Erinaceus_europaeus Locus RBM13
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus RBM13
Erinaceus_europaeus
RBM13
GeneScaffold_8453
SNORA66
10603..10735
13882
ATATACTTTGGGTTCAATTTTGAGCACTGACACCAACAAAAATTTAACAAGGTGGTTAT
GCAAAAAGATTCTCATACCTGAGGCTTCAAAGTTCCAAATACAATTTCTCGCACCACCAG
AGCTGAGCAGTGCTCTAGGAAAAAGAAAAAAGAAAAAGAAAAAGGAAGAAACGTAAACTA
ATTGATACTTAGTGAAGGCACTCAGCCCCAGCAATAGTCCTGGTAGCAGCTTAAAAAAGT
GCTTCTACCAGGCCCTCTTACTCTTCGTACTAAAATGTCCTTTCTTTGTATAAAAAAAAT
AATCACTGAGTGGTCTGGGAGGTGGCACAGTGGATAAAGCATCAGACTCTCAAGCATGAG
GTCCTGAGTTCAATTCCCAGCAGCACATGTACCAGACTGATGTCTGGCTCTTTCTCTCTC
CTCCTATGTTTCTCATTAATAAATAAATAAAATCTTTAAAAATCACTGAAATAAAGTTAC
GACCTAGAAAAGGTTTTCTCCTTCCCGCCAAAAATAAAAAGCAGAATAAAGTTTCTGGTC
CTTCCAACTTGCTTTCGAGATACGGATTCCAGGGCAGCAACGTGGCGGTGATGGAGGAGC
AAACACCCGCAGCCCAGACGCGCCGAACAACAGAGACAGAGAGGCAGCCCTGCCTAGGTG
GTTAGTATACAGAGACTATCATGAGCCTCACGTTGGACAAAGGCGCGTCCCTCACTGTGC
CAACCTGTGAATCCACTGCCCTCAAGTGACGCCAGCAGTAACAAAGGAGGAAAAAACAAA
AACAAAAAACCGTGAGCGCTAAATACCACTGCCTAAAGTAGGCAGCAGGAAACCGAGAAC
CGAGCGGAAATGACATCACCAGGTGGCGCTACGCAAACCAGACACTCTGAACTCTCGCGA
TACGTGAGATTAGCCTTCCCGGAAGTGATTAGCCAGAAATAACATGGCTGCTCCCAGTAT
CTGACCGGACACTACACGCTGAACGCTGAACGGTCGGCACCATGCAGTCTGATGATGTGA
GTCTTTTGCTTTGCCGCTCGGGGATTACACGAGGTGACTTTACCATTTGAAGGCCGCATT
ATAAACTGGCCCAATTGACTCGTGTCGCTCCAGAAGCGAGATTTCCCGAAGCAGGTTTTC
CTGTCGCGGGCGGGGCTCTCACGTGTCTATTGGCGACTTTCATCCCGCGGGCCCAGCGCC
TCCTCGGGGGAGCCTGCAGAGCGCTACCTGGGTGCTCAGGGGCATCTGGAAGATTTGGCT
TTAGGTCTCTAGGATTTGTGAGGCGGGATGGGGGTCTAGTACAGAAAAGTTGAGACGTCA
TAGGAGTATTTTTCATCAGTATGCTTATTACCCGCCACCGCCCTCCCTCCGTCGGACGGG
AGGGAGATGATGGTTTACAGTAGTCTCTTTTCTCCCTTTTGAAGATATACATATACATAT
ATATGTTGTTGTTTGTTTCAATTACTCATGACACAGCAAAAGGGGATTCAGAGAATCATT
CGGAAATGCAGCTCTGTGGATGAAACTAGGAACCTCAGGCTTGCTAGTCTAATGCTTTGC
TTTACCACTTGAGCCATCTCTCCAGCCGTGCACGTCCCTTTTCTATATGGTTCTTCTGTG
TCAGATTTTTCTTTTGCATTTGCTCCATTTGTGCCCAAATCACAATTTCAGGAAGCATTC
AGTTATTTGCTGGAGAAATACTTAAATGCGTAAAATGTGCTAGCATTGTGGTGATTATTG
TAGATTTGTTAAAGCAATTCAGATGACATGCTTTTAAGGAGTATTCTGGTGGGTGGAGAC
AGGTGCACAAAAACAGTTGCACTATGTAGTAATATGCAAGAGGAGGGATAAGAATGATTG
CTTCAGAAGGGCTTATCTGGAAATGATTGTAAATAGAAGAGGTTTGATCTAAGAGCTGAA
AGATGAAAATGAACCAGGTACTGAGGGAAAAACAACCACTTCAGGCAACTGGAACAGTAA
AGTATAGAGGAGTGGAAACAAAAGAGAAGACATAACAGAGAATGCCAGTGTAACTGAATT
TAAATATCAAAGATAGTGAAAATTGATATGCTTTCTAGGGAAAGACTATGGATAGTGTTA
TAGGAACTGCCTTCTAGGCCATTTAATGGGGTTTTTAGTGGTTAGAAGTTATTTGGTAGT
AAAAGGAAATAAAACCCATTATCCAGAGAAAAAATTTGATTAGCATTTGCAAGTAGTTTT
TTTTTTTTTAACTTTTTAAATCTTTATTTATTGGATAGAGAGGGAAGGGATGATAAAGAG
GGAGAGAGACACCTGCAACACTACTTCATGAGTACTACTTTATGAGTAGTCATAAAGCTT
TTCCCCTGCAGGAGGGTGTTGGGGGTGTGGGGCTTGAGTCCAACACACACTTAGAAGTTT
TTTGGTAGTAAAAGACTTTTGGAGAAACAGTGGAATCAAGGAGATGTTTGGCTGGGTGGT
GGCTCACCTGGTTGAGTGCACAAGGACCCTTGTTCAAGCCCTCAGTTCCTATCTGTAGGG
GGGAAGCTTCCCGAGCAGTGAAACAGTGCTGCAGCTGTCTTCAGTCTCCCTTCTCAATTT
CTCTGTGCCTTTATTCAAAATAAATAAATACATTTTTTTTTTTTTAAAGAGAGCCGGGGT
GACAGCATAGTGGTAATGCAAAAGACTTTCATGCTTGAGGCACCAAGGTCCCAGGTTCAA
TCCCCAGCACCACCATAAACCAGAGCTGAGCAGTGCTCTGGTCTTTCTCTGTATCACAGT
GTTTCTGCATTTCTCTTTCACTAAAATAAAAAATAAAAAGATAAAAAAATAAAAGAGAGA
GACTTGGATGTATTTAAGATCTGTTTTTATCAGTATACATAGCCAGTGAGACTTGGTGAT
GAATTAAGTGGAAAAAGGGAGACTAAAATAGATTTTGGATTTGAACAAATAGTTCGGTGG
TAGCTATATTGACATGATAAAGTTGTTAATATTTATTTTTTATCAAGTAGGCAACTAAAT
GTATATACAAACCTGATGCTCAGGAGAGAAATGAGAAACCTGACCAGATGACAATTTGAG
AATCATCTTACAGATGATACTTAAAGACAGTAAACTCTTTCAACTTACATTTTCTCTTCC
CACTTCCTCCCCACCCCTGCCCAATACATGTCATAAAATCCCATAAACATGTTGTAAGAC
TTTTTGACAGTTTTCTCCCTTTTACTGTACAAGCACCTTTTTCGGTTCCTCAAAGCAGCT
CACTCAGACTCTACTCCCTACATCTCTACAGTGGCACTTGAACTAATACTTTGTGGTGCT
TTGTTTACCTACCTTTCTCCTTAACTTAGACAAAACTCTTAAGGACTAGATCTTCAACGA
CTTTTTGAGTGTTTTCTAGGGAAGTAAGTTTTTCACATGAATTAAGTGTACAGTAAATTC
AGAAAGAAAAAAAATGCAGAAAGAATGCTTCAGTTAGTGAAGGATAGCAAGATGTGTTAT
TCTTTACTCCCATGAGACAAAATTATGGCACACTGGTAAAGAAAAAAAAAGGAATGTACC
CTTTAACAATAAATTTATTGAGTCCTGGTGTTAAATAAGCGCATTAGGTTAAAAAAGAAA
ATTATAAAAATATATATGATCTTAGGACCAGAACTACACATCTAGGCATAAGTTGCTGAA
CCTATATACAAAAACTTGGGGTGGAGTAGATAGCATTAAGTTTTTTAAAAAAAAATTTTT
CATTTAAAAATTTTTTAAATATTCTCTTTTGTTGCCCTTGTTTTATTGTTGTAGTTATTA
TTGTTGTTGGATAGGACAGAGAGAAATGGAGAGGAGAGGGGAAGAGAAAGACACCTGCAG
ACCTGATTCACCACCTGTGAAACGACCCCCCTGCAGGTGAGGAGCTGGGGCCTCGAACCA
GGATCCTTATGCCTGTCCTTGCGCTTTGCACCACATACACGTAACCCACTGTGCTACTGC
CTGACTCCATAGATAGCATAATAGTTATGCAAACAGATTCTCATGTCTGTCTATCTAATA
AATAAAGATTAAAAATAACTTGTAAATGCTAATGAAATTTTTTCTCTGGATAATGGGTTT
AAGTTTCTTTGTAGTTCCTGTTTGCTTTTTCATAAAAACTTGTTGAAAAGAGGGTGGGGT
TAGATAGCAAAATGGTTATGCAAAGAGACTCTCATGCCTGTGGCACCGAAGTCCTAGGTA
CAGTCCCCCTTACCACCATAAGCCAGAGCTGAGCAGTGTTCTGGTTAAAAAAGAAAAAAG
AGGGAGTCAGGCGGTAGTGCAGCGGGTTAAGCACACGTGGCGCCAAGCACAAGGTAAGGA
TCCTGGTTCAAGCCCCTGGCTCCCCACCTGTAGGGGAGTCGCTTCACAACGGTGAAGCAG
GTCTGCAGGTGTCTATCTTTCTCTCCCCCTCTCTGTCTTCCCCTCCTCTCCTTTTCTCAC
TGTCCTGACAGTGACAACATCAGTAACAAAAATAACTACAACAACAATAAAAAAACAACA
AGGGCAACAAAAGGGAATAAATAAATATAAAAGTTTTTTTTAAAAAAGACTTGAATAAAA
GAAAAAAGAAAAAAAGCTTGTTGAAAAGAAAGATAAATTAGAGTGTTTTATTAATACAAA
GCATTTATTTATTAAAGGCTTTCCCAGGATACTGTTATCTTTAATTAATATATCTAATGG
TTCAAAGCAAATGGATTTTATTTTGTTTTGCAGGTTATCTGGGATACCTTAGGGAACAGA
CAATTTTGTTCTTTCAAAATAAGGTGAGTCTAGATTTTCAACTTAGAAAAGATGACTTCA
TTTGTCTTCTTGGCAACTTATAGTTTTTTTTTCCCTCCACTTCCTACCATAGAACCAAGA
CTCAAGGTTTTTGCAGAAATGAGTACAGCCTGACTGGACTGTGTAATCGATCATCGTGTC
CCCTGGCAAATAGTCAGTATGCCACAATCAAAGAAGAGAAAGGTAGTTCTCCAGTTTTGA
TGTTCATGAGCCCTATTTAACAGGCTTTGAAAGGATGTGTTTTAGTCTCTGTAAATGATG
TTAAAGGTATTTATTTTGTCCTGCAGGACAGTGCTACTTGTATATGAAGGTTATAGAACG
AGCAGCATTTCCGAGACGTCTTTGGGAACGGGTAGGTCAACTTCAATGACCTTGATCAAG
AACAAGATTCCTTCCTTGTCCCTTTCTCTCTGTTGATCTGATCTAGACTAAACTTTGAAA
TCTTGATTAAAGCCCTCCTGGTGTTGTTAATAGTGTAGAGCTAATCTCTTCCCTTTGTAC
TTTTTTTTTTTCCTATTTGATAGGTTCGACTTAGTAAAAACTACGAGAAAGCACTGGAGC
AAATTGATGAAAATCTTATATACTGGCCCCGTTTTATTCGACATAAATGTAAGCAGAGAT
TCACCAAGATCACCCAGTATCTAATTCGAATTCGAAAGCTTACACTAAAGCGACAGTAAG
TACTTGTTAGATCACTTATTTTACCTAAAGAGAGGCACACACTGGTAGATTCAGCACTTG
AGATTGAACTCGGGACTTTATGCTAGCGCTTCACCTACTACTGTGTTACCTTCTGGGCTA
TCTCTCCCCACCCCCCACCCCCCAGCAGTTGTGTCATAGAGAGGTGAAAGAGAGAGGAGA
GCCATATTACCACTCTTGTAAATACGGCACCAGGGATTAAACTGGGAGCCTCAGGGAAGC
TAGTCTTGTACTCTACCTGCTAATCTCTTTTCCTGGCTACCATGCACTTTAATTTTTTAA
ATTTTTTTATACCACGAGTTATCAATGGGTTTCGGTGCCAGCACTGCAAATCCACTGCTC
CCGGTGGCCTTTTTTTTTTTTTTTAATTATTATCTTTATTTATTGGATAAAAACAACCAG
AAATCTAGAGGAATGGGGAGAGACACCTGCAGCCCTGCTTCACCACTTGCAAAGCTTTCC
CCCTGCAGGTGGGGACTACCCCCCCCCTTCTATTTTTTTTGGATAAGACAGATGGAAATT
GTGAGAAGAGGGGGAAATAGGGAGGGAAGGAGAAAGGTAGATCTGCTTTACTGCTCATAA
AGTGTCTCCCCTGCCTGTGGGGAGGAGTTTGAACCTGAGTCCTTGTGCATGGTGCTATGT
GCACTTAACCATGTGTGCTGTCACTTAGCTCCACACCATGTACTTCAAAATCTGTCTTCC
CATGGGTCATTCTTATGAAGCTAAGGTTGTGAAACATATAGTACTGCTTTATAGCAATTT
CAGTTTTGAATATCCTAATATTAAAAGAGGAAACTTTCCCTCAGTTTTAAGTCACATCTT
TTTATTTTACAGGGTTTTTTTTTTTCCCCTTTTGGTTTTTGCTAGTGCTTCACTGCTCCA
AGATAACTTTTTCAGATATAGAGACAGCTCTGAGAAAAGCAAAGAAAGACAAGCTTTCCC
CTGTGTGGGTGGGGGGCAAGGCGGGGGTTGGTGGTGCTTGAACTTGGGTCTGATGAACTA
TTTTATGTGTGGCCTTGCTAGCTTGATTTTGCAAGATTTTTAAACATGAGATTACATCTT
GATTATTCCTTCCCTTAAATGTCAACAGAAAATTTCCTTCAAATCCTGAAGGAATTTTAA
GATTTGAAAATGACCTAAAATATGGATAAAAAGAAATGTAAGGATTTTACTCTGACTTAA
TTAAAAACTATTTTTAAAGTTATATGAAATTGACTGAGTATAAAACTCTCATACTTTGTG
ACTTGCAAATCTAAAGGTATCAGTCTTCCTAATATACTGCAGTATTAATCTTAGCAAAGT
GAATGCCCTTTGAAATTCTAGTGTGCTTGAAGAAAACAAAAAGTCACATTAGAATATCTG
ACTTCCTTTTTTAAATTCATTTCATTGGAGATAGGAGAGAGACAGAGGCTAGAGAAGCAT
TATGGCCTTAAGTGGTGCCCTGGACTGAGCTCAGGATCCTATGCTTATAGGTCCATATTT
TAACTACTACACCATCACCCACCACCTCAGGGCCACAAATGTGTGGCTTCTTATAGCATT
CAATTCTAGATTTTTTAACTTTTAAAAATATTTTTTATTATTGAATAGAGAGAGAGAAAT
TGAGAGGGGAAGGGGAAATAGAAAGGGAGAGAGACAGACACCTGCAGCCCTATTTCACCA
CTTGTGAAGCTTTCTCCTGCAGGTGGGGACCAGGGTCTTGAATTTGGAGCACTCAACCAG
GTGTGACACCACCTGACCCCTCAAATTCTAGATTTTGAAAATGTAATCTTGCTGTGTTGA
ACCTAATCCTACAAAATCATTTTCAGCTTCCCCTGTCCCCCACCAGCTTTGAAAAGGAAC
ACCTAGCAGGTGTCCTTGGATTTTCTGATGGTGTGCTTTATTTCCTATAGGAGAAAACTT
GTTCCTTTGAGTAAGAAGGTTGAGCGGAGAGAAAAAAGAAGAGAGGTAACTTGTTCTGCT
ATTCCTAGCTTCTTTGTTTTCATTGAAGTTTATTAGTGTGTAGGCAGGAGTATGAGAGAA
AGGTTCATTATTGGGCCTTCAGGTCCAGGACATGGCATAGCTGGTGAAATGCACATATTA
CCATGGTCTGTGTGAACTGGTTGGGTTCTAGATAATGGTTTACTTCTAAAAATTTTGACT
TTCAGAGAGACTTAGCATATGAGTGCTTTGGTGATAAATGTAATGGAAAACAGAAAGGCT
ATTTCCATAATCATCACGGTTTAGGTCTGCTATGAAGAGATATTCATACTAGATTAAATT
TAAGATTTGGGTTTAGTTGTGTTTTTCCAGAGCAGTGCTCAACTTTGACTTAACTGATGC
TAGGTTAAATATAATGCTGTCTCCCTGACACCATGCTAGATGGACTGGCTTTATCAGCTA
GACATGGAGAGGGTGAAATATCACAACACTGAAGTTTCCTCTGGTATTTTGGAAACTGGG
CTTGAACCTCATTCAGAAAGAAAAAAAAAGTTTCAAGTGCCCAAATGCCAACTCAGTCAT
ATTTGACCATAGGATTGAGGGGTTTTGTTTTTTTATTTTGAAATTTCCTTTAAGAAATTA
ATTGGGATTTGTTCCTTGAAATATATCAGGGTATTATTGCTAATGTAGTGAATAGTGATG
GCGTTATCCATATTGTGTTATCCATAGATGACTTAGTCAAGAAATGCTAACCTTTACCAC
ATAGTGGAAAGACTTGGTGTGCAGCTGTAGCTCAGTTTTCTTTTGTTTTACAAATTGTTG
GTCATTCTAGGTATTTGCTTTGCTCACTCCCCCTCCACTAACAGACATTTGCCTGGCTGG
CGTATTCTGCCAAGGGATAACTCAAATTCTGTCTCCTACCTGCAGGGGGAAAGCTTCACG
AGGGGTGAAGCAGGGCTGTAGGTGTCTGTCTCTCTTCCTCTCTACCACCCCTCTGTCTCA
GTTTCTCTCTGTTCTTCCAAATAAAATTAATTAAAAGCAAAGAGTTCTATATCTCACATC
TTTAGTCTCCACACATTTGAGCACTCTTTCCATCAACACGGTTTTTGAACATATTCCCCA
ATATACTATTTACTTTTATGTGTAGCATACATGTAAATTTTTACTAATATTTACTAATAG
TTTGTGATATGTGTGGTAAAATCAAGGTTTGGTTCTCAGCTGAGTTAGAATTTGATAAGT
GGGTTGATGGTAAATTGGTTGAAAGTTCTATTTTCAATTTTTAAAGGTTTTTTTTTAATA
TTTACATATTTCCTTTTTGTTGCTCTTGTTATTGTTGTAGTTAGTATTGTTGATGTTATT
GATGTTATCATTGTTGCTTGTTGGATAGGACAGAGAAATGGAGAGAGGAGGGGGAGAAAA
AGATAAGACACCTGCAGACCTGCTTCACCACCTGTGAAGTGATTCCCTGCAGTTGGGGAG
CTGGGGTCTCGAACCGAGATCCACACTCCAGTCCTTGCGCTTTGTGCCACCCACGTGTGC
TTAACCTGCTGCACTACTGCCCTACTCCCTCCAGTTTTTTTTAAGTGTATTGTGTTTTTA
TAGTAGACACACCGTCAAGAATGTCACATAATCACTTTTTTTTTTATTAGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATAATGGTTATGCAAAAAAAAAAAAAA
AAACATCCTGAGGCTTTGAGGCCCCAGGTTCAATCCCCAGCACCATCATAAGCCAGAACT
GAGCAGTGCTCTTGTCTTTTTCTGTATACCTCTCATTAAAAAAATAAAAATACATTATTA
AAAATGCTTTTCAAATTCACTTTTTAGGGGGCTTGGTGGAGTTTTAAATACCATTAAAAT
ATACAGTATACCTTTAAAACTGAACTACTCAGTGTCACCTGTAAGTTATTTTCACCAAAG
AAACAGCTGTAGTAATCTGCATAAAGGGGGAGGGCACTACTTTCCTTCCATCTCTTTGTA
CCCTATCTTTCTGGACAGTTGAGGCAACATTGTCAGTGGACATAGAAAATAATTTGTAAT
TGGTGGGGGACATAGCATAATGGCTATGCAAAAAGAGTCCCATCCCTGAGGCTCCAAAGT
CCCAGGTTCAGTCTCACATAATCCACTACCATGCCAGAACTGACCAGTGCTCTGGGGGGA
AAACTGTAGCACACTTGAATTTTTCTTAAAAAATATGCACAGAAGTTTTAAACATTTTCT
TCCCTTGGCTCAGTGGAAATCCTTTGAGGTGTAAAATTAGTTCAGTTTTTACATTTTAGT
TGTAGGTGGTACAGGTTGATGCTATGTATCACCTTCCTATGAGAGACTGCTGGAAAAAGA
TTTGGAACTTGACATCATTTTAGAAAACATGCTGAATGTTTCCATCCCTTTTCTCAGCTT
TTCAGACTGTTTGAGGGTTGCTAATTTTCTGAGCCACTAAAATAATGTGTAGAGAGCTAC
ATGGTTTGTATGGCATCAAAAGACTTTGGTAGAACTTCATTTAGAATGACATAAGACCAG
AGAATTTGAAACATGATTTTTGCTGTGCCAGGGCATGTATGATCTGACTACTCACAAACC
AACTCCTTTCTTTTTTACTTTGACACTGTTGCACTGGGGTCTGTGATGCTTGCAGTCAAA
ACCAGGCCTTGTATTATTAGCAAGATTCATACCACACCAGGGCACTGTCCTACTGACCCC
CAAAGGGTAAGAAAAGAAGAAATAGTTCAGATTGGAAAGGCAGTAGATCTCATGTTCTAG
ATAAAAACTAAATTGTTTCACATCTGTAGGTTAAAAAGTGAGTACTAATGAAATAAATGG
GCTTACTCATTTTCTCTTACAGGAAAAGGCACTAATAGCTGCTCAGCTAGACAATGCTAT
TGAAAAGGAATTGCTGGAGAGACTGAAACAAGATACGGTGAGAAAGTTTTGGGATATAAT
TTTGATTTTTTTTTTTTTTTTTAGGTAGTTTCATACAAGGAGAGAGTGGGAAAATATGTA
TCATTTTTAAAAGATGCTAGCTATTCCATTTATCCCTGGAATAAAATGTTTCATGTAGCC
CCTGGCTTCATTCACTGGTGCAAGCATAGAAAGTACTCTGGTTGTGCAGACTTGATCACT
AACAATGCATGTTGTTGCAGAAGTGAAGAGAACCAGGTTTGCTAAAATAACTGTGGTGAT
AGAAATGTATTTGCTTCAGAAGCTACTGAAGTGGCCTGCTCTACCCTACCCTATTACAGT
GTAATTATCAGCTACCACATTTTTATAGGCTAATAAGATAATTTACTTGCTGATAATCTT
TCACATTTTGATCTTTGAATGAAATAATGCTTAATGAGAATCTCGTTATTAAGTGCATGT
AATAGAACTGAGAACATTTGATCTCCATCTGATTGTCTTTTAAAATCAAACTTACTTAGC
TTTCAGCTATGATTAAACTACAGCATTTCTCTTTGTATTTCTAGAGAGAAAAAAAAAAGC
TTTGTTGGGGAGGGGTAGATAGCATAATGGTTATGCAAACAGACTCCCATCTCTGAGGCA
CCAGAGTCCCAGGTTCAATCCCCTGCACTACCATAGACCAGAGATGAGCAGTGCTTTGGT
TAAAAAAAAAAAAATTGCTTTGTTTACCTGTGACAACTTTTTTCAGTATAAAAGAACCTT
TTCCCCTTTTGTCATTTTACCCCTTTACACCTGTTCCATAGTGTAACAATTCTTGCTCTT
TGTATAAAAACCATATAGTTTTGATCTTACTGCAAAATGAGTATTTTTTTTAAGTTAGTG
TCATCTATTGGGCCAATATAGGTAAGGTTTTTCTTTTTTTTTTGGGGGGGAATAGGGTTT
CATAGGCAACTAATTTCTAAATGACTCATTTCCATGCTTCAAAAAAGTTGTGTTTAATAC
AGCAACAAACTATTATTTTTAAATTTTACTTTTAATTTTATTGCATAGAGACGGAAATTC
AGAGGGGGGGGACACGAAGAACTACTTCACTGTTGGGAGTTTTCCCCTGCAGGTAGGGAA
GGAGTTGCCAGTACTTGTGCATGGTAATATGTGAACTCAACCAGAACCACCACCACCTAG
CCCAGAATTGAGTTTAAGACCCTGACAGCTCTAGGCTTAAAAATAATGTAGAAATATTAT
TTATGAAATTAAATATTCCTATTTATTTACTCAAGAAAAATCATATGCTAATTGTACAGT
GGACTTTTAAGTCAAAGATCCAAATGTAGCTAATCTGTGTTTTTGTTTTTTTATTTTTGT
GTGTGTGTTTATGTTTAGTATGGTGACATCTACAACTTCCCCATTCATGCCTTTGACAAA
GCCTTGGAACAGCAAGAGGCAGAAAGTGACTCTTCAGAAACTGAGGAAAAAGATGAAGAT
GATGATGAAGTAAGCCATGCTTGTTTTGTCAATCAGTAATCTGCAGGACTAGATCTGTAT
ATAATCGAGACACAGACTGTTATTTCTTAGGCTATTTTTGGTTCAAACAGTGGCTGATTT
ATCCTGGCACTAGTTTTCCAACAACTTACTTATGCATTAACAGTAATGATCTTATCTGTT
GGCATTCTTGAACCTAACAGTCATGTCTGTTTCATTTTAGGATGTGGGAGAAAGAGAGTT
TGTAGAAGATGATGAAGTGGATGAAAGTGATATAAGTGATTTTGAGGTGAGACTGGATTA
AAATTACCATTTGGGGTCCAGACTAGGCCAGGACATATCTTAACCTGTAGAATTTATGCC
TTGGTCCCAGCATCACATGGGGGTACCATGGATGATAGAATTTGCCCTCTGGCTGGAGGA
ATAATTTGGTTTTTAGAACACTGGACTTACACATATACATATGTGGTAGTGGGCCAAAGA
TATAGTTCACCCAGTAGGGTGTCTGCATTGTTGTGAGCCACAGCCCTTGTTCCAAGTCCT
GGCACCATATGGGAGATGCTGTGGCAATGTAGGAAGCTCCAGTGCTGTTATGCCACTCAC
TATTTGAATAAAGGGTGGCCAAGAGCAGTGAAACCATGCATTTGTGAGGTCTCAGAGATG
CATATATGTGTATGTACGAGGGGTTTACTTCAGCACACACACAGAAGCAGATAAATACTC
TATAGTTTGTTCAAAAGTAAAAGAACAATGAAAGGAGTTTGGGGAATCTATTTAGCATCT
TTTTTTCCCCTCCCCACACTAGGATATGGATAAGCTGGATGCTAGCAGTGATGAAGATCA
GGATGGTAAGACCTCCAGTGAGGAAGAAGCAGAAGAAGAAAAAGTACACAATGCCAAACA
CAAAGGCAAAACCCCTGTCAAAAAATCTTTGGGAAAACGCGCCTACGTGGAAATAGAATA
TGAGCAGGAGACAAAGCCTGTGGCTAAAGTCAAAACCACGTGATTGTCCTGCCATTTATA
AATAGGACTAAACACTGAACTTTTTCTTTCTTTTCAACATATATACACCTCTAGTTTTTA
CTCTTTGTTATATTTAACAAAGTATCTGTGGTTTATAAAAAGAAATATATTTATTCCCTC
TGGGATGATATGGAAGTGGGTGAATGGATTTACACAATATTTTTATATATTGGCATACGT
GTTACAGTAACAGCTTGAGCCCAAGAAGTTTAACAGATGAATTTGTGGGTGTAAAGAAGT
TGTAAATTGTAAATGTTGCCCCTTTTTCTTGGTATATTTTCCCACCGCCAAGTTTATTTA
GAGATGTCTAAACCAGTTTTTTTTTTCCTCTCACCTTTCCCTCTTTTGTTGGGAGTAAAA
TAAAAGGAAAAATGAAGATCTCGGTTAAAATGTTTATTGTAAAAAAAAAAAAAAGCCTAT
TAAAATAGCTCCATTTATACAACTGAATAAATAAAGAAAATCCTCTCTAGCAAGAAAAAA
AAATTAAGTTTCAGCATACGATGTTTCCTTGGAAGCTTGCTGCACTTTGCTGATACACTT
CACAACCTTGCTATCATCACAGCTTTGGGGAATTTTGGCCAGGAGACTCTGAAACATAAA
ATTACATAAGCTTTAATTTATTTATTTTTCTACTTTAGTTTTGGTTCTTTCTTGATACTA
TACTCAAAAGAAGGAAGGAATGGATGACACTATGGAACAGTTCATAGACTGGTGTTTTTA
CTTTTTAAACTATGTTGTTGTGCCTGAAAGTCTGCTTGCTCATGAAAAAAACAGCCAGGG
TAAATTAGGCTGAATTCAGGAGCTAGAAACTGCCTGAGATTAAAGAACCAAGATGAAGTA
CTTTGAGTAAACTGTACTATTTCTAAATATTTTTAGGATATGAGCTTTTCATGCCTTACA
ACTTTCAGTTGAAATCAGGCATATTCTATGAATAATAACGAGAGCAAAGGAAAAACAATT
ATCACTCCACCCCTACACACAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 4713..4762, 4852..4961, 5066..5130, 5303..5454, 7370..7424, 10342..10416, 11778..11888, 12100..12165, 12682..12882
1001..1015, 4713..4762, 4852..4961, 5066..5130, 5303..5454, 7370..7424, 10342..10416, 11778..11888, 12100..12165, 12682..12879
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved