Erinaceus_europaeus Locus GDI2
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus GDI2
Erinaceus_europaeus
GDI2
GeneScaffold_1978
SNORA46
4654..4789
10860
TTTCTCTTCCTTCTCTGTCTTACCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAA
CGACGACAACAACAACTACAACAACAATAAAGAAAACAAGGCAACAAAAGGGAAAACAAA
TAAATAAAAAGATTTTCAACTGGCTGTTCAGAGTTAAAAAAAAAAGTTAAGAAACAAATG
TACAAATTCTCATGAGATGCCAAATTGGGACGCATATTAAAAGTCTGTTTGCAGATATTT
TCCGTTTTGCAGGTGAGGGGTCTTGGTCACAGCTGCAGTTGTTGTGGTTCAGAGAGTGGT
CGCAGGTAGATGGGTGTGGGGTTGGCCAGCAGAACCTCGTTTACAGACTACCCTGCATTT
ACACGAACTCCATTGTTTGAGGACCCCTGCTCTATGGCAGTGAGTGAACTGACCACACAC
AAAGTGTGTGTGATGAAAAAACATTTACCGCGGGATCCTGCTTTCAGAGCCAAAGCTCTT
CGAAGCCAGGAGCATGTGGCTTGAAGTTCAGCTTATCATCGACTCACAGGAAGTTTTCTT
TGAGTCAGAATTGCCTTGTGGATTCTTTCCATCTTGCCACACAGAATATTGAAAGGGTTG
CTGTTGAGAGATGCCCGCTTAGTAGAGGTCATTTTTAGTGCTTCATTAAGGAAATTCTTA
CATGTAGCTGGTGTCTGTTTGCGGTGAATGTAGTGAGTAGTGCGGCGAGAACCACTGCTG
TCCCTTGCTCTACCCATCTCTGTTCTTGTGCAAAGGCCAGCACAGTGGGGGAAAGGGAAT
ATTGTCTTAGTTTTCTAAAGCGGTGTTGACCTTGCAGTTCACGGCGGCCCACTTTGAACC
CTGGCTACTTTAGGACTGTGTCTTTAAATCACAGCACGTGTTGCACATACGTAGCTGCCA
GTTACTAAAAGAATGTTCAGCCATAGGTTTTGAAAAGCAAGGTATCTGAAGCGTGGTGGA
ACATTTTCCTCCTTCTGAAGGTCTTTATACTTTCTCTATAGGAATGTATCCTGTCAGGTA
TAATGTCTGTGAATGGAAAGAAAGTTCTTCACATGGATAGAAATCCGTATTATGGAGGAG
AAAGTGCATCAATAACACCTCTGGAAGATGTAAGTATTAGCGTGCGTTACCCTTGAGCAT
TTTTCTTTCGTGAATCTTAGAAAAATTGAAAGAATAACTCTAGTGGGTTATTCTAGTGGA
TCAGAAACTTGCCACCTTACTGAGATTAACGCTTTGCCTGCCTGCCTGCTCCCCTCCCCT
CCTATTTATACTTCTTTTTTTTTTTAATTTTAAAAAATTATACCTTTATTTATTCCTTTT
TGTTGCCCTTGCTTTTTTATTGTTGTTGTAGTTATTGTTGTCATTGATGTCATCGTTGTT
AGATAGGACAGAGAGAAATGGAGAGAGGGGGAGAGAAAGACAGACACCTGCAGACCTGCT
TCACCGCCTGTGAAGCGACTTCCCTGCAGGTGGGGAGCCGGGGGCTCGAACTGGGATCTT
TACACCAGTCCTTGCGCTTTGCGTCACGTGCGCTTAGCCCACTGCGCCAGCGCCTGACTC
CCTCTACTTCTATATAGATCCTGCCACTCGCAGGCCGACTTACTCGGAAAATGAGAGACA
GCTCAGTACCGCTCCTTGGAGTCATCATCCACGGAGCTCCCTTGGTGCTGCGTACGGTGC
TCTCGTGTCATGCACCCTTTTCTCTTTTTCTCTGACTGGACAGAAAGAAATTGAGGAAGC
AGGGGGAGTTAGGGAGAGAGCCTAATCACACCTGCTCCACAGCTTCACTACTTGTAATGC
TGTGCTCCTGCAGGTGGGGACCAGGGGCTCGAACCTGGGTCCTTGTGAGTGGGAATGTGA
GCTTTCAGCCTGATGTGTGTGCCAGCCCCTGACCCCATGGTGCACATTTTGAAACCTAAA
TTTATTTTTGATTCCTTACATTACTGTCAAAAATCTGTTAGCTTTTTATTTAGAAGAAAA
TGAGTTTGAATATGTTTACAAATAATAAAGGGTCTGTTGCAGACACAGACTAGTGTGTCA
CCAAGAAGTCGTTATTATCCTTGCATTTCTTTCTTTTTTTTTTTTATTATCTTTGTTGGG
TAGGGACAGCTAGAAATTGAGAGGGTAGGGGGTGACAGAGAGGGAGAGACAGACACCTGC
AGCCCTGCTTCACCACTTGTGAAGCTTTCCCCCTGCAGGTGGGGACCAGGGGCTCGAACC
TGGGTTCTTACACTGGAGTGTGTGCTCACCAGGTGCACCGCCACCTGGCCCCCAGCCTTG
CATTTCTGATCGTAACAGCCTGCAGGATTTGTGTTAATGCCCACAGGAGCATGTCACGGG
TACATTGGGGCTTTGCTAGAGAGTTTGTCTGATTGATAATAAAGTGCCCTTCCTACTCCT
TACCTCACATTGTGGTGCTTAAGTGTTGCACTACAATCACTTCATCAGATGTAGTTGCAT
GACTCTACTTAAAATTAAACTGTGTCATTTTATGGATATTTTTCATTTTGGTTTTAGTTA
TACAAAAGATTTAAACTACCAGGAACACCACCGACATCAATGGGGAGAGGAAGAGACTGG
AATGTTGACTTAATTCCCAAGTTCCTTATGGCTAATGGTAAATAATTCTGACTTAGATGT
CTAGCGTTGCATTGAGCGTGTGCAGATTAACCTTGTTGAGTGTCAGTAGCATGTCAGTAG
TATCGGCCTTTATGAAAGTCAGTGAGCTGAGGAACGAGGTGGCTTGTTACAGAAGCCGTG
GCTTGGGGATGTAGCTCACAGGTAAAGCATATTCGTAGCTCCAGCTGGATTCCATCACTG
GTACCAGAGCAAAACAGAAAAGAAGGAAGTCCAGATTACTGAAAACTTTTGTCTATGAAT
TAACTTTCTTTAAATATAGTGGTAACTCTGAAGAAATCCAAATCAATTTGTAATAGGGTT
ATAATTCTAAACTTCATATCTTGTTTTAAGATTTTCTCTTAATTTTTTTATTACTTTTAT
TTATTCAATAGAGATAGCCAGGAATTGAAAGGAAATGGGAGGGAGACAGACTGAGAGACA
CCTTCAGCTCTGCTTCATCAGTTGTGAAGCTTCCCCCTAGAGATGGGGACCTGGGGCTTG
GACCTGGGTCCTGCGCATTGTAACGTGCCCTCAACCAGGTCCACTACCACCTGGCTCTCT
GAATTTCATATCTCTTAATAAATATTTTGCAGCTTACCTAGAAATTGTAACAGCAAAAAA
AATCTGTAAATGTACTAAGTGATGGCTGTGTATTCTGATNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGGGTGAGCTGTGTCGTGGCCCTGCTCTTTACTGTT
ACTGAATTAAGTTACATGCAGTAAAACCACAGACCTACGATGAAAGTAAATTTGCTAAAC
GTCTAGGTTTGTGCAGCCAGACCCCCACAGTCAAGATGCAGGGCATTGTCCCCTCTCTCC
ACATTTGCCCGAATCAGCTCGAGCAGTCACCACGCCTATCTGCTGGGGGTCTGTCGCTCT
GCATCCGCTGCTGATGCCCGAAGCTCATTGGCCATCCGTGTTTCTCACCCTCCCTCCACA
TTGGTGTCAGTGGTTCGTCGTAAAAAGCGAGCACAGCACTATATTTAAACTGTGGACGGG
AACCCTCCCTGTTCTTGGTTACGCTGTAGTGCGAAAGGATTCCTTGGCCTGCTGTGCTGC
ACACGGATTGTCTGTCAGTCTGCTGTCCTGCCTGGTGCCAAGAAACATGTCTATATTCTG
CTCTGTTACCTGACAGCATCGAAAATGGGGATACATGGAAGTTTCCATCTGTTCTGGAGC
AAAATTCCAAGAGCCTTTCATTCTCTGCCCTCTCAATTCTCTGTCTTTATCCAATTAAGA
AATGAAATATTTAAAAAAAAGGAATCCTAGGGGCTGGTCTGTGGCATTGGTTAAGTGCAC
GTGGCGCGAAGCACAAGGACCAGCGTAAGCATCCTGGTTCCAGCCCCCGGCTCCCCACCT
GCAGAGGGTCACTTCACAGGCAGTGAAGCAGGTCTGCAGGTGTCTGTCTTTCTCTCCCCT
CCTCTGTCTTCCCCATTTCTATTGATTTCTCTCTGTCCTATCCAACTATAGCAGTAGCAA
CAATAACAACAAGGGCAACAAAAATAGGGAAAAAAAAAAAAAAAAAGGCCTCCCAGGAGC
AGTGGATTTGTGACGGCACTGAGCTCCAGTGATAACCCTTGGAGGCAAAAAAAAATCTAA
AGGTGGCTGTCTTCGGCAGTGATGTGAACACGTTTTCATTATATCCAGAATGCCCCTAAT
AACCTTTACGTTTATGATGCATTTCCTTCTTTCAGACAAGTTGTTCCGGAGTTTTACATT
CAGGTGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACCTG
TGCTTTTTAAACTTGGCATTTGTAACTGAGTGAGACGCTTTTTTCCTTTTTTAGATTTAA
GATTTGTTTACTTTGTAAGCGAGGATAGATAGGAAGGAGAGGGAGGGCGGGCCCAGAACA
TCATCCTGGTGTATATGGTGCAGGGGACTAAACTTGGCACCTCATGCCTACAAGTCCAGC
ACTGTCCCCACTGCGACTCCCTCCCTCTCCAGTTCCACATTTCATGGCTTTGACTGTTAG
AATTGATGCTTTAATGACGTCTGATCTGTATTTGAGGGAGGGGATTCAACAGTTGCTAGA
CGTTTATTCTTCTAGAACGAAGTAGAGCGAATGTATGTTGCACTAATTCAGCAAGATTTG
AGAGAACAAGTTAATAACTGAAACAGTTGTCAGAATTATGGTTAACTTTTTCTAGGCTGA
GTGCTATCTATGGAGGAACCTACATGCTGAATAAACCAATTGAAGAAATTATTGTGGAAA
ATGGAAAAGTTATTGGTGTAAAATCTGAGGGCGAGGTAAGTAGCTTGTAGTTTATACAAA
CACTGTGTGTGTGCGCGCACAATTTGTTACCCAGAATGCATTGCTCAGTGGCTGCTGCAA
GATTTCATGCTGACTCAGTTCGGGGCTCTGGACAGTTGCTGTGTTCTGAGTGAAGACCTC
TGAGAGGGTGTCTGTCACGTGCGTGACTCTTGCTTACATCTAGTTGCCTCTCTTTTAATT
GCCACCAGTGTTATAGCTGGGGCTAGTTAGAGACCCAGTGGCCATATTTTCCCTTTATTA
CTCCTTCACTCTTTTACAGGACAGATACCGAGAGGGGAGTGGAAAATAAACGCTTGCAGT
ACTTGCTTCACTGCTTGTGAAGCTTCCCACCCTGCAGGTGGGGAGCAGGGGCTTGAACCT
GGGTCCTTGTGCCTGGTTACATGTGCCCCACCGCCCAGCCCCTATTGAGCCTTTTTCTAC
CACTTTGTAACTTACTGTAATTGGACTTGATGATACTGGTTATTTCATTACTATTAACAT
ATAATGACGGCTAACATTACTTACTGTTGATTTGGGTTCTAGCTAATGGAGCCTGGCCAG
GTCGAGTTTTTTCCATTTGAACTGTTAAGTCATGTTTTTTTTTTTTTTTTTAATCTTCAT
TGATTTTGAATAGAGACAGAGAGAAATTGTGAGGGGAGGGGGAATAGTGCAGAAGAGAGA
CAGAAAGAAACCTGCAGACCTGCTTCACCACTTACTTGTGAAGCTTTTCCCCCAGTGGGG
ACCAGGGACTTGAACCTGGGATCCTTGTGCACTGGAATGTGTGTGCTTTAACCAGGTGGG
CCACCGCCTGGCCCCCAAGAAGTCATTTCTTGTGGAGTCTGGGTGGCGAGTGCATGCATT
GCCATGCTCAAGTCCCCACTCTCCATTCCAGGAGCCGGGGAACGTGAGCAGCGAAGCAGG
TCTTATCTTTCCCTCTCCCTCTGTATCTCCCTCCACCCCCGGTTTTCTCTCTGTCCTGTG
AAGTAAAATAGAAAAAAATTAAAAAGGAAAAAAATGGCCAGTGATGGAGTTGGGCAGTAA
CACAGTGGGTTAAGCAGACGTGGCGCCAAGTACAATAACCGGCGTAAGGATCCCAGTTCG
AGCCCCTGGCCCTCCACCTGCAGGGGAGTCGCTTCACAGGCGGTGAAGCAGGTCTGCAGG
TGTCTCTTTCTCTCCCCGTTTTCCCCTTCTCTCCATTTCTCTGTGTCCTAACAATGACAA
CATCAATAACAATAAAAAACAAGAACAAAAGGGAAAATAATGTATTAAAAAAACACCAGT
GAGTGGTGGATCGATCACTTGAGCCCGTTATATCCCCAGGGCACCTAACAAAAGCGTAAA
AGGCAGTCACTTCTCGTCAGTGTGTTCTCAGATCGACACTATTTCATGAACTAGCACCCC
ACATGCTGAGTAGTGATCTTAACCTGAGTAGTGGGTTAATAGCAGAGATCGCAGTCTCAG
CACTGAGGTGAGTCTCAGGTGCTTAAATCTTCCTCACAGATTGCTCGCTGCAAGCAGCTC
ATCTGCGACCCCAGCTACGTCAAAGACCGGGTGGAGAAGGTGGGCCAGGTGATCAGAGTC
ATCTGCGTCCTCAGCCATCCCATCAAGAACACCAACGATGCCAACTCCTGCCAGATCATC
ATTCCACAGAACCAAGTCAATCGGAAGTCAGGTGAGCTTCGAAGATGGGGTAGATGTTTT
AGAGAGGGACCCAGATAATCTCTCAGGTGCCTCTGGGTAGAGGGCTTGCTGAGTGTTATC
TCTGCTCGGAACTGTGTTGTAACTTCAGTGGCAACAGACAGGCTGCGGGATTATGAGTCC
TTCATGCTACCTCAAGAAATGTGGATTTTTCAGGTCGAGGCACCAATGTCTTATAAGCTG
TTTCTTGGTCCATGCTTTTCCAAATTCAGGGCTCTGCACAGAGACCCTAGAGCGTTTTTT
TTTTTTTTTTTTTTTCTTTTTTCCCTAAAGCACTGTTTAGCTTAGGCTAAGTAGAGGATT
GAACCTGGGACCTTGAAGACCCAGACATGAAAGTCTTTGTAACCATTATGTTATCACCCC
TCACCCCCTCCCCCAGCAAATATTTGCCTCCTTTGACTGCCTCTCCATAGAATTTAAAAT
TGAGAAAAGCCTGTGTATTCCAAGTAATTCTTTTCACATCTCACCCAACATGGGGAAAAC
CTGTGTGAGGTGCTCAGGCTGACACTGGGCAGTGAGTGGGCATTCCTTCTCTCCAGACAT
CTACGTCTGCATGATCTCCTCTGCACACAATGTCGCCGCCCAAGGGAAGTACATCGCCAT
AGTCAGCACAACTGTGGAGACCAAGGAGCCTGAGAGAGAGATCAGACCAGCTCTGGAGCT
CTTGGAACCTATCGAACAGAAGTGAGTGGCCGTGGCTTGCACCAGTGAACACACAGACGA
AGGCCTTCGGCTTGCTCCATGGTGGGAGGAGTCTGAGGATAAGTTCCTGCTGTGTCTGTT
GTTTCTGCCTGTGCCTCCGTTGGGTTTTGAGTTTTGGGCAGAGCTGTGAGTGGCTGTGAG
GTCAACCAACCTCATGACTCAATTCTGTCTCCTTTCAGATTTGTTAGCATCAGTGACCTC
CTCGTACCAAAGGATCTGGGCAAAGAAAGTCAGGTGAGTTTGGCTCCGAGAAAGGGACGT
GGCAGACTTACTGGGGACAGCCCTAACCAGCCGTCTCCGTCCTTCTCTCTCCAGATCTTT
ATTTCTCGTGCATACGATGCCACAACTCACTTTGAGACAACCTGCGACGACATTAAAGAC
ATCTATAAGAGGATGACAGGATCAGAGTTTGACTTTGAGGAAATGAAGCGCAAGAAAAAC
GACATCTATGGGGAAGACTAACGGCAGTACGCGCTCCTAGCTAGTTAGGACACGTTTATA
ATTTGGCAAATGATGCATATTACACAAGAGCAATATTGTAAGGCCTGCTTTTGTAACCAG
AACTGAGATCAGAGCACTGTACCAGAAATACTGCTCCCCTTTCTAATATCATGTATTAAC
TTTTTCCATGGAAAAAAGTGGCTGTTCAGAGTTGGCAGGTTACCACATTCTGTTCAACTT
GACCTTAATTTGCTTTTCTTTTTCTAGTGAAAGATCAGTTTAAAAAACATACTGATGCAA
GGAACTCGATACAGTGTTTGTATCTTTTAATCGGCGTAACCTTTGCAATTATGTGCTTAG
CTGCTCAAGAACCGGCCATGTCATCTCTCCTTGACATCAGGGAGCTTTGAATTGAATATC
CACGGTTTGGGAGAGCATCCCTTTACCTTTGTGTTTTGTGTCCTGTCAAGTATGCTGGTA
GAGCCCACACGGCACAGCCATACTTTGGTTCACGTGGGCCTAAAATCCTAATCAAACTGG
ACTGTTGAGTCATTTTGGAGGGTCTGTGTGCGGTGTTTTAACCTAGTAACACTGGGGGAG
GAAAATTACAAAGCAGGTAAAATGTAGAAGCTTCTTTTGTATCCCAGGTGTGGCTTCTTC
AATGGACCAAGCTGCCATGCAGTATTGATTTGACAGGGCCTCTACTCTAATGATGTCTGT
CTCAAAAATGGCTCCAAATGATTTCTGTACTGCAAAATAAAGCCAAACTTGAAACCAGTT
CCCTCCAACTAATCTGTTGTTTAATAAGAGCTTGTGAGTATTGTGCTGGCCATGACACAA
CCGCCCATTTCCTTCAGTAGAGCGGAGACCAAGAAACCACCAAGGGCACGTGACAGCAGT
GAAGATGGAAAACAGTCCCTCATCAGGCTTCCTGGAAGTAGACCCCGTTACATTCACGTG
TGATTATCAGAATTCCTTTTGAGTGGGAGACACGCCTCGTGTCTGGTTCTGTGTTCAGAG
A
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 2517..2616, 3379..3513, 3614..3812, 3913..4044, 4145..4244, 8499..8670, 9236..9380, 9578..9632, 9714..9860
1001..1108, 2517..2616, 3379..3513, 3614..3812, 3913..4044, 4145..4244, 8499..8670, 9236..9380, 9578..9632, 9714..9857
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved