Erinaceus_europaeus Locus ENSEEUG00000014071
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ENSEEUG00000014071
Erinaceus_europaeus
ENSEEUG00000014071
GeneScaffold_4548
SNORD34, SNORD35
3013..3085, 3261..3347
4769
CTGCACAGAGCCATCAGCCAGAGCTCGGCAGAAAAAAGAGGGGGCCAGGCGGTGGCGCA
CATGACAGAGCCTCAGGCCCCGGGTTCAAGCCCCGGCTGCCCACGGGCAGCTTCACGAGT
CAAGTAAGACTGCGGGTGTCTCGCTCGCTGTCTCTATCCAGTAAATAAATATAATGATAA
TTTAAAAAAGAGGGCGGAGGGTAGATAGCATAATGGTTATGTAAAGAGACTCTCAAGCTG
ACGCTCCCAAGTCCCAGGTTCAGATTGCACCACCATAAACCAGAACGGGTTAAAATAATA
ATAATAATAATGTGATCCGGGAGGTGGCGCAGTGGTTAAGGCACTGGACTCTCAAGCCTG
AGGTTCCGAGTTCAATCCCCGGCCACACGAGTACCAGGATGATGTCTGGTTCTCTCTCTT
CTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCGGGCTGGGAACC
CCGACCGTTCAGCCCTGATCCGGCGCGGAAGGTCCGAGCCCGCTGCCTCCCGCCTCCCGC
CGGTCACACGCGCCCTGCGGCCCGCGGTCGCCGGAGGGGGTGGCGGCGCCCCCGATGGCC
GGCCCCAGGGGGGAGCGGCGGGACGGCGCCCGCAACCCCTCAAGAGCATGGCGGCCCGGC
CCGGACGACCCCGCCCCGCGTGCCCTGCCCCCGGGGTCACGTGACCTCCCTCCGGGCCCC
GCCCCGCCCGCCTAGCTCGGCGGGGCGTCACTCGCGGATTGGCCCATCTCCAGACGGCCC
TCCTCCCGAGGGGAAGTCTCTGCGCACGCGCCGACACGCCGGCCAATGAGAAGCCGCGAA
GCCGCCGGCTCAGCCCGCGTGGCGTCACTTCCTCCGCCCCTGCTTCGAGGCATAAGAAAC
CCTGCGGCGTCCCTTCCTTCTTTCCCAGGCGGCTGCCGAAGATGGCGGAGGGGCAGGTGG
GCCTCGGAGCGCGGCGGGGCGGCGTGGGGCCGGCCGGGGTGCGAATCGGGGGGCTCTCCT
CGAGGGAGAGGGGGGAAGGGAGACAGAACCGCCCTGTGGCGCGGATCGGGTCCGCGGGAC
CTTTTGGTGAATCTTCCTGTTGAACTCGGCTAGGTAGATCCGTGGTCGGTCGTCAGAGCT
TCCATTCTCGTCCTTGGTACAAGCCCGAGAGGAGTAGGGACCTTGACATCTCTCACTACA
AGAATGCGCATTCACTTTCTAGGATCGAGAATGCTCTGGCACTGGACTAAGAAACCCAGC
ACCGATGGAGCTTACGCTGCCCACGCCCTGTCCTGGCTCCTTTTTTGTGTATTTATGTTC
CGCTCGGTAGTTTATTGCTGCAGCAACTGATGTCGTTGGCTAGCACAGAGATACACACCT
CTTTCACAGCTTGTGAAGCGACTTCCTGCAGGTGTTGAGCCTGAGGCTCGAACCCGGGAT
CCTTGTGCTTCACACCATGTATGGTACACCCGCTGCCCAGCTCTTGCCTTTTAACATCTG
CGTCACAGCTCAGTCAGGAATACCTTTCCAAAAAGGTCACTTTGAGTGGCTCAGCACTAG
GACTCTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCGGCCCGTCTGTGCCTGC
CCCGCAGTGAAGTACCTGGCCTTTCTCCGCAAGCGGATGAACACCAACCCCTCCCGCGGC
CCCTACCACTTCCGCGCCCCCAGCCGCATCTTCTGGAGGACCGTGCGGGGTGAGCGGCGG
GCGGGGCGGGGCGGGGCGCGGCGGCCGCTGATGAGGATTGTCCCCTCGTGTTCGAGTTGG
CCGACCATGAGACCACCGCATGCACTACCATCTGAGGCCGCCGGGGCCGGGAGGGCCGGG
CCGGGGCGCGCGAGGGCAGCGGCGCTGACCGGGTGCCCCCCCCCTGCCTGCAGGGATGCT
GCCCCACAAGACCAAGCGGGGCCAGGCCCGCCCTGGACCGGCTGAAGGTGTTTGACGGCA
TCCCGCCCCCGTACGACAAGGTGGGTGAGCTGGGCCGGCTGCAGCCCCCTCCCCAGCCCC
GGCCCCGGCGGCGGGGCGTCCATGATGACCGACCGTTACCTACATTGTTTGACCCTCCTG
AGAACAGCTCCTTGCCTGAGACGCCCGTCCCAGCCAGCTCTCCCCGTCCGTCCCTGGTTC
CAGGTCCCTTAAGCCCCTCTGCTTCCCCCACAGAAAAAGCGGATGGTGGTGCCGGCTGCC
CTCAAGGTCGTGCGTCTGAAGCCAACGAGGAAGGTGAGTCGGGGGCTGTGGGCGGGCTGG
GGGCCGGGGTCCCCCAAGACTGGCAGATGATGGTTCATTCTCACGATGGTCTGCGGATGC
CGCCGAGGGCGCTGCCGAAAATGCCAGTGGCTCAGCTGATGCCAGGAGGGAAAACTCTAG
GGCATGAGGGCTGCTCCTCGCCAAGCCCGGGCCCCTCACGGCCGGCCGTCTTTCCTCCCA
CCCCATCCCAGTTTGCCTACCTGGGGCGCCTGGCTCACGAAGTGGGCTGGAAGTACCAGG
CGGTGACGGCCACCCTGGAGGAGAAGCGCAAGGAGAAGGCCAAGATGCATTACCGCAGGA
AGAAGCAGCTGATGGTGAGGCGGCCGGGCGCCCAGGCCTGTGCCCGGGGCTCCGCCGGGT
GGCGCGGGGGGTGGGGGCGGGGGGTGCCCTCCTGGGACGGGCTGACCAGCCGCTGACCAC
TTCCCACTCTCTCCACTCCACAGAGGCTACGGAAACAGGCCGAGAAGAACGCCGAGAAGA
AGATCTGCAAGTTCACAGAGGTCCTTAAGACCCACGGACTCCTGGTCTGAGCCCAATAAA
CTTGACTGTTTGCTCACGTCTGGCCTTCCCTTCCTCCCCGGGGCCCTGGGGCGTGGGGGA
CCCCACAGGGCAAGCTGTCTGGGGCCTACAGAGCTCACACGAGTGTGGGTGTAGCTTGCC
TGAGGCCAGCTTGTGCACAAGTTTAAGGAATCAGCACTTGGAGCAGCCAGCTCCGACTAT
GGAATTTTGCAATGGTGACCTGGAAAACACGAGGGCTTGGGGCTTTCACTCCCGGGGTGG
TCGATGCTATACTCTGCAGCTGGTGGAGAGTGCTAGCCTGGGCAGGTGTGGGCCTGATGT
TGTACAGGGGGCTTGACTTATGCTGGGAGGGCAGCTAAGGGCATCAGTTCCTGTGCCGGC
CCTGTGTTCTGTAATATAAAATAAATTATTTTAAAATAAAAAAAANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGCCTGTTAGGCGCTTTGC
TCCTTGCCAGGGAGGGTCCTATGGGTACAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1975..2047, 2148..2213, 2587..2688, 2873..2907, 2909..2959, 3153..3212, 3431..3553, 3683..3769
1001..1015, 1975..2047, 2148..2213, 2587..2688, 2873..2907, 2909..2959, 3153..3212, 3431..3553, 3683..3766
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved