCCCCAGAAGTAAACATTTTTATGTACA
GATGTTTGGGTTACTTTTTTTCTTAAAAAACCAAGGGTAGCAGCCTGGGGGATGTTACAA
TAGGTGAAGTGTTTGGCTTTCAAGCACAAGGTTCCAAGTTCAGTCCTTGGCCTTGCATGT
GCCAGAGTGATGCTCTGGTTCTTTATAGCCCCCTCCCCTACCAATTAACATCTTAAAATT
GGTTGTGTTACTCTTGAATGTAAGGTGAAAGGTGCATGAGAATTTATTACTTTTCGTGTA
TTTGGTATTTTATGGAATACAGAGCTTTCAAGAAGTAATTTCCCTCTTTGTCATCTAGGA
TTCTTACGGAAGCCGAGATTGATGCTCACCTTGTCGCTCTAGCAGAGAGAGACTGAACAG
TGTGGTCTACCCACCTGTGCATTTGGTAACAACAGATCGACATTGTGGAGGCCCTTGAAA
AAAGAACTCTTCTGCCACAAGTGGTGATGACACTATATAAATAAAGAACAGTGCTTTTGG
AAAATAATTGCTTTTGTTTTCTACCTTCAATTTTAAGTATTAAGCCAAATTCCCTAGGAG
GCCTTAACTATATAGTAAAAGGAAGGCCAGCAGAATAGCTCACTTTGCCATGTGCTTGAC
CCCACTGCATTGAAGGAAGCTTCAGTGCTGTGGTGGTCTCTTAAACCCTACATTCAAGCA
AATAAAAAATATATAGTAAGATGAGTATTACTGGTCATAGTTCACGTATGATTTCTAATC
CAGTCGTTCAGAGTATGAAAGGCTTTTTGCAGAACCATTAGGCTATCTCCCCAATCTTAA
GGTAGGACAGAAAATAAACATATTTGAAGAAATTGGTGTATAGTGAATAGAGATACCAGC
CCAGTGTTAGTTGGAGTCAGTGAGTGAGGGTGCCGGTATCCCGCTGTCTGTCTCTAGCCT
TTAAAAAAGGGGGAAGGGTTTGAATGGTGGGATCATCGTGCAGGCACTGAGCCCCGGCAA
TAATTAGTGACAAAAAAAAAAGTTATTAATGAGAGAATCCAAACATTGTGCTGGAAACTG
ATTGCAGGGTTCCGTGGCTGCAGTGTCTCAACCACCAGACCCACAGTTGGGGAGACTATG
TGAGCCTGTGAGAGTAGAAGCAGAGGGACAGTCACTGGCCACATCCTGTTCAGAGTTGAG
TCATGAGTTGTAAGGTTTTCATAAAGGGAAGTGGATCCTTCCAGTTTATGGGCTATTGCC
CATCCAAATGCATTTTCTATAAAGGTGCCGCCGGCATTCTGAGTGGGGTCTGCGTACAAG
GCGACTCCATGGACAGACAACCGGATCTCTATGCCCTTGACCAGAGCACGTAAGTGCTTG
ACTGCTGAGCCACCTGCCTGCTAACTCACTTTTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 44239..44333, 45103..45184, 46119..46274, 49098..49276, 49428..49522, 51538..51595
1001..1076, 44239..44333, 45103..45184, 46119..46274, 49098..49276, 49428..49522, 51538..51592
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved