Erinaceus_europaeus Locus RANBP1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus RANBP1
Erinaceus_europaeus
RANBP1
GeneScaffold_3362
SNORA77
10395..10513
11935
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCCCCCTTTCCCCAA
ATCTCCCTTTCTTTACGTTGTTGTTGAGCTTGTCACTCAGATTAGGGTCCTTCCTGCCCT
TCCTCTCAAGAGCCACATCAATGGCCTCCTTCAGGGAGCGCGGGACGCGACAGGCCTCCG
CACCGGGTGGGGCGGGACTTGAACCTTCGCTGCTCAGGTCCCGCTAGTGGGAAAGACGTG
CCCTGCCCGCTCACCAGGAGCTCGGGCCCGCGCCCGCCGCTCCTCTCGCCCACCGCTCTC
CCGCCGACCAGTGCCCGTAGCCCCGGCCGCGCGTCTCTATCATTCTGGCTTCCGGCAACG
TCATAGCGGCGCGCCCGTCCCGACCCCCATACTCTTTTGCCAACTCGAGAGCCTTGCGCG
GCCGCGGGGCGGAAATGCGCGCGAGGGCCGCCGGGAGTGCACGCTGCCGTAACTGCGGGG
TGCCTGAGCATGCGCCGCGGACATTTTGGCGGGAAGCGCGGGGTAGGCTGGACAATGAGA
GTGTCCGCCGCCTGAGCCAATAAAGCTGTACAGGTTTTGAATCGCGGCGCATTTCCCGCC
GCCGAGGTCAGGGGTCGGGGTTCGGGTCGCGGGGCGGAGGGAAGAGCGGGCGGACGGCAG
GCGCCGGCGCCAGACGCGGAGAGAAGGAGCTACGACCCTCCTCCCAGAGGCCGCGGAGCC
AACAACGACCGAGCCAGCCGAGCCGCCGCCGCCGCGCCCCCATGGCGGCCACCAAGGTGC
GGTCGGTCGCGGGCGGGGGCTGGGCGGGGACCGAGGGCTGAGGCCTGATACCGGCGGCCA
CGTGGGCGTCCCGCGCCACCGCCGCCAACCCCCGCTGGCCTGCGGGTTCGAGGCCTGCGG
AGCCTAGCTGCGGGGAGCGCGGCGTGGGGGCTCTAGGCCTCCCCGGCTGCGGTTCGCGGG
CCTGGGGGCTACGGTGAGCCCGCTTGACCTTGGGACGGTGCCCGGGGTCCCGGGACCTCC
ACCCGGACGTTTTTCTTTGGGGGGGTCTGGTTCCCGCTTCCCTTGAGCGGCCTCCGGGGA
CGCGGGACCCGCAGCCGGCTCCCCACCTCTACGGCGCGCACCTCTCTTGCGGCCTACGCA
GCACTCATTCATTCGCACGCATTCATTCATCTACCCATCCATCCACCCACCCACCTACCC
ATCCATTCATCCATTCATTCACTCAGCCTCTGTGTCTCGCACCGCAACGGGCCTCTGCGG
CGGCGGCTTTGTTGGCCCTGGGCGAGCTGACCTCTCCGGAGCCCTGTTTGTCCAGCCGAG
AAAAGCAGCGAAAAGCTTTTTTTTTTTTTTTTTTCTCCTGCTCCTTCCTCTAGGGTTGAG
TCTGATGATGACTGTCTCTGGGTTTGTCTGTGTTAGAGATACACGGAAACGAGCCATGTG
CTGGGTAAAACTTAAAAACCTGAACAAGAGATGATTCATTTTTTTGGGGGGAGGGGCCTC
ATACGCGATTGATTTTACTTGTGACAATTGGAGCGTACAGAGCAAGAAAAAAAAACGTGA
TGACAGAACTGAGCTCCGTATAAATAGTAGCAGCTTGGTAGTAACTTGTTTACCTTGTCG
CAAGCTAGAGCTCACATGTTTCTCCAACAGTAAAAACCTCAAAGGGTTGCTTTTTTGCTA
TAAAAGTAGCGCTTCCCCCGGGGCTCTTTTCTATCCACCCTTGAGTTCTTTAATCTTCCC
TGAGCAGACTCATCCACGATTAACAGATTAGGAAACCGAGGTTCAAAGAGACAGCACGCC
ACCTCATTTAGCACTGCACAGATTTGATTGGTGCCTGTGCATCTTTAGAGAGTTTGGAGG
ACTGGTTTCTCCACACACTTGTTCTGTGGGCCTGGGTGTACTTGAAAACGCTTGTAGGAC
TAACCTCTTATTTTGGGAGTGAAGTCATTTACTGGAGGGAATAGTGAGTGCCAAACTCTA
TACCTCCTCCTCCATAGGACACCCATGAGGACCATGACACTTCCACTGAGAATGCAGATG
AGTCCAACCACGACCCCCAATTTGAGCCCATTGTCTCTCTTCCTGAGCAAGAAATTAAAA
CGCTGGAGGAAGACGAGGAGGAGCTTTTTAAAATGTAAGTAAGGTGATACTGTTGGAAAA
ATAGGTACCTTCAGTGTAAAAGTTTTTTTTATAAATGTCTTGATCTAATGTACCAAGGGT
ATTGGGATTGGGTTGGGAGGAAGCCCAGAGAAAAATACGAATTATGTGGAGACTAATCCA
TTGTGGGAATTAAAGTTGTGCTGCTGTTGTCACATAGAATAGTTTTGCCCTTCTCTGATG
TTCTGTCCACAATGAGCCCAAAGATGATGGTGCAGCCTACCAACCAATGTGTAAGCTACC
CATGCCACTAGTACTGTCACAGCCCCTTCCACTGGTGCAGGTCTGTCTCAGGAGTTTGTA
ATTTATTTTTATTTATTTATTTGGATGAAAGAGACCCTGANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCCCCCCCCCATACTTAGAGGGACTTCTTTACTAAAAGTTCAGGTCGTTTG
GTTGGGGAAATTGACTGTGAAATAAAAGCTTGAAATTCATTCAACTGTTTGGCTCATTTG
CTGTTCTGAATTGTGGTTTAATGCATAGAAGACACATGATATGTACCTGTAATAATAGGA
CACTCAGTACCCTCTGAGTATCTAAGCTCTCCATGGCTTTTCTTGAAGGCGGGCAAAGTT
ATTCCGATTCGCTTCAGAGAATGATCTCCCAGAATGGAAAGAACGAGGCACAGGGGACGT
CAAGCTCCTCAAGCATAAGGAGAAAGGGACCATCCGTCTCCTCATGAGGAGGGACAAGAC
CCTGAAAATCTGTGCCAACCACTACAGTAGGTGACCTCTGGGGTGTGGTTTCTCTGCTCA
GCCCCTTGAGCAGGCTGTCTCCAGTGCTTTCTGGGAGCACACTGTTCCTCCCAGCACTTG
TGTGAGTGGCAAGCTTGCACATTTTAAAACAGGAAACAAGGTTTCTCATTGTTTGAGCTC
ATAGCAGACCGGCAGAACTTCAAGCACATGTGGCGTGGAGCCTGGGCAGAGTTGATCTGA
CAGGATGGAGGTAGGGCCTCAGCGTGGGCTGGGGGTCATGGGTGCCAGCTCAGACCGGGG
CAGCAGTGAGGACCCTTTGCTTATGCACTTGTACTTAGAATGCCTGGGCAGTGTTTTCCA
GTACTTTGTGTTGGGCCACAAGAGGAGAAAGAGGAGGCTTCACAGCAGGTGGGTAGTGGT
TAGAGGCCAGGTATGATGTTTTAGGCCTGACTGTCATGAGCATAGTAGAGCTAGCCTGAA
GAAAAGCACATAGACTTGGCCTGTAAAGAGTTTGTTAAGTCTCCCTTGCCCCAAAATTCT
TCTCTTTGGCTGCTGGCCTGTTCATAGTACCACAAGTGTGTCTTAGGAAACAGACCCATC
TTGGGCTCCTTTGCTGAGTCTGCATTTCTGGGTGTGGTGCATGTCCAGTAGGACAGGCTT
CTGCTCAATTTTCAACTCTCCCCTCCCAATTATTTATTTATTTATTTACATAGGGCAGAA
ATTGAAAGGGGAGGGGTTAGAGACAGTGACACCTGCAGCAGTCCTTGTGAAGCTTTCTCC
TATAGGTGGGGGCTGAGGGCTTGAACCCAGATCCTTGCACTTGGTAACGTGCTTTTTTTT
TTTTTTTTTTTTTTAAAGATTTATTAGAGTGGGAGTGAGAACCAGAGCATCACTTTGGCA
TGTGCAGTGCTGGGGTTGAATTAAAGGCTGCTTCATGCATGCAAACCCTTTGTTCTCCCC
CATTGAACCACTTCCCTGGTAGTCTAGTTTGAAACTTTGTTGTGGCTATTCCCTAACTCA
GGATACTTCCCCCAGAGCCTTGTTAGGAAGTGGACACTCTTCTGTGTTGATTGTGAGTGG
GTTTGCAGACTTGGTGATGCAGAGCAGGTGGCGGCAGGATGACATAGTAGCCTCTTTTGT
GCTCTGTGACAACATGCAGGCTAGCATTGGGGTGGCCTCTCAGTTCAGGCAGTAGTGTGT
TCTGGGCCTGCAAGGGGACTGAGGAAATTGATGTAAAAAAAAGTGTTTGTCCCTGACCAT
AACTCTTTGCCGTTCTGTGCAGACATGTCAGGAGGTCTTTGGTATCCTTTTCTGGGGGGC
CTTGTCTCCTATCATCTATCTCCCTGGACAGTGCAAGACTGAGGAGAGTGGCTGCCCTGG
TCTGAGTACAGACCCTGATAGGTCATGGCCCCATTTCCTCACTTGTCCCTCTGCATCTAC
TTCCCAGGGGCCTTCTAAGCCTTGAACTCCAGATCTGCTTTAGAACCAAGGAAATAGGGT
GTTTAGATTGGAGACCCTTGCTGGGGGCAGACCAGCCTGTTCTCTCTCAAATTCAGGATT
ATTTTGGTCTAAGTGGATATGGGACATTTTTATTTTATTATTTGTATTTAATGGATAGTA
ACAACCAGAAATGGAGATGATAGAGAGAGAGATGTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCC
CCTGCAGGTGGGGAGCCGGGGTTCAATTGAGAGGATTCTTACACCGCCTTCTTTCTTAAC
ACTTAAGGAATACCCAGGCTTTTGGAAACTGAACCTGGTACTAGACAAGTATATACTAGA
AAAAGTAAGTTAGTCATTTAATGGCCAAATATATCTATTTCCTATAAATCACTGTAATGC
CAGTGAAAACAGTGTTAGAAAATATTTTCTCAAAGATAATTATAAAAAATAATAATAAAT
CTTGATGCATTTGGACCATATGCTCAGAAGCCCAAGTAGTCCGTTTCCCTCTTAAACTCA
GAGGTTCTGCTATTCTGCATAGCCAGGACAGCATGTCTTGTGTTCCTAGGGGCTCTTCTG
AGGCTGACACCCCTTCACTGTAAGCCTGGATTATCAAAAGGTCACTGGGTGGACTTAGGA
GAAAATGTGGGTATTGTGGTCTTTCCAATTGCTCTTGTGGTCGATGGTCGGTTACCAAGT
GCACCTCATCTTTGCTTGGGCAGCAGGCCCTGTCTTACAGTTCATTCAAACCCTGGTGGT
GAACAGTGATTGGTCCTTGCCTCTTGGTTACCTGAAGACAATTTGCTCCTCTATCTAAAC
TGTTAATGGATTTAGATGGTGAAAGTTGCCTGGCACAGCTACCAGCCTCAGAGTCAGTGA
ATCCTGGTGCCTCAGAAGGCAGGATGTGTTTCCTCACTACTGGAGGTCTTATGAAGTCTC
TCTTCCCCTTTTTTCTTTTTCTTTTTTTCCCCGTAGATGCACTGAAATTCAAAACAAAGT
TTGAAGAATGCAGGAAAGAGATTGAAGAAAGAGAAAAGAAAGGTAATATGTTGCTCGTGA
TCAGAGACATCCCTCGCAGACTCACTCTGCACCCGGCTGCAGCCCCAGGCGGGTGCTTTT
TCTGTCTGCCACAGTAACACTCCAGGCGCTGCAGTCATCTTGACATGGCAATACAGTTGC
CGGGGGACAAGGTGGTATTTCTTGGGGAGTGAGTTGGTGCTTGGGCATGTGCTGACTGGT
CTGGCCTCACAGCCAGGTCATAAGGCCCAACTAAAAGCCGGCTTCCAGGTTTCATCATGG
TTACCTACTCCCTTGGGGCCTGCGAGTGGTGCTGTAGCAAGACGTACTGGTGGCCTGAGT
GCGTGAGCATGTTTACTAGGGTGCCTGGGAATGCCCTGCCCTGTGGGGTATGTGCCACAC
AGTCACTGGGGGGGGGGGTGCACATATGCTTGACCTGGGTGGTGCTTCCCACTCTCATGG
GGTCTCTGCTGTTCTTGTAGGGGGCGGAAATGATAATGCTGAGAAAGTGGTGGAAAAACT
TGAAGCTCTGTCAGTGAAGGAGGAGACCAAGGAACCAGAAGAGAACAAGGAGAAAGCTGA
GGAGGAGAAGCAATAAGTCGTCTTCCCTTGTTTTCTTTCCCTTCCTTTCTTTTCCTTCTT
TTTCTTTTTTAAAAATTTGCCCTGCCCCTCTTTTTCTTTTTTTTTTGGTTTTATTTTTAT
TGTTTTGTTTTTACAAGGGCTTTATATAAAGAACTGAATTCCAACAATTCAGGTTGTTTT
CTAAGTTTTTGCCCTATTGAAGATGACTACAGAAAATCATTCCCCAGTCATGAAAATGTA
CTGTGCTAACTTTCTTTTCCATAGTGGAAACATTTATAGTCATAAGAATTAGTGAATAAA
CAACACATTTGAAACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 2237..2373, 4668..4825, 7931..8059, 10296..10361, 10817..10886, 10905..10935
1001..1015, 2237..2373, 4668..4825, 7931..8059, 10296..10361, 10817..10886, 10905..10932
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved