Erinaceus_europaeus Locus DNMT3B
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus DNMT3B
Erinaceus_europaeus
DNMT3B
GeneScaffold_1086
SNORA3
4672..4798
24668
ACCCTGGGATATTCAGGCTTATGTATAACTAACTTTGATCTCACAATATGATTGAACTT
GGAGACAGTCCCACTGTATTAGGTTACTCTTTCTGTAAAATTGTCCTACCCTCATTAAGA
GGAGGGCTATAAGGTTATAGGACAGGGCCATGTGGAGAGTTGCAGAGAATCTGCATCCAT
CAGCAAAGACTTGGCTCAGTAATAGCTACCAGGAAGGACAGCATTGGGGTGTGTGTCAAG
GGACCCATGAGGCTGGAGCATAACCCTTGGTAACTGCCCCTAGTCCTTGCTCATTGCTGT
CTTCATCCATTCCCTTCTTGGGAACTTGGGACTCTGAGCCTCAGCTGGTGAGGGAGGAGG
GAGTGAGTGATGGGCTAGCAGACCAATAGGCCCTGGAGGATGGTGTGGGGTGGGGCTTGT
GCTGCCATGGAGAAGAGAAGCTTGATCTGTGGGGGAGGAGGGGGCGGTGGGAAGAGGACC
TAGAGATTGAGGGGAAGGGAGAGCAAACAAAGGGGTCAGGAGGGAAAATAATGCCTTGGC
TTCCTGAGGCCCTGCGGAGTCTGGGCAGGGAGAGCTGACCAGGGGCAGAGGGGACCAGAC
CAAGGCTGGCTGCAGGAAGGCTGAGGCAGGCGGATCCTAAATGGCATTGTTTGAAGTGGC
CAGCTAATTGCACAGAGCAGCCCAGAGCAGTCCCGAAGAGTCTCAACCCTGGGCCTAGCC
CCCTCTTCTGTCCTCTGTCTGGGTCCTGGTGCTGAGCCTTTGGGCAGTCTGGCCACATGG
AACCAAGTCCAGAGCCTCCGTGTTTGGTGAGGGGCAGACTATTGGTGGTGGGGGGCAATC
CTGGGAGGAGGGGTTGGTGGGCAGGAGTATTACTCCCCCAGATATGCCCTATGACGGAGG
ACATAGTCACTGGGGGGTCTTGGGGTGTGCTTGTCCTCCCTTGCCCTTGCTCCCCTGCTG
CTCTTGCTCCCCTACCCATTCTGGCCCTCCCACAGGAAACAATGAAGGGAGACACCAGAC
CTCTCAACGGAGAGGAGGATGCCAGTGGGAGGGAAGACTCCATCACCAATGGGGCCTGCA
GTGACCAGTCCTCTGACTCCAAGGATGCCCTCTCACCCCCAGTCCTGGAGGCCATCAGCA
CCCCAGAGATCAGAGGTGCTGGGCATGTGGGAAGGGGAGGGGTGGAGGTGGGGTCGGCAG
GCCTGCAGGCCACAGCAGGGCATGAACCTTCTGTTATGCTATAGGCAAGTTTGGGACACT
AGGTTTCATCACTGACCACTTGCCAACCCTCAAGACACAGGGGAGTGGAAGGAGGTAGAC
ATACTAACTACCCTCTAATCTCACCTGGGAGTCTGGGCAGGGGAATCCAAGCTGACTTTA
TACTTTGCAATTATGATGGGCTGATAATATCCCTGGGAGGGGACTTCTATCCTTCTGACC
GTGGGACCCCTCCCCCAGAATTGAGGGGAAATGGGGGTGAGGCTGCTTCTGTTTCTTTCT
GCCTCTTCTGTGTTAGTGCTGGTGCCAGCACTACAAATCCACTGCTCCTGAGGCTATTTT
TCCCATTCTGTTGCTCTTGTTGTGGTTGTTATTGTTATAGCTATTGTTGGACAAGACAGA
AATTGAAAGGAGGGGAGAAAGACACCTGCAGACTTGCTTCACTGCTTGTGAAGCAACCCC
CCCCCTGCAGTTGGGGAGCTGGTTGCTCAACCAGGATCCTTATGTCAGTCCTTAATGCTT
TGCGCCATGTGCCCTACCACCTGGCCCCCACTGCTTCCATTTCTAATTACATCACCTGAG
ATTCTTTGCCATTGAGATTTTTCTGACTCAGCTGGCTTCACAACTGTTTTTGTCCCCATC
CTGTTAAACTCTTCCAGAGCCTTGCTGTCAAATAGAACTTTCTATGAACTTGAAAATGTT
TAACTTCTGCATTGTTCACCACAAATAGCCATTTGAAATGTGTCTGACAGGCACTGGATT
GCTCACTTAAGTGAGCACTGCCTGAGTTGGGCAGCACAGTGACCTCTTGTAATTAATACT
GAGGTATTGTTCTGAGAGGATGCCAGTGGGTTTGGAGGACATGACATACTGATCCTGCCT
CAGCATCAAATTTCTCTCCTGCACAGGCCGAAGATCCAGTTCTCGGCTGTCCAAGAGGGA
GGTCTCCAGTCTGCTAAGTTATACTCAGGTATTGCTTTCCATCCTCCCAGTCAGGGCTGA
GGATTTCCTTCTGCTTTATTAATTGGGGAGCCCAAGATCACCTAAACTGGTATTCAGCAA
GTCCTTGTAGACTGACAGATTTGGAGCACTGCTAGGTACAGCTCTGAGCAGCCTCACTTA
GGGTATTATTTATTATACTTCCTTTAAATTATGCAGTTTTTACTATATGCTTTCTACTTA
TTTTTTCCTTAATCCATTTTTTCCTTAATCTGAATGATCAAATTGACTTCAAAATGATGC
AAAAAACAAAAAAACCTGATCTTTCATTACTAGAATGACTCCAGTATGGCCATGGGATGT
TTTGATTGTGATCTTTTATTTCTTGTACTATGTCTGTTTTGATTTCATTTTTAATATTTA
TTTATTCCCTTTTGTTCTTGTTTTTATTGTTGTAGTTATTATTATTAGTGATGTCATCGT
TGTTGGAAAAGACAGAGAAATGGAGAGAGGAGGAGAAGACAAAAAGGGGGAGAGAAAGAT
AGACACCTGCAGACCTGCTTCACCGATTGTGAAGTGAATCCCATGCAGGTGGGGAGTCAG
TATCAAACCAGGATTCTTATTTTTTATCAGAACATTGTTCAGTTCTGGCCTATGGTGGAG
CAGGATTGAACCTGGGACATTAGAGTCTCAGGCATGAGAGTCTTTGCGTAACCATTATGC
TATATACCTTCCCTCCGGCTCTACTGCCCAACTCCCCCCACCCCCTTTTTTTTTTTTAAG
AATATTTTATTCTTAAAAGAGATATGAGGAAAGAGTACCAGGCATCACTCTGGTACATGT
GCTGCTGGGGATCAAACTCAGGACCTCATAGTTAAAGATACAATGCTTTTAATCCATTGT
GCCACCTCCCAGACAACTATAGTATCAGTTTCGATTAGATAAATTAAAATTAGCTTCTTT
TTTTTTTTTTTTCTTTCCTACCAGGGTTACTTCTGGGTCTCTTGCCTGCACTACAATGCA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGAGCTTAACTCTGGCCATTGTGCAGGGGGTTAGGTGCACTTAAACCAGG
TATAGCAGAGTCTGCCTTGCTCCCTTAAATTACGTCTTTTTATTCCTGACACTACTTGTA
TATTCTGGTTTCATGAGACTTATACTAGAATTTTATTTGATGGGTTACTTTGATACATGG
TGAGATTTGAACCTAGACCTGGCACTTGGTACATGCTTGAATTATAAATAATCTCTGACC
CCTGTTCTATTTTAACAGTACTATCATTACTTCACTGTCAGACTCTGGGTCTAAATTATT
TTGATGCTGCTACCTCTTAGTAATTTTAAAATTCATAATTCATTTGTGCAGGATCTTACT
GGTGATGGAGATGATGAGGAAGATGAAGGCTCTGATATGCCAATGCCAAAACTCTTCCGT
GAAACCAGGACTCGTTCTGAAAGCCCAGCTGTAAGTTACTTCCCTGAGTTAAAGCACTAA
CACAGAGGTTTGCACAAAGGAAAAAGAATTAAAAAATACATAACTAAGGGAAGTGTTACT
CAACTGCATTTTTTTTTACCATAGCATTACTCAGCTCTGCCTTATGGTTGTGTAGGGGAT
GGAACCTGGGACTGTAGAGCCTCAGGCATGAGAGTCTGTTAGCATAGCCATTATGCTATC
TACCCCTGTCCCCATGCAGAGGAACCCAAGTTTGAACATCAAACTCCCATATAGAAGCAA
CTTGGAAAGGGATGCTTCAGTATAGGTAGGGGATGCTATTTTTACCCTTAAGAAAAAAAA
AGCCTACCTCCCCAGCCAGCATGTGGAGAATGGCTGATACCCTATCAGCTTCAGAAACCA
GAGGTATCTATTCTGCTCCCAGATTGACAGTAGCTGGTGATTGTAAGACGTCATGTGACA
GTACACTATGTCCAGCCCTGCCTTGGGTGCTGAATGCAGGCTACTTAACATCTGGGGCAC
TGGAGTTGTCCAGTTCATAATCCTGACAAAAGCACTTAAGTTTTTTGTTTTTTTTTTTCT
CTCCTGTGGTTAGGGGGATGACTGAACCTGGGACTTTGAGCTTCAGGCACAAAAGTTTTT
AACATGACTGTTATTCTGTCTACACTTACCAGAAGCACATTTTATTATTTGCTATACTGG
GAGGGGGTCTGAGAGTAGATAGCTTAGTGGTTATACATGGAGGCTTCTATGCCTGAGGCT
CTGTCAGTCCCAGGTTCAGTCCCCCAAACCACCATAAGCCAGAGCTGAGCAGTGGTCTGT
TAAATATATATAGTTAGGGGGAGAGAAAACAAGATACTTGCAGCACTGCTTCAGCACTTG
GTCCTTGTAGTTACTTGTAGGTAGGAACATAGGGTTTAAATCCAGGATCATTTACGAGGC
TAGAGTCTTGCCTGGGCATGGCGTTGTCCGGGTGTGCTGGAGTCCTCGGAGAGCAGCCAC
TGGCCTTATTCGCTGGCTGTGGCCGTGTGGCCTGGCTGGTCACCAGGCCAGGAACAGGTG
GGCAGGAAAAAAAGATCCAGGATCATTGCTCAGCCAGATGTGCCACTTGATTATCAAAAG
TACTTTCTATTTACTGCACTGCTCAGATTTGGCTTATTTTAGTGTATAAGCATTACACTA
TCTCCCTTGTTCTAGTCTCAAGCTCTTATATGCAGGATTTGAACACAAGCCTGGAAACAA
TGCCATTTTGAGAAAGAGGATTGATTGATATTCCAGTTCCTTTCTGAAGTTAACTGAGTA
GTTTTGCCTCCAATTGTTTGAGTAAATTGACTTTCTTTTTACTTTGTTTTATAGATTATA
ACCAGAGCATTACTGATACATGCAGTGTTGGATTGCACTTGGGACCTCATGCTTGCAAGG
CTGTTGCCCTACATGCTGTGCAACCATTCTGAATCCTGTATTTTTTCCTAATCCATTTTG
TGACAGGCTGTGGATTGTCATACAGCCCTGTCATTAACACTCCTTTTGCCCCATTCACTT
GGGATTTGGGCTGAACTTTTCAGTACAGACACCCATGTTCCTCCATTTAACTACCTCTTT
TGCTTCTCTTGACCTAAGGGTGCCTCTCAAGCACAATTCTCTTGGATCCCTGCAGAAGAC
CGGATGCCACCATTAACCAAAGACCCTGTGCTGATCCTCTCTTGCTTCTAGGTCCGACCT
CGAAATAACAACAGCCAGGAGAGGCACAGGCCCTCCGCACGTTCTACCCGAGGCCGGCAG
GGCCGCAGTCAATCAGAAGAGTCCCCAGTGATGTTCTCCAGTACCAGGGTTGGTTCCCTA
GATGCTCTGATCCATGCTCCAGGGCTCTGCGTGGTGTCGCAAGATCTGCCTCTCATCGCT
CTCTGCCTCAGTGAAAGGGGCTGGTGTCTAACCTTCTTTTCTCCAACCTACTCTGTTCAG
AGTTTTGCCTTTCATTTCTCTCATGGGTGTTGGACAAACCTCCAGCCTGGTGAATTTCCC
CTCTTGGTCCTGTTTTAGATGGAACTATGGTGGAATGCAGGAACTGCATTTCCTATTAAC
TGGGTTCTCTCCTTTCCTCAGAATGGGCTCAAAACCACTGACTCCAGAGCTATCTTGTCT
CCCTACTGTCTTTACTCTCAATGATGTAACCCCAAGGTCGCAGCAACTCCACTCCTGTTG
CAAAGCTGGGCACATCACACAGTAAGCACTTAAGGAAACCAGTGGCCTCTTAGCCCTCGG
GCCTTCTCAGCACTACTCTTCATTATTGTCTTTGTCTTGTTTGGACTTTCCTCCTTGTTT
TTGGAAACCCATCCTTGGTGTGCTCTGTTCTGTTTTAACTCAGTTCTTGGGAAGCAATGG
GGGTCCTTAACCACTGGCAACACACTTCTCTTGCACTGAGCTTAAGATGTGTGCCTTTCT
GTTTGCAGTCTCTGCGCCGGCGGGCAAGCACACCATGGCCTTCTCCTTCCAGCCCCTACC
TCACAATTGACCTCACAAATGATGATGTGGTGTCACCACCAAGCAGCAGCACCCCTTGCC
AGACCCAGGACAGCCAGCAGGAGAGCCTGGAGTGCCCACAGGTGGAGGAGGGCAAAGATG
CCGACAGTACTGAATATCAGGTACCTCACAGAGGGCTATATAAGATTACTCAGAGGTGAC
TGTATAAAATTTGACTGTAGTAGTAATAGTGAGTTCATTCTCCATGTCCATTTTGCATTT
CCATGATAACAGCCCTTCCTTTACCCTGACAAAACTCATTTCTCATAACATATTAAGGAA
CACAGAAACTTACATTGTGAAATTTTTTTTTCTTAAAATATTTATTTATTTTCCCTTTTG
TTGCCCTTGTTTTATTGTCCTTGTCAGATAGGACAGAGAAATGAAGAAGGGGAAGACAGG
AAGGTTTGAACCTGGGACTCCTGTCCTTGGCGCTTTGCACCATGCGCTTAACCCGCTGCG
CTACCGCCCAACTCCTGGGTCTTGCCTTTTTTTTTTTTAAATACACATGACATTTTTTAT
TTATTTTTATGAGAAAGTTAGGAGAAAGAACCAGACATCACTCTGGCACATTTGAGTCCA
AAGCTTTACCACTGCACCACCTCCCGGACCACAGGTCTTGCCTTTTTAAAACCAGAGCAA
TGCTCAGTTCTGAGTTATTGGTGCCTGGGATTGAATATGGAAACCCAGAGCCACAGGCAT
GAAAATTTATTTGCATAACCCTTATTCTGTCTTCCCAGCTCTGCACAGTCTTGGGTTCAT
GTGGTTTCTCTTCCAGGATGGGAAGGAGTTTGGAATTGGAGACCTTGTGTGGGGAAAGAT
CAAGGGCTTCTCCTGGTGGCCTGCCATGGTGGTATCCTGGAAATCCACATCCAAGCGACA
GGCCATGACTGGGATGCGGTGGGTCCAGTGGTTTGGTGATGGCAAATTCTCTGAGGTAAG
TTGGCTAAGAGGGAGAGGATTAGCCAAAGCATCATTCTGGCATATGTGGTAGTATCTCTG
CTATTTTCTTTTTTTTTTTACCAGAACACTGCTCAGCTCTGTTTTATGGGGTGTAGGGGA
AGTGAGAGTTAGAGATGTATGGTGCATGCTCTGCTAGAAGTTGATCTCAGGACCTCCTAC
TTGGGAAGCCCATGCCTTAACCTCTGCACCACCCTCCCCAGAACTACACTGATGGTTCAT
TCCTCAGTATAGTTTATGTAAGGATTACGCCAGCTGTGCATGGTGCATGCAATGTTAGTG
ACTGAAAAACTACAAAGGCAGAGGCAGGCTGTGAGTATGGATCGGCCTGTCAACGCCCAT
ATTCAGTGGAGAAACAATTACAGAAGCCAGACCTTTCACCTCCTGCACCCCCACAAAGAC
CTTAGGGCCATACTTCCAAAGGGATAAAGAATAGGAAAGCTATCAGGGTAAAGGGATGGG
ATACGGAGATCTGGTGGTGGGAATTGTGTGGAGTTGTACCCCTCCTATCCTATGGTTTTG
TCAGTGCTTCCTTTTTATAAATAAAATAAAAAAAAGAAAAACATAGTACCTGTGAGGGCC
TAGCAAATTAAATCTTTTTTTTCAAATTATATATATGTATATATTTATTTATATAAAAAG
ACCAATAGCAGTATGTTATGCATCAATAGCAGCCAACAGCTTTTCCAGGTTCTGCAGTCA
TCTGAACAAAATTAGACATCCAGCACACTCCATTTAAAGAGAGAGTGAGAGAGAATGAGA
GAGAAAGAGATTGGGGGGGGGAATCCCAGAAAAGAGCAAAGTTGTGTTACTGTTGTGGTA
CCTGGCACCATTAAAGAAAAAAAGTCTTCTCAGCAAATTAAATCTTGAAGTACTGTTGAA
GTAAGTTTTGTGCTGTGGTTTCTTTATCAGAAAAGTCATGAAGCAGTGGAAGCCAAGTAT
ATTTGTGGAATTTGATTTACAATTGAAGTTTTAGGTTTTCCTGTATGTTATGTATCATTT
GGTCCATTTATCATAGATACTGAATTTCCCAGTGGGTGTAGTAAGTGACTGGAGGGAGTT
TTCATGTAGATTATCTCTTGCCAGCAGAGGGAGCAGGGAATGGGCACCTGAAACATACAT
TGTATTACCAGCTGTCTAGGCCAGTAGCTTTATTGTTGGGAAAATTCATTTATTGCCACA
TCATCGTGAGATAAGAAATGGTCCTTGTGGAGAGACAGGGCATCTGAGTGGGTTAAACTC
AAACTGTGCAAGGCGAATTCTTTCAAGGATCCATCCCAGTTCCAGCCCCCTGGTTCTGGT
TCAAGTCTCCTGGTCCCCACCCAACTGGGTTGCTTCACAAGCTATGAAGCATATCTGCAG
GTATTTTTTTTTCTTTCTCTTTGTCTTCCCCATCTCTCAATTTCTCTCCCATCACAATTT
CTATGTCCTATCCAACAGCAATAGCAACAACAACAGTAACAACAATGCAAAAAAGATGTT
ACTCAGCCACAGTGATCACCCTGAAGGCAATAAAAAAAAAGCCTTAAGACTAGACCAGAT
GCTAATAAGATGGAAGTGTGACTCTTAGCTTGATGGGATATAATTATAATGGGGGACTGT
TACACTTTCATCTCCATAAACAACTATGTTCTGAAATTTAAAAAAAAGTTTTTTATTTAC
TAATAGAACACAAACAAACATCACTATGGTACATGTGCTGCCCGGCATTGAACTTAGGAC
CTCATGCTTGAGAGTCTAGTGCCTTAGCCACTGCGCCACCTCTCTGATCCCAAATGTCCT
GAATTTTTTATAAGTGGTGTCAATACTGATCTTGGGATAGGTCAGGAATAGAGTTGCCAA
TTTATTTACTCAGGAAGATGTTACATGGGAGAAAGCCAGACACACTCTGGTAACATGCTG
CCAGAGACTGAATTCAGGCCCTCATATTTGAGATTCCAATGTCTTACCCACTGTGCCACC
TCCCAGACCTTAAGCTGCAAATAATGTATATTAAATAAATGCAAGTTGTAGACAATGACG
TCTTCATGCATGGCCTGTTGACTTGGGTGTAGAATTGTATGTACCTATGCTCTATGAAAA
TCAAGTAGTAAAAAAAATTTGCTCTTAGCCAAGCAGTTTTCTAAAGATGTTCAGTTGCTA
AAAGACTGAATAGTAATCACAGCATGTGCCTATTATCCGCCCAGTACTAAGTGACTTGTC
CGGATACAGGGTTACATTGTGCTATAGAGCAGTTCCACTTTCTGCTCTTAGGGAATCTTA
AGTTATAAGATGTTGATGATGCCATTCTCTTCTAGGTTTCTGCGGATAAGCTGGTTGCTT
TGGGACTATTCAGCCAGCACTTTAACATGGCAACATACAATAAACTTGTCTCCTATAGGA
AGGCCATGTACCATGCACTGGAGGTAATGGAGTGGGTGGAGAGGGTCTAGCCTGGATAAT
GCTGTCAGTCCACATAGCAGCCCAGAGTAAGGGGTGAGGGAACAGGCAATTAAAGAGGTG
GTGAGAGTTCATATAACTTCTATGAATGCCATCGGTAGCTTTTTTTCCCCTTCCCTCCTG
CTGCCCTTACTTTTCACTGAGTGACTGTCAGACTATAGGCTGAATTGGGAAGAAATATTT
GAATGAGAAGCATATTCCTTATAACAGTTCAAGGCCAAAGCTGGACAGCGGCTGAGGTCA
GTTTCCTCCTGGGTATAGTTCTATGCTATCATGGAGGAGTGTCCTTGACAGTAGGAAAGG
TCACTGGACTCTGTTAAGCTCTTTGCTAAATCAGAAATGTTTCCAATATAAAATATTTTA
CACTTTCATCTACAATGGAGAATAAAAAATGAGGTGGTTTCAGGCTTGGGTAGATAGCAT
AATTATACAAACATACTCATGCCATAACACCATAAGCCAAAGCTGAGCAGTGCTTTCTTA
AAAATAAATAGAAAAGAAATATGCTTTCTGAGAAGTTCTGACTGATCCCAAAGGTTGCGG
AGCTAATCTCCCCTCTGATTAAGAGCTGACCATCTTCCCTTCAAGGAGAAAATCTCATTT
GGGGTGCCTATATGAGAATTCTTCACACCCCATCTATACCCACTGGCCTCCTAGCCATCT
GCACAGGCCTTACATACCACAGACCAGGACAGCTGCCTGCTATGAAAGGGCCAAGTGGAA
AAGGGATTTCAGCCCTCAGCTGTGGCCTAGCCAGCATCCACCACCAGCATCACCACAAAC
TTGCCTTTTGTCTTTGCAGAAAGCCAGAGTACGGGCTGGCAAGACCTTCCCCAGAAGCCC
TGGTGACTCCTTAGACAACCAACTGAAGCCTATGCTGGAGTGGGCTCAAGGTGGCTTCAA
GCCTACCGGTGTTGAGGGCCTGAAACCCAACAACAAGCAACCAGGTATGAATGGGTGTCT
ATAACAGCACTCAATGCTGGCTGTGGGAACACGTATGCAAGATATTCCCATTGGAAAAAA
ATTGGGAAAGATTTTAAAAATATAAGTACAAATTAAGTACACATTACAGAGCACAAGGAC
CCAAGTTCAAGCCCCATTTGCAGGGAAAAAGTGTGAAGCAAGTGATAAAGCAAGGCTACA
GATGTCAGACTCTCCCTCTCTATATCTCTATCTAATAATAATGCTTAATAATGGCACCAA
TGCAACATTTTCTCCTTGATAACTGATAATGTCCCAAAAAGCTTAAATCCAGGCTTAAAA
TTTGTGTTTACAATTCATGCTTTTAACATGTTGTTCTGTTTTCTCCCCCCTTCCCAAAGT
TGTTAATAAGTCGAAGGTTCGTCGTTCAGGCAATGGGAAGTTAGAATCAAGGAAACACGG
TATTCCCTTCCAAACTTTTAACTGCACACTTTTCTTGGCACTTGAATTTCCTGGTCACTG
AAAAAGAATCAAATCTGTTCCACAGCCAACCTAAACTCTCCCCACCTTTCACTCACAGTG
GTCTTCAGGTTAACCTTGTTGGGTGTGCACATACTTCTAGTTTCTTCTACACACTAGTGG
GTTCTGATTTTCTCTTGATTTCCCCTAACAATGTGGTTTTTGTGATTAAGTTGTTGTGGT
TTATAATTGCTACATAATATCACTTCCTAGGACCAACATATCGCTTCACTGTGTCCCTGG
TTGATTGGATTTGTATATTAAAATTTATTTTATTAAATAAAATATTTATATTAATATTTA
TTAAATTTTATTTTATTTAATATATAAATAATATTTATATATTAAATAAATTTTGTATAT
TAAATAAAATTATATATAGACAGTATATAAATAAAACAAGTTAAATGTTAACAGTTAGCT
AGGAAAGCTCAGAGGTCCCAGGTTAAATCCCCTGGCCCACTCAGAAGTTAGAAATAAGGA
GTACTCTATAAAAAATTAATTAATTTAAAATAGTAATAATTAATCCCAGTATTTCAAACA
GTTTATTTTAGCACTTGAATCAACTGAATTTTAATAACATTTCCAAGAACTTGTAGATTT
AGCAATTAGATTTTACATAATGAATCATGTCAAATGTCCAGATTTTCTTCAATGAAGACC
TTGGCAGTTACAAATTTATAGTAAAAAATTAAATGTATGCCAGACATAGCTTCTAGGATG
AACACTCATCACCATTAGGCAGAACTCTGGACAGTGCTCTGATTAAAAATAAACACTCAA
AGTCATATTTCTTTTTTTTTTTTTAATTTTTCTTTTTTTTTTTTTAACTTTTTTTTTATT
TAAGAAAGGATTAATTAACAAAACCATAGGGTAGGAGGGGTACAACTCCACAATTCCCAC
CGCCCAATCTCCATATCCCACCCCCTCCCCCGATAGCTTTCCCATTCTCTATCCCTCTGG
GAGCATGGACCCAGGGTCATTGTGGGTTGCAGAAGGTAGAAGGTCTGGCTTCTGTAATTG
CTTCCCCGCTGAACATGGGCGTTGTCAAAGTCATATTTCAATTAAGCCACACGTGACACG
TTATCTGGCTTGTTGGACATCACAGGGCTTCTCTAATGATCTTTGAGCTGAATGTAGCCT
TCTGCATCCCACACTTTTTTGAAATCCTAGCAAACATGCTTTATATACATATAGTGGCTT
TCACATTCTGGTCCATGGTAAGACAATATGACAGCAGTATAGCCTTCTGGCGTGCCCAGA
TGTGTTCTTGTCTAAGGCTGCATTCGCCCAGCACTCTCCTCAGTTAGCTCCTTACTGTTT
ATAGATAACAAATCCCGGAGACGCACAGCTGATGACTCTGCCAACTCTGATTACTGCCCC
CCGCCCAAGCGCCTCAAGACAAATTGTTACAACAATGGCAAGGACAGAGAAGACCAGAGT
CGAGGTGATTGTGGGATTTTAGAGACTAGAGGGTTATTTCTGGCCAGTTATCAGGATCCA
GCAGATATTGGTACTCCCCAGTGCAGAATTGTAACCAATGTGCCAAGAAGCTCCCTGACT
CTCCCGAACCTCTTTCCTCAACAGAGCAAATGGCTTTGGATGTTGCCAACAACAAAAGCA
ATCTGGAAGGTAATGCTCTTTCCCTTGCCAGGCTTCCCTTGTATCCAGGCTAATTTGTGC
TCATCCTCACCCTTCCAGGGCTTGTTCTATTTTTTTAAGGTCAGGGACCCAAAGGCATCA
AAGTTGGTATATAGAAGGAATGGGTTTCTTTTTTCCAAATGACCCATTGAAGAAAGCAGC
AAGGATGTCTGGTACAAAATGACTTACAGGTCACCTTGATTAAGACAATTGAAAACATGG
TCAGGCTTTTCTAACTGGCAGACACTTCACCTGCCATTCTCTGAGACTAACTCCAGCAGA
CTCCGCAGTTTTAAGGTTGCTCATCCTGATGTGCTTTAATTTACAAATATTTATTGAGTG
ATTACTCAGTACTGGTCTGGGAAAGCAACAAATGTCACTTATGACCACAAAGAACATTTT
AAAAAGTTTGGACAATTCCTTGATCATCCCCAGGGGATGATGATGTTGTTCTTCTGATAA
CAACAAGCAAATTAGGCTCAACATGAATTCACTTGAAACCCAGGGGCCTTTGCTTGGTAC
TCACCCCCACCTCTTCTGTAATTGCCCAACTTTTGCCTGTACCACATTTAAAACTATCAA
CTTCACCTTTCCCAACCTCTGGGGGGTGGTTGAAGCATTGATGAAAGGAACAAAGCCTGA
GCATGGTGCACAAGGCATGGTGCCAGCAGAGAGTAGACCCCGGACCTGAGTTAGCCATGT
TGTGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAC
CAAGGGCAGTACCATGTCTCCCAGGGTTAGTTACTCAAGTTAAGATAGCTATACTGCTGG
TGCCATCTCTTCAGGGAAAGGCTGGCAAACAAGGCACCTGGTACTATTGTGCAACATCCC
TTTTCTCCTGTTGAGTACAGGTGCTTCTGTGTGGAATGCCTGGAGGTGCTAGTTGGCACT
GGCACAGCTGCAGAGGCCAAGCTACAGGAGCCCTGGAGCTGCTACATGTGCCTCCCTCAG
CGCTGTCATGGTATCCTGCGCCGCCGCAAAGATTGGAACATGCGTCTGCAGACCTTCTTT
ACCACTGACCCAGGAAGGGAATATGTAAGTCGTCTTTGCCCAGCAGTCCAGCCCCCACCT
ATCTTTGGGTGCTTGCCTATTGGCATGAATAATTAGTGACATTAATAAGCAAGCCTTTGA
GAACCTCAGACTCTTACAAGGTCTCTGACTTTTAGTGTTCCTTCCTCCCCAGCTCTTGGT
ATACACTATTACATAGATTTTCAATAGCCTTGACTAACAGATGGTTTAAAAATTATCACA
TTGTCCAAAGCATAGTGTAGGTGACAGGGCTCTGTTCTACATTGCATGGCTTACACAGTG
TATGCATGTCAGTGAACACCTGTAGTGTTCTTGTGTGGTCATGCCTGAGGCTAGCATAGC
CGTCCTGTGCCCACACGTTTGATGGGTGTCAGTGAGTTCCTCAGGAAGGTCACCTCCCAG
CCCCCAGAGGATAAGTCTTCCCTCTGCACTCATCTCTCTAACCTCCTTCTTTAACTTGGC
AGGATGCCCCCAAGTTGTTCCCTGCAATTCCTGCACCCCGGAGGCGACCCATTCGAGTTC
TGTCCCTGTTTGATGGGATTGCAACAGGTGAGATTGTTCACCCAGCAGTGTTCACCTCCC
AGGATTTCTGAACCCAGTGCTTGTTTGTCAATTGACATGTTAGGGATAGCCCTTTTTTTT
TGATGTCCTCATTGGAGAGGGGGGATGACAGGGAGAGAAAGATAGTCTGCCTGTATTATT
CTTACTTATTTTTATTTCTTAATATTTTTATCCCATTTTGTTGCCCTTGTTTTTCATTGT
TGTAGTTATTATTGCTGTTGTCATCCTTGTTGGATACAGGGAGAGAGAAATGGAAAAAGG
AGGGGAAGACAGGGGGAGTGAAAGATAGACACCTCCAGACATGCTTCACACCACTTGTGA
AGCAACTCCCCTGCAGGTGGGGAGCCAGGAGCTCAAACCTGGGTCCTTACTCCTTGCACT
TTGTGCCACCTGCGTTTAACCCACTGCGCTACTGCCCGACTCCCACATAAATATTTTTAA
TAAGTTAAAGTAACCCACAAAAGGTCTATGCTCTACTCATTTTTGAATACCCTGAAGTTC
TTAACCATGTTCTTCCCATGTGTCTTTGTCCATGTCGGTACACCTCTATCAGTTACTGCA
TCCATTCACATTTTCCTTGGGCTTGGTCCTTGCTGTGACCAGTGTGCTGTTTCCACATCC
TTGACAGCGATATTTGAGTGAATGAATCTAGTCCGTATATGAAGTAGATCTGGAAAACCT
AAACTGAATTGGATTTTCTGTCTCCTTGAACCACCTATAGGGTACCTGGTCCTCAAAGAA
CTGGGCTTCAAAGTGGAGAAGTATGTGGCCTCTGAAGTGTGTGAAGAGTCCATTGCTGTT
GGGACCGTGAAGCATGAGGGCAACATCAAATATGTGCATGATGTCAGGGATATCACCAGG
AAAGATGTTAGTCACAAGATGGGCTCCTGGGTGGGCTGCCACACTCTTGTCCCTGAGCCA
CACACCCTGACAGCCATGTGGGCCATTTCCCCATGTTTAAGAGTATGAAATTGTAGCACC
TGTGCTCACATGTAGTAAAATCCTGCATTAGAGGAAGGCTCTACAATGAGTAAGGCAAGG
CTGCAGACCTTTCTCCTTTACCCTTTTTAAAATCCAAAATAAATAAGGAGGTAAAGAAAA
AGACTAATGACTAATGGCTCAGCTCTGGCATAAAAGCAGAGATGGTCATTGAACCTGTGC
CCCTCAGTAGTGTCCCACCCCCCCTTTCATTATTTATTGTCCCTTTTGTTGCCCTTTTTA
TTGTTGTAGTTATTATTGTTGATGACATAGTTATATAGGACAGAGAAATGGAAAGAGGAG
GGGAAAGAAAAATAGACACCTTCACTGCCTGTGAAGTGATTCCCCTCCAGGTGGGGAACC
AGGGCTTATGCCTGTCCTTACCAAGTATGCTTACCCACTGCACTACCTTCCTATCCCACT
GCACTACCTTCTGATACCCTCCCGCCCCCCGCAATTCCTCTCTTAAGAATGACTCCCCCC
TCCTCAGATTGAAGACTGGGGCCCCTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGA
TCTTTCAAATGTGAACCCTGCCAGGAAGGGCCTGTATGGTGAGCATCCCTTCATTTTTAA
TGTACCCAAGCAAACCCATCATTTGAGTGCTGCTCTAGAAAGCTGTTGGCTTCTCACCAT
CCTTACCTGCTGGGTCTGTCCATATGCCATCATGATTTCTAACTCCCAGAGATATCTGTA
GACATTTCTTTAGTCATTGCCTAAAGTTATTCTAGGGGACTTGGGCTTTGAGGGGATATA
TGTTAAATAAGATGATGATCAAACAACTGGTGACTGAAAGAATGACTGACCCCCAACTCT
TTTCTCATCTCAGAGGGCACTGGCAGACTCTTTTTTGAATTTTACCACCTGCTGCATTAT
GCACGCCCCAAGGAGGGTGATGACAGGCCATTCTTCTGGATGTTTGAGAATGTGGTAGCT
ATGAAGGTCGATGACAAAAGGGACATCTGTCGTTTCTTGGAGGTAAGAGACAACTAGAAT
TTTTTAAAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCTG
CACTGTAATCTGGTGTGCCTCAGGCTGTGCTTCTCTCTAACCTGCCTGTCAGCCAGTTTT
GCCCCACCCTTAATTTGGAGTTTACACTTTCTTTGCAGCCGCCTCACTGAGAGAGCAGCC
TTGTCCAGCCAGCCTAAACCCCTGGCTTCTGACTCCCTTCTCTTTTGTGCCTGCAGTGCA
ATCCAGTCATGATCGATGCCATCAAAGTGTCTGCTGCTCACAGAGCCCGGTATTTCTGGG
GCAACCTGCCAGGAATGAACAGGTAACTGGGGGGGCCTCTGTGCAGACAGACAACTATGT
CAGATACAGAGCCATGTTCATGCCTTCTAGACAAGACTGAGAAAGGATCTCTGCCCAGGA
TTCACCCTAACCCTGAATATCTCAGGCAATAGTCTGTCAGTCTGACTTACACCACTGCAT
ATAGGCCTGGTTCTCACAGTGGTGTCTTCCCCAATCAGGGTCACTGAGGCTTTCACTTAC
CACCCCTACACCACCCCCAATCAATTTTAGTAAAGCAGTTCATAATCCTGGAACATGCAA
AATGAGGGATCAAATCTATAGTCTCATACTTCAAACAAAATGCTTATCCAGATCTACCTC
CCTGGCCTTGAAGTACTCTTTATCTCCCTACCACAAAGCCAGTCATGCTTGGGATCAACT
TTCCATGAATAAATGTCTGAACTAAAATGACAATTTTAGACTAAAGCCTGTGTCTCCCTC
CCCTTTCCAAACCAACAGCCTATCCCAACTTCTTATCAGCCCTTTCATGTTGAAAGCAGG
AGATATGGATGAGGATTAGTTATGTCTTATATGTGATTTCAAGAAGAACGTAATTAAGAC
AAAAATGCAGTGGTAATGTGATGCCCCAGATTTGCAAATAAGTGAACTTCAGAAACCATC
TTCAACTTTCAGACATTTAGCAAAGTGTGGGCAGAAGTGAGAAGGCAGTAGAATAGCTCA
GGGGCTGGATATCTTGCATTTTTATTGGGCTCATCAGCCAGTCAAATGGTGCAGTGTGTG
GAGTGAGATGGGCTCAGTGAGCCTGCACTTACTTAGTGCTTTCACTATATCGGTTTATTC
GTCCTGATTGGTTGGGGTGGATTTTCCTTGTGTGAGAACTGGAATACACAGTAAGTGATT
TCAGGGTCATGGTTGATGGGAGAAACCCTGGAAGCACTGAACAAATTAGTGGGAAGATTG
CTTCTATTCAAGGTCCCTAACTAAAGGAATGGATGAGGATAATTTCAAGAAATTAATATC
CTAGTGGAAGTGTAGAAGTAAGAAGCTACTTGCTGATTTGCTTTGAGAGAAGTAGTTGAA
GCTGAGTCACTGGTAAGGGCAGGGCAGAGAACTTAGAAGGAGGGTCATCCTGTGGGATTT
GCTGATCCCACAGCAGGTATAGGGAAAGTAGAATGAGTTTTGAAAGGTATAGCAAAAGGT
ATAGCAAAGGTATAGCAGACAGAAACAGTGACAAGGAGCTGTACTGTGCCATAGGAAGTA
CTTAGACCATCATTTACCCAGGAAATGATGCATATTCTGACACTGGATTTGCTGACACAG
TTACAATGAATGTGCGGTGAAAGGCTATGGAAAATTGGGGTACTAGCTCTAACTTGTGGG
ATTAATGGTTACAGCATCAGCCATAAGCCAAGTCTAGCTGTTAGGTGAAATATTTCAATT
TGTTTGAGTGCAGACATAGAATAAACCCACTGTAAGCACTGTAAGCTCAGCTCCATTGAG
TTCATGGAAGGCGTATGATCAGATCAGGGTGGCATATGACAGGGGACATAAGCAACAGAA
TATAGGTTGTGTGGTTCCCTAACCCCGTTTTGGTATGCAACATTTTCATGATTTCCATTT
AGCATTGAAATTATAGACTGGGCTTTGGTGATCATCAACTCTATGCTTTTAGACTTAATT
GCTTTTTCTGCTCTGCCACTGCTTAACTATTCCAGTCTCTGGAGTCTTTGCTTTTTCAGC
CATCTCTTTGTCTCTGCATTTCCAGGTTTCAAAGGCTACTTCTTTTGTGAACCACTGTCT
GTCCTACCTGCACCCAATTCTAGTGCTTAAATTAAAAACTCTGGGTCTGCATCCACAGAA
AGCAATCCGCCAAGGCATGGATTTTGCGTACTGACATTTGTTATTTGTGACATATCACAA
ATAACAAGTCCTACAGCTCAAGGTGGCATGACTTGCACAGTCACTATTTCATTAGTAAAC
AGTGGGAGAGTGAATAGAAGGAAGCACAAGAGGAGTTTCCAGTTTTCCGCATCCACCTTT
AAATCAGAACCTTTTCCTCCCCTTTTTCTATTTTCTTATTTTTGCCTCCAGGATTATCTG
GAGATTAGTGCCTGCACTACAAATCCACTGGTCCTGGCTGACATTTTTCCATTTTATTGG
ATAGGACAGAAATTGAGATAGGAAGAAGAGAGAGGGAGAAAGACACAGATCTCCAAAGCT
TGTGAAGCATCCCCACAGCAGGTGGTTAGCCTGGGGCTTGAACCAGATAGTTGCACTTGG
TACTAAGTGCGACTAACTGGGTGTGCCACTGCCCAAGCCACCTTTTTCATTTTTAAGTTT
CTGCTTAATAGTAGATGACTGTAACGTTAAATATTGTATAGTTCCATAACATATCCACCA
CCAAAGTTTTGTATCCCCATCCTATGGGAGAACCTAAGTAATAAAGTAGAGGTCTGTGGA
GCATTTGTTGGCAGGCATAGGCCTTCCCTCTACTTAAGGAATTGTCTATTCCTGACTCTT
AGCACACAGGCCTGTGACAGGGTATTTGTAGCTAACTCCCAGCCAAAGCACACTCTGTAA
CTATAGGCCCACACTCCCACATCGGGAGGTGCCTACCAAAAAGCCCCATTTATATTACTG
TAGAAAGTAATGGGTTTTGGCTGTTCCCAGGCCCGTGATAGCATCAAAGAATGATAAACT
CGAGCTGCAGGACTGCTTGGAATTCAATAGGACAGCAAAGGTAAGATGGTTGGTCTGTAC
CATGGCCTCCTGGGAAATGCACTTGGTGATTCCAAGCAAGGGTCCTGATCTTTGCTGTCC
AGTTTGTTCCTGTCCCTCCCTCACTTGACACCTTGGTGCTGGGTCTTTCACCCTTCATCT
TTATTTAAAAGTGCCTTGGTAGGGTGAGAGGCTTTTGATCATCACTGAGGAAACACAAAG
TGGATTGTGAATGCACATTCCATAGGGACTGTATATATCTCTGCTGTTCCTCTTAGTCTG
AAATCAACACTTATCTCCCCCCCCCCCCCCCAATTTTTAAGAAAAGGGTCTCAATTAAAA
TATGGGTAAATTACATTTACCGTCACAATAAACTACCCCTGTGATGATTTTTTTGGGAGG
GTAAAAAACTTAAATCTTTGATCAGCAACATTGGGGTCTGTCCTCACCCATGTGGTCCAC
TCTCGCTCAATGTGTTTTAAATCCTGAAGGTGAACCTTCCCATGGACTAACTTGGGGTCC
GGAGAAAGCAACCAGGCTCTAAAACTTCTCGCGTAACGTCTCCGGATCCTCCTAAGGCGG
TGGCCTTGCCCCTGCTTCTTTCCCCGAGACCTGTCCATTTCCATTATTTCCTAGGAAATC
TTATGTTCGCTTGAACCTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAGCTCAGCTTTTTTTGAATTTTTTTCATCTGGTGACCTTGCCCCATGTTTTCTTCCCCC
TTGCACGCTTCCCATTTCCATCTTTCCCGTAGGTAATTTCTGATTTGCCTCAGAACCTTT
CCTTACCGTGCTCACTCCATGATGTCATTTTGTTCTCCAGTTAAAGAAAGTACAGACAAT
AACCACCAAGTCGAACTCAATCAAACAGGGGAAAAACCAACTTTTCCCTGTTGTCATGAA
TGGCAAAGAAGATGTTTTGTGGTGCACTGAGATAGAAAGGTGAGCAAGGCTGCTGTGGTG
GAGAGGGAGTGAGCCAGTTGGGAAGAGCTGATCCCCGAGGCACACAAAGGGCAGATGCAC
TGGGGGTAACAGCTTTTCAGTAGCCATCCTGGGAGGAATGGCCAGTGAGTCTGGAGGTGG
AGAGGATTCTGAAACACAAACACATTACATAATGCCATCCTGCTGTTGTGCCTGTGTCAT
GCCCCAACATGCCTAGGAAGCAGCTGGGGGACGGCTAAAACTACTGACATGCCATTACTG
TTTCTCAGAAGGCTCCTTCTTCCAGGTTACTCCATTTTATAGATAGCTGATCCTTCTTTC
TCACAACCTGTCTTCTCCCTCTTCCATTTAGTTGGCAGTGCCTATGTTAATTTCAGGAGT
CTGCATATAGACTTCAGAGCTCTGGGTTTCGTTTTCATTTGTCTTTTTTTTTTATTGGAT
TATAAATTTGTATCTTTATTGGTTAGAAACAGCCAGAAATTGAGAGGGAAGGTGCTAGGG
AGAAACACCCGAAACACTGCTTTTACCACTCACAAAGCTATATTGAATTATCATGAACAT
TTTTCTTTTAAAAGATTTTATTTATTCATGAATGAGAAATAAGAACCAGACATCACATGA
GCTGCAGGGGACTGAATTTTAAGAGACCAATGCTTTATCCACTGAGCCACCTCCCTGACC
ACCCATAGATTATATTTTCACCCCAGATTTTGAGTTACCAGTAGTAACTTTTTAATTGGA
TTTTATTACTATTTTTTTTTGCCTCCAGTGGTATCACTGAGACTTGTGACTGCACTAAGA
ATGCACTGCTCCTGATGGCCATCTTTCCATTTTTTTATAGGATAGGCCAATGAGAAATAC
CTGCAGACCTGCTTCACCAATTTTGACGTCACCCCCACCCACTGCAGGTGGGGAACTGGG
GATTTAAACAGATCCTTGCCTATGGCAAGGAAGATGTTTTGTGATGCACTGAGATAGAAA
GGTGCCACTGTCTAACATCGCCACCACCCCCCCCATTAGTTTTCTTAGTTTCACTAATAT
CTGATTAGTGGAAGGAAACATGTAATCTTGCCCACACATACTCTGGATTAGTCTGGATTT
TGTGACTAAGGACTGTAATGCTCCGCCAGACATGTGACATGGTGCACATGGCTGGCATTA
AGCAGTTAATGAACACAATAGGTCCCAGGTTCTGGTGTTTATTATACTCTGCCATTGCCC
ACTGGATGATAAACCTTGGAATAAATGAGACACACTGATAATGTAGTCCTTGGCTGCAGT
AAACTCTTGGTATTCTTACTTGGTATCTACCATTAAGTATAGTTTAAGCCTTAATCTAGT
AACTGAATTTGCAGAGATCAAAATCTCAGCCTGCTTCAGTGTATTCAATTATTAAATTAT
GCAACCATCTGATGTTGAAAAGACCTTTCTGTTCCTTATTAAGAAAATTGTCTTTATGAT
CTCAGGAAGAACTCCAGGTGCCCATGTACAATGTTAGTGATTAATGCCAGGAGGGTACAC
AGCACAAGTGCCCTCACGACCATCTCTGTGTTCAGAAGGACTGTGGGTCTGGCCTCTTGG
GTGCACAGGGTACTTTGAAAGTCTGGTTGTCCCTCCCAGCAGGGGTGGGGAGCAAAAACT
CTCAAAGTGCTCAGCATGTTGGAGGTTGCCCTTCTGACTGTCTTTTCATCTGGTGTCTTA
CCTCCAGGATCTTTGGCTTTCCTGTGCACTACACAGACGTGTGCAACATGGGCCGTGGTG
CCCGCCAGAAGCTGCTTGGAAGATCCTGGAGTGTCCCAGTCATCAGACACCTCTTCGCCC
CCCTGAAGGACTACTTTGCCTGTGAATAGTTCTTCTGGGAGGCCCTTGGCATGGGGGAAT
GGGACCAAGCCTGGATCCAGAAGGTGCTGCCTGGGCTCTGCCCTTCCTCAACTCTGCTAT
GTGGCTCTTGTCTCAAGCTACCTTTGTGGAGGGAACAGTACCCTTCCAGCAGGGGTAGCA
TGACTTGCCACCTCATTGTGCACAATTCAGACCCGGCTGCTTGGAGCAGCCAGACATGGT
GCTCATTTTTATTTTCTAAGACTTTAAAAACTTGAAGTAGATAGTAAGAAGACTTTTTTG
TTTGTTTGTTTCCCTCTTTCCCCTCCTGGGTTAACCGCTCAAGAGATAGGATGGCTAAGA
TACCAAAACCACAGTGCCGACAGTTCTCTAATACTCAGGTTAATGCTGAAGAATCACCCA
AGACAGAAAATGCAAGTCTTTAAAAAATTTTAAGTGTCTGCAGCTCCCTTGTTTCCAGGA
GTGGACAGTTGTAGACAATGCGGCTAAGGGACATTTTTAAGAACCCAGAGGTTTTTTTTT
GTTTGTTTGTTTGTTTTGTCCTCTCCCCACCTGGGCCTAGCAGAAGAGGACAGGATGTCT
GCCTTTCTTGAATTTTTCCCCAACCAGACCAGTTCCTCCTTCTGGCAGTATACTGTACTG
CCAGGGCTCATTTAGAATATTTTTCATGATGATGACAGCAGGGATGACATCATCACATTC
AGGGCTATTTCTTCCTGCTCATGTAAGGGCAGGGTCTCCCTTAATTAAATCCCCCTCAGT
GACTGTAGTTGACCCCTCCGGGGAGCTCAGGGAGGGAAGGGCTGGGTTAGAAGCTGCCAC
TGATGCTGTAACCAGGCATAGCTTCACATATCCCTCTTCCCCATGTGCAGGGCAGTGAAG
GATAAGGCTTCCTTAGACCTTCCTGTGTCTCCCACCCTCCTTTTCACATGCCCCCACTCC
CAAGATGTACCATTCACACTTGTCTTCAGGCACAATTCCCCTAGAATCAGAACACAGGCC
AATTCTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1154, 2126..2187, 3651..3749, 5451..5567, 6188..6262, 6265..6269, 6271..6379, 7036..7194, 9515..9622, 10459..10603, 10979..11038, 12424..12543, 12684..12728, 13835..13914, 14015..14127, 14660..14843, 15302..15386, 16120..16265, 16867..16957, 17233..17381, 17996..18081, 20730..20799, 21700..21818, 23527..23668
1001..1154, 2126..2187, 3651..3749, 5451..5567, 6188..6262, 6265..6269, 6271..6379, 7036..7194, 9515..9622, 10459..10603, 10979..11038, 12424..12543, 12684..12728, 13835..13914, 14015..14127, 14660..14843, 15302..15386, 16120..16265, 16867..16957, 17233..17381, 17996..18081, 20730..20799, 21700..21818, 23527..23665
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved