Erinaceus_europaeus Locus BCL6
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus BCL6
Erinaceus_europaeus
BCL6
GeneScaffold_8504
SNORA3
27141..27267
32388
TTCTTGTGGTAAAACCACACTAGCTGGTAGGCTGCGGCTTTCCAAGTCAAACTATACAC
ATGCATCCTGAAGTAAGATTATTATGAATGATTTTACATTCATTTAATCAATTTCTCTTT
GCTTTCTTTTCTTCCCTGCAGATTTTAAGCAAAATTTTGGACTGTGAATCTAGGCGTTGG
GTAAGTGAAATTATATGCCTTTAAATTTTGTGGGCAGGCCTTTTATTTTCCCTTTTGAAT
TTGTCAGTGCCTGTGTGCCTGTGAAGTCACCCAATTTTCACTAAATGAGAGGAAAGGTAA
CCAATTCCCAGGCCTCACTCTTTCACCTCTGCATCAAACTAACAACACTCTTACGGGGAT
CATTCATTTCTCATTCATTGCTTAGTTCAAGTTAATTTAGCCACCACAATACACTAGTCA
TGTGCCAGGTACTAAGTGTTCAAATAACGTTGAAGTCTAGCAATAATAGCATGTGATACT
AACACGAATCTCTGTAGTTTTTGAGAATCCACAACAGCCCAGGTGTTTTATCTCTAATTT
TCACAACCACATAACTAATTCCACTCCCATTGTGGAAAGCCAAAGCCCAGAAGTAGCAAA
CAAAGTCAAGTCACACAGCTAGCAAAAAATAATGCTAGCCAGCTCACCTCCAAAGCATGG
TTTCTTTCCCCTGTGACTCACTCACTGCCTCTCCAAGTTGGCAACTCTCCAAGTTGGTAT
TTGCTGTGTAGGAAAACTACTTAACAAATATTCATCCCTTCTCTCTTTCCCCTAAAAGGC
TTTATATTCCAACTTTGATAGATTCAAAAAATAATGCTCAGAGAGGGAGACTGTGAATTT
TTTTAGAGACTAAATGTGAGGGAACTCAGTTTGCATTCCATGCCTGAGCAGGCCGAGCCA
CCTGTTCTCACACTCCTATTAAGCAGGAATCAGGCTCAAGAAGACTAATGGGATTCTTTT
GGACTTTTTTTTTTTTTTTTTTTTTGCCAGGTCGAGACAAAATGGCCTCGCCGGCTGACA
GCTGTATCCAGTTCACCCGCCACGCCAGTGATGTTCTTCTCAACCTTAATCGCCTCCGGA
GCCGGGACATCTTGACTGATGTTGTGATCGTGGTGAGCCGTGAGCAGTTTAGAGCCCATA
AGACAGTCCTCATGGCCTGCAGGTGAGGGGTTGAGAAGGGAAAGATAGATGAATAATAAA
TGGGAAGATTGGTAGGGTATAAGCCTTTTTCTGTATCTGGGATCACTGCTTACTCCTTTG
TATCTAGGTAACAGAGTAGGTTCCCAGGAAGTGAATAAATGAAAACTTTATTTATTTGTT
TATGTATTTATTAAAGAGTTTCTATTCTGTGGAGATAAGAGAAGAAATCATATATGATCT
GACAAAAAAAAGGATTTATATTTTTGGGAGAATATGGAGAATAATTTTAGCTAGTCAACG
GAAAAATTAAAAGAGCTAAACTACTTTATGCAAGTTCATGTGAAATAGTTACGTGAGTGA
GAGTGAACAAGCTGACTCTTCATATTTGCCAAGTGTTTTGAAGGTTCAGAGCAATTTTGT
ATTGTTCCAACTCTGGATCTTCATAGCTGTTCTCTCTGTTATGGCTGGCATGGTGACCTT
TGTTTTGTGGGCAATCAAACAAAGATATAGGCAGGAGAAATTATATAAAGTCAGGGGCCT
CTACTGTGTATAGAAAAAAAGTATTCAACATATATAGTGAGCACCTTTTTAAAACGTGGC
AAGAACTGAGATTCATGGCGATATGAGAGTAGTGGAGAATGTTCAGGGGATGCTTGCTGT
GTGACAAGCATCATTCCTTTCCTTGAATTTTTTAGCTTTGATCCTTTATAAAATTTTATT
TATTTGTTTGTTTATTTATTTATTGACTGGGTAGAAACAGAGAGAAATCAAGAGGGGGGA
GATAGAAAGGGAGAAAGAAAGATACCTGCAGCATTGCTTCACTGCTCATGAAGCTTCCCC
GACTGCAGATGGGGGCCAAGAGATTGAACCTGGGTCCTTGTGCATGGTAAGTTGTGTGCT
CACCCAGGCATCATTCTGTACCCTTTACATTCCTGTTCTTGCCTCATTCTGAAGAAGCAG
ATACTATTGTTCCTGCACAGCTCCTTCTTGGTTGAAATCCAGCTCGTTTCCCAACCCACT
TAGAAAGAGTGGAGTCAAGATGATAACCTCAAACTTTGGTTTTTGAACTGAGTACATTTT
ACTTGACTAGATCATCTCATATTTAGAGTTAAGCCCTGAGATTTGACTTATACCTTTTAG
AAGTATTGACCTTGCCATAGTCTGTGGACTTTTAGAAGATCAGTAGGCTGTAGACGTTGG
CATAAATTCATTTATTTATTTGTCACCAATTCCCAACTTCTAAAAATAGAGTAGGATCTT
AAAAATAAACATAATTTGATGGCACCCGAAAAGCAATACTTACCCTAAAGCTACAAACTA
AAAATAGTTACTGCAAATGAGAGCTAAATTTAACTCTAGTAACCCAAGTAGTGAAGAATA
AATCAAGAAGAAGGTTCTGTGATTTTTGAGGACTTGACTTCCCTGATCTTAGATCCATTG
TTTGGAAAGGGGGCTAGGTGATGGCATTTACCTGGAAAGCCTGTGAAGAACACAGGATAA
TAAATGTCAGGTGCTTATGATTTCTGGCATCTCGTAAGCTGTTCCTAACTGCCCTAGATA
TTGTGAAGTTAAATCTGAGGGACAGGAAGATACTGACTTTGATACTGACTAGAACTGACC
GTGATTCTGTGTGCCTGCTATAGTAAGGTCTGTGCTTGTTTTTGTAGTGGTCTCTTCTAT
AGCATCTTCACCGACCAATTGAAATGCAACCTCAACGTCATCAACCTGGATCCTGAGATC
AACCCTGAGGGCTTCTGCATTCTCCTAGACTTTATGTATACATCTCGGCTCAATCTGCGC
GAGGGCAACATCATGGCCGTGATGGCCACAGCTATGTACCTGCAGATGGAGCATGTCGTG
GACACTTGCCGCAAGTTTATCAAGGCCAGGTGAGGTGCCGCCACCTGGATGAAAGCCTGG
GAGACCAGAGGGAACAAAAAATCCTGGCTGGTGCAGGCGGCAGGGGAAGAGACATTCCCT
TGTGCTGTACCACAAGTACTTCCACATGTTCTGCATGCTTCTGACTCCGTGCTGTCATGC
ACCATGTCTCGTGCACTCCTCCCCGCCCCCTTCCACCCCCGCCTCCCTCCACTGCCCATA
TCCTTTCTTCTTACCCTTCTGGCAAGGTCCAGCTTGGATGCAAGCTCCTTCACTGACGTT
TCCATGCCACCACTTGTCCTCCCTCAGCATTTCCTCTGTTCCACAGCTGTGTGCCTGTCT
CCAGTGCCACCTTTCCCTTTTAATGATTTGCATATACATTTTAGTTCTCCTTCGGGGTCC
TTTTCCTGACTATTTATACTTATGTGTGTATATATATGCATATATATATATATATATATA
TATGCCTTAGTTCCCCTGCCAGACTGTGGCCTGCTTCACTCATCTTTTATGTTACTTTGA
TTCTATTAGAGAGGACTTTGTTGAATTAAATTAAGTCTGTTGGGTCTAACCTCCTACCCA
AGTGCTCATAAGACACACCATACGTCATGTGTGGGTGATGGACCAGAGACAAAGAAGTGA
AAGCTTCTCTATGGAAAACAGACTCTAGGGCTTAGCCTTCCCCTCCTCCTGCTCCTCCTC
TCTCCTCTTCTTCCTCTTCCTCTTCTTTATTCATGCTCTATTTTTTTTTTTAGCATCTTA
TTTATTTGGTTAAAGACAAATCAAGAGGGAAGAGTGCGGTAAGGAGAGGGAGAGAAGTAT
ATCTGCAGTGCTGCTTCACCTTGTTAAACTGTCCCCCTTGTAGGTGGTGACTGAGGGCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAG
ATAGAGAAAGATAGACACCTGCAGACCTGCTTCACTTGCTCGTGAAACAGACCTCCTGCG
GGTGAGGAAGTGGGGGCTCGAACTTGCACTTTGGTAATGTGTGTGTTAAACCAGGTGTAC
TCCTCGTGCCCCCCCCCCCCCCAGCTGATTTCTTTAGAGCCATTTGATTCATTTGCTCTA
GGGGGTTTACATTCTTTCTGAAACGGAGGGACTTGCACCATGGAACACCTCTAAGAGCCA
GGAACTAAGAGTTCCCAGAGCGACACTATCTATTTTGGAGAGTTAAAATGCCCCTCTTTC
TGACGAGTTGAAATCTGGCTCCCTTAACCTTTGCTCATTGGCTCTAGCTCTGTTAACTGT
GAGTGTGTTCAGCTGGCCTATTTTTCTCGCCCACATAATGTCCCTTCAAGTACATGCATC
TGGAGCTCTTTGCCTCCGGTGGGTGGTAATGGTGGTGGGATCATCACTGCCGTCATTTAC
AGGTACTTTGTGTGGGTCAGGCCTTGTGCTCGGAGCAGTAAAATAACTTGCTTCAGATTA
CTTAGCTGAGAAGTGGCACAGCTGGGGTTAGAAGTTTGCTCTGCCTGCTATATTGCTGGA
GCTGCTTTTTCCAGCAGCCCTGCTTGTTCTCCAAGGTGAATTTCCTCATGACTTCACTTG
GCATGTGGGATAAGTCTTCCCCTCAACAGACTTCCAGTCTGTCTGAGACCTTCCAAAGGT
GAGACCCACAAGCCCTCTGTCATCCCTATGCCTCTATTTGTTCATGCATCAAATGGAGAT
GTGCAGATTCACATACACACATATGATATGTGTGACTTAAGCATGCAAGACCTTGTCAAG
AGGGTCACAGAGTATGTGACTAGTTCACCTCTCCCTTCTGGGCCTAGATTGTGCAGCCGT
TGGCTAGAAATCTAGACTTGCAGCATTTCTGCCTGAAACTGTGAGTCCTTCCCTACTTCA
GAGCCTCTGCCCCTCTGTCTAGCAGAACCAGACACAAATATGGCTGCAGACAGCTAGGTA
AATAATCACACAAACAGGAAGTAGATTATAAAGAGACATTTACTAACAATACATTGTGCA
CATGGGAGATTCCTATGGATTCTGAGAAACTCACAGGCACTGAGGTCATTCTATTGCAGG
GGCTTTGGGGAGGAAGAAGAAAGGAGGGGTCAGTTAAAGTGCTGTGTGTTCTGCTCTCTC
AAGGAAGAAAGTAAGGCAGCTCCAATGTGGCTGCATAGACCCGTATCCCGGGGAAGATCA
TCTGTTACACAGTTCTGGTTCAGAGGTTGATGTTTCCTCTTCTCTCTTTGCTCTTGCAGT
GAAGCAGAGATGGTTCCTGCCATCAAACCTCCTCGTGAGGACTTTCTAAACAGCCGGATG
CTGATGCCCCAGGAAATCATGGCCTACCGGGGTCGGGAGATGGTGGAGAACAACTTGCCA
CCGAGAAACGCCCCTGGGTGTGAAAACAGAGCTTTTGCCCCGAGTCTGTACAGTGGCCTG
TCCACACCGCCAGCCTCTTACCCTGTCTACAGCCACCTGCCCGTCAGCAGCTTCCTCTTC
TCAGACGAGGAGCTGCAGCTGCGGGATGCCCGCATGCCCATGGCTAACCCCTTCCCCAAG
GAGCGCTCCCTCCCCTGCGACAGTGTCAGGCCGGTTCCCAGTGAGTACAACAGGCCGGCC
ATGGAGATTTCCCCCAGCATGTGCCACAGTAACATCTACTCCCCCAAGGAGGTGAGCCCG
GAGGAGGCACGGAGTGATATGCACTACAGCATGGCTGAGGGCCCCAAGCCCGCTGCCCCT
TCGGCCCGGAACATCCCATATTTCCCCTGCGACAAGACTGGCAAGGAGGAAGAGAGACCC
TCCTCAGAGGATGAGATTGCCCTGCATTTTGAGCCCCACAATGCACCCCTAAACCGGAAA
GGTCTGGTGAGTCCCCAGAGCCCTCAGAAGTCTGACTGCCAGCCCAATTCACCTACAGAA
TCCTGCAGCAGCAAGAACGCCTGCATCCTGCAGACCTCTGGCTCCCCGCCTGCCAAGAGC
CCCACTGACCCCAAAGCCTGCAACTGGAAGAAGTACAAGTTCATTGTGCTCAACAGCCTC
AATCAGAATGCCAAACCCGAGGGGCCTGAGCAGGCTGAGCTGGGCCGCCTTTCCCCTCGA
ACCTACACAGCCCCCCAGGTCTGTCAGCCACCCATGGAGCCCGAGAGCCTTGATCTCCAG
TCGCCAACCAAGCTTAGCACCAGCGGGGAGGACTCCACCATCCCACAAGCCAGTCGGCTC
AACACCAATCGTTAACAGGTGATTTGGGAGGTAGTCTGGGGTCAAGGATNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTCAGTTGTCCCACTCCTGA
CCTGTTAGGACACTAAGCTGACCAGAGCATGGAATAGGGAGTCAGAGTTAATCCGGAGGA
GCTGGAAATGACCAGACAGCCTTTTAGCTTCATTACCAGCCAAAGGTAATTTGTGAGGCT
GGCTAGAACTTCCAGAACTTTCTTAGTCCTCTGGACTTGAGCTGCTAGTGAAGGTCTGCT
AATGTGTCCACTGGGGTATAGATTCTACAAAAACAAGTCTCTGACTTTGTTCATACCTTG
AGTTTGTGATAGGTCCTGCTGAGTCTCTAACATGGAATGGGCATTCAGTTAATATCAGTT
TCTAGATGCTGTGTGATTGGCATCTGCAGTTTTCACCATTAAAAAAATGCCTTTTTTCCC
CCCCAGTTCTAGCTGTGGAGATACAGTGCTGTAATTTCAAATCAGGATTAAACCACCATG
ATTTAGTGCTTTCAGATGTTCCTAACCAAAGGAAAAGAAACCAGTTGCTCACACAGAGAG
GTTTAGCTTTGGACCTATAGTTGGGAGAGCAGGGACTGTCCCCTTGGCCATTTGCTGCAT
TCCAGTTCCTTCTCTCTGGACCTCTGTTTCCATTTCTATTGTCATCTGTGATCTTCCAAT
CTCACAGCAGTGTATGGGAGACAAGCTATCCAGATAGGTGCCATGTTCATCATCAATTCC
TCCTTCAGTGACATCAAAGTATCCTTGAATTTGATTTCTATCTCACATTCCAATAATGCT
TTGTGTTATACATACGCTCCAGTGAAGTTGACAGGACAGGGATTTATTATCCTGATTTTG
GAGACAGAGGCATAGAGAGAGAGGTCCTGCCAGATGAAGGGGCTTGCCCAAGGGCTTCTC
CTGCACATCAGTGTAAACAAAACTATAAGCTGATAAGAAAAGTCAACTCCCTCAGAGCTC
TTGAGAGAAGAAGCATGCAGAACGTCCCTCAAGCTGATGCAGGCTGTATGGGTAGCTGTT
AGTTTGGGTTTCTTTTCTGTACTTTAATATTCAAACCCATCCCCTTTCTCCTCCTTGAGT
TTCTAAATCCTAAGAAAATAAATAATACCATCTGCCCTTTGCTCTGAACTCCAGTGACTA
TTGGCTGGACGGGGTGTTGGGGTTCAGGTTAGCACCGGGTAGTAGTGACAGAGGAGACAG
GTCTTGGAGACCGGCCTCCTTTCCTCGTGCTGACATCAATGTCCCCCTCCCTCCTGCCCC
CTGACAGAGAATGGGGCCTTCTTCTGCAATGAGTGTGACTGCCGCTTCTCTGAGGAGGCC
TCACTTAAGAGGCACACGCTGCAGACCCACAGTGACAAACCCTACAAGTGTGACCGCTGC
CAGGCGTCCTTCCGCTACAAGGGCAACCTCGCCAGCCACAAGACTGTGCACACGGGTATG
GCCTTGCCCCACCCCGCCTGAGCTCCCCTGGGTTCCTGAGGACAGGAAGGGGGAGGGGAT
GCTAGAGAAAACAGTGCTGTCCTGTGGGGTGAGACACCATGATCCTGTCCTCTTTGCTTA
GCCAGTGGCCACTCCCTGTCTTCTTGGTCTGTCCTCTCAGATGCTCTCATCTGCTTCTTT
ATCTTGCTGGGGTTGGTAGGATTAGTCCCCCTGAGCAGGGGAAGGAAGCTAAGGCCAGTA
GAGGTGAAACAGATTGGGTTTTTATATAGCCTTAACTAAGTTAAAGACCTCTTGATTTCC
CCTAACTCACAACCCTTTACCATGTAACTTGTGATGATCTGGTCCGAAGTTGACTTTCTC
AGTAGTGTGATAGGTCCATTACCCCAGAAGCTTTCCATGAAGGCAGGCTTAGCCCTATTG
GTTTCCTTGGCCTGTGCGTCTGCTCAAAGCCTGGCCCCGCTCCTTTTGCAAATGGAATCC
GACCCAAGTTGGCCCAAGAAGAAAATCGTATTTGCTCTAAAGGAGAGAAATAGAGCAATC
TGGCTGTTTCTCTCTGGTGTATGTTGCCTTTTAGACACACAATGAACCAGACAAACCCAA
GGCCATTTGCTTTTCAGGTGCCAGAGAGGGAAACTGAGAAGATTGAGTGTGACCTCTCTT
AAATCCATCAGTTAGATATTCCTAATGACAATACTGGTTCCGAGATTCCCTGGAGTCTCC
CTCCCTTTTGTCTTAGTGTTGTCCCAGGTCTCTCTGCCACCACTGGCAGGGCATACTCCT
GCGTGAGACAGAGAGAGAGGTGGCAGGCCAACAGGCAGGAGCCTGGCTTCTCTCTCTCTC
TCTCTCTCTCATGTCTTTTGAGGGAAAGAAAAACTCATGCTGCCCCCCCCCCTTAGAAAG
GGCAGTTTTCTTTGAAACCCAGGACCCAGAGACTCCTCTGTTGAATGTGGCATCTTTTCC
TTGGTACTAGGTGAGAAGCCCTACCGCTGTAACATCTGTGGGGCCCAGTTCAACCGGCCA
GCCAACCTGAAGACCCACACTCGCATCCACTCTGGAGAGAAGCCCTACAAGTGTGAAACC
TGTGGAGCCAGATTTGTGCAGGTGAGCTGGGGTGAGGGGGAGAGGACCCCTGGACCTGTG
CATGTCCATGAGGGGTGCTAGGTAGTCCGTAGCCCACCCTGCAGTGCCTCTCATGCTTTG
CTTCTCCCTCAGGTGGCCCACCTTCGTGCCCATGTGCTCATCCACACTGGTGAGAAGCCC
TACCCCTGTGAAATCTGTGGCACCCGGTTCCGGCACCTCCAGACTCTGAAGAGCCACCTT
CGGATCCACACGGGAGAGAAACCTTACCATGTATGTGAGCTTCTTATGGCCATGGGCTGG
CCTACGAGGGGAAAGGAGGTGGAAATGTGGAATAACCAGTATTATTCCTTCCAATCTCCA
GCAGCTAGTAGGATAGCCACTAACTATAGGTCAAAGACCCGGATTTTGCCCTGATTATCA
AAAGAAGCCTGCCTGAACTTGGCCTGGGCTTCATTTGTGCTCATCTTTAAAATGGGTATT
TTCTGTTTTCTGTTCTCCCATGGTTGTCCTAGGCCATTAAAGGAATATCAACAGAAGATG
TGGCTCTTAAGAAAGAGGCCTGGCCTATGGACTTATAGATTTGGGGGTTATTCATTCACT
CCTACAAATACCTTTTCTAGTGCTCCCCTGCATTAGGCTAGTTATCTACTTGACCAGAGT
CAAAGTGTTTAAGAAAAGCAGTCATGGGAGAAGGAGGAAGAAGAGAGACTGAAGATTGTG
GTGATTAAGAAAATGCAGAGAGACGAGGCTAGAGTCTCGCCTGGGCATGGCGTTGCCCCG
GCGTGCTGGAGTCCTCGGAGAGCAGCCGCTGGCCTTATTCGCTGGCTATGGCTCTGTGGC
CGAGCCGGTCTCCAGGCCAGGGACAGGCGGGCGGGCAAAAAAAAGGAAAATGCAGAGAAA
GGACCATATCCAGAGGGATTAGGGCTCAGCTGGGGGCCCGATGCTACAGACACTAGCAGT
TGTGTTCTAGAACAGGTCTTGGCAAACAGTTTGGGGAGTAAATCAGGAACATTCTGTTAG
CTCAAAATGGGTTTTAAGTGTTTTACCTGCTTAAAAAAGCTATCAAAAATATTTTGTGAG
CTGTGCACATTATATAAAAGTCTGGAAAATGTTGATGCCAATCCACAAAGTTTTTTTTTA
AATTTTTTAAAAATTAATTTTATTTTTGAGAGAGATGCAGAGAGAGAGAGAGACACACAC
ACACACAAAGAGAAACACCAGAGCACTGCTCAGCTCTGGCTTATGGTGGTGCAGGGGATT
GAACCTGGGATTTAGGAGCCTCATGCATGAGAGTCTGTTTGCATAACCATTATGCTGTCT
CCCCAGCCCCATCCACAAAGTTTTATCAGGAGACAGTCACACTGCTCTGTGCACACACTG
TCCTTGATGGCTTTCCCATGCCAGTGGCAAAGTGAAGTCATTATGCTGAGAGTGTATGGC
CCACCCACAAGGTCCAGAATATTCACTCTCTGACTTTTTGCAGAAATACTCTGCTGATCT
CTGTTAGAGAGGGCAAAGGTTTTGGTCAGGCAGTCAGGCTCTCTGGGTCCTTATTCTGAC
TCTGATATGCATCCTTTCTAATGCCTGGGTCAAGTTCTGATCCTGTCACTGGGCCGCAGT
TTTCTTTCTTCTTAAAATGTTGACCATGATTAGTTTTCAGACTCTGCTTCTTCTGTCTTA
AAGATTCTGCATCCCCATAGGTAGGGTTAGGCCAGGGCTGTGGCCTCTTGGACCATTTGA
ATCTTCATTTAATTTGATTTAAGAGTTCCATGACTTCTATGCATGGGAATAGTTGTTATT
GAGGAAGCTGATTTTGATGAATTTATGGCTTCACTATCCGCCATGGGGACACAGAGTTTA
ATCAATGAGTGATTTGCCCACAGCACAGATGGGCAACTTGCAAAATATGCTTGTTCTCAT
TCACTGATTTATCAGTTCTGGATTGATAGTGGTTTCCTGTTTTATTTAATTTTTAATTTT
TTATTATCTTTCTTTATTTATTGGATAGAGACAGTCATAAATCGAGAGGAAGAGGGAGAC
AGAGAGGGAAAGAGACAGAGAGACACCTGCAACCCTGCTTCACCACTTGCAAAGCTTTCC
CTCTGCAGGTGGGGACCAGGGGCTCGAACCTGGGTCCTTGCGCATTGCAACATGTGCGCG
CAATCAGGTACACCACCACCCGGCCCCTAAATTTACTGTTTTATTTAATTTTTAATTTTT
TATTATCTTTATTTATGAGAGTGGTTTCCTACTTGCACTTTGTTCTTGGGAAAATGAGTT
ATTTTCATAGTACCTTCCTTACTCATCTACTAAGCAGACCTGTTAATAGAAAATGCCTTG
TGGGTCTGTTAAATTAAGTAGCCAGATCCACTGAAGTCTTCAGAATCCTCCTTGGCATGG
AGTAAGAGTACAACAAATATTTGCTATTATTGTTTGCTAGACGTTGAGATGAGCAGAGTA
TCAGAGTTGAGTGACCATCAATAGAAGGGGAAGCCAAGGCCCAGAGAGAAAGAAATATAG
TGTCTAGAACACACAGTATTGGTTAGTAGAAACAAAATAATGAGCTCTACCTCTCCCAAG
ACTAGGTCTCGTTCTGTTTGCTGTCTTATGCATTTTCATTTATTATTTAACTTTTCTACA
TTTATTTCTAGTTATTCTTTTTTTTTTTTTTTTTGCCTCCATGGTTATTGCTGGGGCTTG
GTGCCTGCACTACAAATCCACTGCTCCTGGAGGCAATTTTTTCCCATTTTGTTGCCATTG
TTGTTGTCGTTATTGTCACTGACGTTGTTGTTGTTGTTGTTGGATAGGACAGAGAGAAAT
CGACCTGCTTGAGGACCCAGGTTCAAGCCCCTGGTCCCTACCTGCAGGGGGAAAACTCTG
TAAATGGTGAAGCAAGGTTGAAGGTGTCTTTCTGCCTCTCTCTCTCTTTTTTACTTTCTT
TTTTAAAAATATTTATTTATTTATTTATTTTCCCCTTTGTTGCCCTTGCTGTTTTATTGT
TGTAGTTGTTGTTGGTGTCGTCATTGTTGGATAGGACAAAGAGAAATGGAGAGAGGAGGG
GAAAACAGAGGGGGAGAGAAAGAGAGACACCTGCAGACCTGCTTCACCGCCTGTGAAGCG
ACTCCCCTGCAGGTGGGGAGCTGGGATGTAGAACCGGGATCCTTGTGCTTTGCTTCATGT
GCGCTTAACCTGCTGCACTACCAGCTGACCCCTGTCTCTGTCTCTCTCTATCTCTCCCTT
CCCTCTCAATTTCTGGCTGTCTCTACCCAATAAATAAATAAAGATGATACTTAAAAAAAA
AAAGAATGGTTTTAGTTTTAAGGAAAAGTTGTAAAGATAGGTACAGAGCATTCTCACACA
TGCCTGTTATCCCTAATGTTAGCCTTTTACATTAGTATGAGGCTTTTGTCACAAATTTAT
ATTTCTTTGAATTTTTTTATTGCCTCCAGGGTTATTGCTGCTGCTTGGTGTCAGCTGTGT
GAATTCAGTACTCCTAGTGGCCATATTTTCTGTTTTATTCAATAGGGCAGAGAGAAATTG
AGAGAGGAGGTAGAGAGGTAGAGAGATAGAGATAGCGAGATAGAGAGAGAGATGCAGACC
TGCTTTGCTGCTTATGAAGTGTACCCCCTGCAGGAAGGGAGCCTGGGGATCAAACCCAGA
GCAGTGTCTTTGTGCTTTGTACTATGTGTGCTTAACTGGGTGTGCCATTGCCTGACCTCC
CTTTCTTTGAATTTTTTTTTTCTCATTACCTAAACTGTCCTTTTTTGGTTCATCCTGGTT
ATCCCATTATATTTAGTCATCTATATTATTTTCCAGTAACCTTTTCATTAAAGCCATTAT
CATCTACCCACTGAATTATAGCAAGAAACAGCTTCATTTGCTAATGCCTTCTTAGCTTAA
CTAAGGAATTTATACTCACAAGGGTATGCAATTATTTCAACTGAAAGAGACAGTCAGGCC
ACTACAGCACTATTTCTGTCATTCCTTGGGTCACACCCAGGGCTTTGCACATGCCAGGTG
TGTATTATGTGCCTGGACCGACCTCCTCAGCCCAAACACTGCATTTGGAAAGTGTATTCT
AAATTCCAGACTTTTCATGAATCCTGACTGGTCTAGTTCATGTGTCCAAACATGTTCAGG
CTTATTGCATAATTAATTTATTGCATAATATGCCTAAGAGGTATATTCTGCTAGCTACTC
AGAAGATTATCCAGTTTAGAAAGAGGAGGTTGTTGCCTTCAAAGCATTCCGGAACTGATA
AGGATGCCAACGCTTAGGGTGACTGAGCAGCAAGGTGAACCATCTTCAAGAGGTTCAAAC
GAAAGTTTATTTTCATCCCAGAGAAATCTAGAAAGGCCTCAGTAATAAGGGGATTGCAGT
TTGAGAGAATATTTGCACTTGTACAGCTGTGGCAGGAGAGGGTGTTTTTTCTTTTCTTTT
CTTTTTTTTAAATTATCTTTATTTATTATTGGAAATCAAGAGGGGAGAGGGAGAGAAACA
GAGAGACACCTGCAGTTCTGCTTCACCACTCGTGAAGCTTCCCTCTACAGGTGGGGACTG
GAGGCTCAAACCCAGGTCATTGTGCTCTCAGCCAGGTGCGTCACCGTCCAACCTCGAGAG
GGTGTTTCAAGCTGGTGAAACACATGAGCAATGCTTTGGAAAACAGAGAAGGGATATTAA
GTCCCTTAGCAGAAACCAGCGTTTGTGTGTCTCCTCTTAAAGTTTTTTAAGAGAGAAGAA
CTACATATCTCTTGCCAGGAGAGTCTTCTGCTATGGGTCTTGGAGCAAAGACGCGCCTCC
TGGGGTAGATGATGGCTAACCATGTATCTCTGTTTTTTCTTTCAGTGCGAGAAGTGTAAC
CTGCATTTCCGTCACAAGAGCCAGCTGCGTCTGCACTTGCGCCAGAAGCATGGCGCCATC
ACCAACACCAAGGTGCAGTACCGTGTGTCGGCCACCGACCTGCCCCCGGAACTCCCCAAA
GCTTGCTGAAGCATGGAGTGTTGATGCCTTCCATCCCAGCCCCTAATGAGAATCAACCCA
AAGGATACTGTAACACTTTACGATGTCCATCCCATGATGTAGTGCCTCTTTCATCCACTA
GTGCAAATCATAGCTGGGGAGGAGGGTGGGGAGGGCGGGGGGTAGATGGGAATGGGGAAC
CAAGGCGGCTCCCCTTCCCCCATGGCCATAAAACATTAAGAAAAAAAATAATATTGCTTC
TTCTCCTATGTGTAAGGCAAACCATGTCAGAAAAAAAAAAAGTAAAATTGTTTTCTATAT
TGAACTGGGGGAATACTCGAAAGTTCTGACTTGACTTAGTCTGCAAAATGAGGAATGTAT
ATGTTTTGTGGGAACAGATGTTTCTTTTGTATTGTAAATGTGCATTCTTTAAAAAAAAAA
AGAAGAGACTTCAGTATGTTATCAAAGAGAGGGCTTTAATTTTTTAACCAAAGGTGAAGG
ATATATGGCAAAGTTGTAAATATATAAATATATATATATATATATAAAATAAATATATAT
AAACCTAAAAAAGATATATTAAAATATAAAATTGCATTAAAGGCTCGATTTTGTATCTGC
AGGCAGACACGGATCTGAGAATCTTTATTGAGAAAGAGCACTTAAGAGAATATTTTAAGT
ATTGCATCTGTATAAGTAAGAAAATATTTTGTCTAAAATGCCTCAGTGTATTTGTATTTT
TTTGCAAGTGAAGGTTTACAATTTACAAAGTGTGTATTAAAAACTAAACTAAACAAAAAA
AGAACAAAAAAAGCAGCTGAAGGAAAAATGTGTAGTTTTGTTCCAGTTTTTTGGTTTGTA
TATACCTGTACAACGTGTCCTACGGTGCCTTTTTTCTTGAAAGTTTTCAATGACGGGCAA
GCGTGCCATCCCTTTTTGAAGTGTAGGCAGACACAGGGACTTGAAGTTGTCACTCACTAA
GCTCTCTTTGGGAATGTTTGTCTCATCACATCCTGCGTCATGCTTGTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1161, 2807..3028, 5459..6425, 6427..6437, 23633..23817, 25147..25314, 26290..26420, 26532..26669, 31245..31388
1001..1161, 2807..3028, 5459..6425, 6427..6437, 23633..23817, 25147..25314, 26290..26420, 26532..26669, 31245..31385
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved