Erinaceus_europaeus Locus NCL
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus NCL
Erinaceus_europaeus
NCL
GeneScaffold_2505
SNORD82, SNORD20, SNORA75
7147..7215, 10782..10860, 11344..11473
12119
TCGCCTCAGTCTCGAGCGCTCGCTGGTAGCCAGGCGTACGTGCTCCGGGTTTTTCAGCG
CTAGCGGCCGCCATCGACGTTGCTTGGCTTCTTCGGGTCTTTTCTGGCCATTCCGCCCGT
TGTAGGCCGCCATCATGGTGAAGCTCGCCAAGGTATGGGGCTCGGCCGTACCGGCGCGGA
CGGCGGGGCCTGCTTGTGGAGGGACGCTCGCGCAGCGCCGCGAGGAGGCCCTGCTCCGTC
CCGGGCGCGTTCGGGGGGCGCCATGCTGCGGGAAGTCTCGCGAGGAGCTCCGAGGTCTCG
CGGGTGTTTGCTTCCTGGCCAAGCGGGTGGTCGGAGCTGCGGGGACTGGCGACGGAGGGT
CCGCGGGCCGGGCGGGGAGGCCGGGTCCGGCGCCCCGCCTCCCGACGCACGTGCACGGGC
GCGTCGCTCGCAACGTGGGCCTGCGGGGCCGCGTCAACGATGGAAGTCGCCCACTGCGGA
GCTCGAGGGGGCCCCCCCGGCAGCCTCGAGAGACATGGCTCGGAGTTCGCGCGCGAAAGA
TTGGAGGCTCTCGGGACGATGTCGGGGCCTTCGTCTGTTTCCCGGCAAACTGGAAGCTAC
AGTGGACACACCGATCTTAGTGCTATTGCAATAGATTGGCGGTAGTCTCCTGGCAATGAG
TCATGGGAGACCAGAGGGGCGATTAATGGAGAGAATAGGACGTCCCATGTGTGTACTCGG
CACTTATATCGGGATGTCGGAGCGTATGATCAGAACCAAGACGTACAAATTGGACACGCA
TGCTTACATAATGTGTACACTTACGAGTCGGGTGAGACGAGGTGCGCGGTAGATCGATTT
ATCAATCTGAACCGTCCCCGATCTAGAAGTATTCCTTTCCTTCCACCAAAAAAATAATAA
AGAGTATCGGATGACGACGCACCAGACGTCGAACGACCCTCGTCTATTTTANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCTAGCTTTTTAAGCATTAGGATTTCAGTGCTTACAGACTGTAAAGGTATTTT
AAGTTTTGTTGGGAGCGGGGACTAGAGCATTATTTCCGGACACGCAGTATGAGGAATCAA
ATCGAGGGCTCAAGTTTATCTGTTCTACCAAGGACACCTGCTTGGAGTGTTTTAAGATTT
TAGACCAGATCACCAGTTTCCAAGAATTGAACCTGTTAAGTGTACTATGAACCACATAAA
AGCCTCAAAGCAAACAGTGCATAGATTTGTGTTTTTTAATAACCAGAGCTCTTCTGAGGT
GTGGTTCATAGTGATACAGGGAATTGAACTTGGGGCCTTGGAGCCTTGGACATGAAAATT
TGCATAACTGTTATGCTATCATTAATTCAGTACACAGGTCTACATTCAGAGCCCTTGATA
AGCAAATAATGATTCAAAAATGACAGGATTCAGAGATGGTCAGTTCTGAATGTTGAAAAA
GGTTCTGTAATTGCTTGGCTTTCCCCGGAAGATGAGATACAGTATTAGATGAGACTTAAT
CCTGATAGCTAGTTTTTTATTCTCCCCAGAGCAATGCTCAACTCTGGATTATGGTGGTGC
AAGGGATTGGACCTGGGACCTGAGAGCATGAGTGATTGTATCACTTGTATTTACTCATGG
AGTCAACATTTTAGAACTAAAGTTAAGTCTTTATTTTCAAGGTTGTTATCCCTCAGAAAA
AAGGCAAAAAGGGAACCACAGCTCCAGCAAAGAAGGGAGTGGCTTCTCCAGCAAAAAAGA
GTGCAGCTGCCACACCAGCCAAGAAAGCAGTTGTCACTCCAGGCAAAAAGGCAGTGGCTG
CACAGGCCAAGAAAGCACCTACCCCAGCCAAAGCTGTGGCGACCACTGGCAAGAAGGGAG
CCACCCCAGCCAAAGCTGTGGCGACCCCTGGCAAGAAGGGGGCAGTAACCCCTGCCAAGG
GAGCAAAGAACGGTAAGAATGCCAAAAAGGAAGAGAGTGAAGAGGAGGATGAAGAAGATA
GTGAAGAGGAGGATGAAGAGGATGAGGACGACGAGGAGGATGAAGAACCTGAACCAGTTG
TGAAGAAAACAGTTGCTGCTGCCCCAGCTTCAGAGGATGAGGAAGACGAAGATGACGAGG
AGGAGGAGGAGGAAGATGAGGAGGAAGAGGAAGATGGTAAGACTTGGTTCCTGCTCAGTC
TCCAGTGTGTAAGATACATTAGTGAAGTTTGCTTTGACACAGTAGGGATTGTATTAACTA
ATCCTTCAAGGGATGTCTTAGTTTTTGCATCTGGGTATTGGCAGGAATTCATTATTTTCC
CTTTAGCTTTTGTTTTTCTTGGGCTCTTAACTAGGTGACTTTTCTTTCAGACTCTGAAGA
AGAGGCCATGGAGACCACACCACCGAAAGGGAAGAAGGCTGCTGTCAAAGCTGCTCCTGT
GAAGACCAAGGATGTGGTTGAGGAGGAAGCCGAGGAGGAAGAGGATGATGAGGATGAGGA
AGATGAAGATGAGGAAGACGATGAGGAAGAAGAGGAGGAGGAGGAGGAGGAAGAATGTAT
GAAAGTCAGATGCTAGGGGTCGGGTGATAGTGCAGCAGGTTATCACCAGGGACCAGAACT
AAGCATAGCATTCTTGTTGGAGCCCCTGCTTCCCCACCTGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCCCCTCTCTATCTTCCCCTCCTCTCTCCATTTCTCTCCT
ACTCCAATGACATCAATTACACAACAAAAATAAGGACAACAAAAAATTAAAAATTTTAAA
ATAAAAGTCAGATGCTAGCTATATTTTAATAAAGACAGATTGAGAGAGAGTTAAAGGAGA
GAAACCTGCAGCCCGCCTTTACCACCTGTGCAGCTTTCACCCTGCAGGTGGGGCCAGGGA
CTTGAACCTTGGTCATTACACACTACAATATGAGCACTTAACAAAGCACACCACCATTTG
GCCCCCTCAGGTGCTTTTTTTTTTTTTTTTTTGAGAGGAAGAAACACCAGAGCACTGCTC
AGCTCTGGCTTATGGTGGTGTAGGAGATTGAACATGGGACTTTGGAGCCTCAGGCATGAG
AGTGTCTACATAACCATTCTCTCCCACCTTATTTTTTATTTTAAGCTTTATTAGAGATCA
GAGCATCACATACTCATTTGATGTCTGATCAAATTTGAGTAACAGCATCCACCACGCCAT
TTCCTGGTAGTAGGTTAAGTGCAATTGCATGAGGTTTTCAAGGGGGGCCTTGCTGGCTTG
TGAGTGACCGACTATTTGGGATCTTGTACAGAGCCCGTGAAAGAAGCACCTGGAAAACGG
AAGAAGGACATGGCCAAACAAAAAGCAGCTCCTGAAGCAAAGAAACAAAAAGTAGAAGGT
AAGCCTCTTGACCTAGAAGTAGGGGGTCTTAAATCCCAAGAGCACAAATGATGAACAACA
AAGGGACTTAATACTGAATCCTGATGTTACATGCAATGTTCTGATGTGTGCTGTGTATAG
CTTTGTATTGGAAGTTTTGTGCCACACATCACATGACTAATGTTAATATATCTAATTAGG
CACAGAACCAACTACATCTTTCAACCTCTTTGTTGGAAATTTGAATTTCAACAAAACAGC
TCCTGAATTAAAAACTGGCATCAGTGACGTTTTTGCTAAAAATGACATTGCTGTTGTAGA
TGTCAGAATTGGGATGTCCAGGTAAGTGTTGGTACCACAGTCCGTCTGCTGGGCGGGCTA
ATGATTTAACCTGAAGCTTAGCTAACTGATCTTGAATTTTTAAGAGATGAGCATTAATGC
ATTCTATCAATTTGTAAAATGGATAAATTTTGGAGTTGGAATCTTTTTTAGTTTCTGATA
CAGATGATAAAGAGAATGGTATAAACTTTTGTGTTTATGTTTTTACTTATATGTAAAACT
GCTAGATTTGAGTAGCTGAAAATAATGACTGTACTTTTCCATATAGGAAATTTGGCTATG
TGGACTTGGAATCTGCTGAAGACCTGGAGAAAGCCTTGGAACTCACTGGTTTAAAAATCT
TTGGCAATGAAATTAAACTAGAAAAACCCAAGGGGAAGGATAGCAGAAAAGGCATGTTAA
AGGGTGCGTATCCATTTTGTTCATTTTCTCCCATAAGCTGACTTTGTAAGTTCCTTAGAG
AGGTCTTTATCCACTAGGCCTAAGACACATCCCTAGCCATGTTGTTTCTCTGTCGGATTA
AATCATTCAAATAGGCAGGTAGAATTTACTTTGGTTTATGTTGGTACTGGGCACTTAACC
TAGGACGGATGGTGTTACAGGCATGAAAGTCTTTGCATTATGCATTCTTTCCAGCTCCAG
GATTTTTTCCCCGTCCTGGGTTATCACTAGTGTCTGCACTGTGAATTCACTGCTCCTGGA
GGCCATCCGCCCTTTTTTATATAGAGGGTAGGATTGAGAGGAGGGGAAGACCTGCCCTGG
CACCCTGTGAAGGTGACCCCCCTTACAGGCGGGGATCATTTTTTATTTGGATAGAGACAG
GCAGAAATTCAACAGGAAAAGGGGGGGGGGGGCTTTGGGATGGAAATAGATACACCTTAC
ATGAAGGATGATAAATGACATAGTGGAGGTTGTATTATTGTTAAATGGGAAACTGGGGAA
TGTTATGCATGTATAAACTGTTGTATTTACTGTTGAATGTAAAACATTAATTCCTCAAGA
AATAATAATAAAAAAGAAATAGACACACCTGCAGCACTGCTTTACTACTTGCAAAGCTTT
CCCCCTACAGGTAGAGGCTGGGGGTTTGAACCTGGGTCATTGTACATTGTAACATGTACC
ACTCACCCAGGTGTGCCACCACACAGTCCTAGAATCTTACTTTTCCCCCAGATTACCTTT
ATTAGGTAGAGACAGCCAGAAATTGAGGGAATGGGAGATAGGGAGAGAGAAATGTCAAAC
TCTTGGGTGGTCTTAAAGTCTAGCTAACTTGGCTTTGTTTTGTAGAACGAGACACAAGGA
CACTTCTGGCTAAAAATCTGCCTTATAAACTCACTCAGGAAGAATTGAAAGAAATCTTTG
AAGATGCTGTGGACATCAGGCTAGTCAGCAGAGACGGGAAGAGTAAAGGGTACGCCGGCA
CCTCTGGGAATGCTAACAGCTCCTCGACTCACAAAGGAAATTTGATACTTTGTTTTTAAG
GTTTATGGCTTTGTGAAAATGAATTTAAAACTGTTAAGTTCATGGAGTAGTTTTAATTGA
AAAAATATTTTATTAATGAGAAGACAAAAAAAGGAACCACAGTACCATTATGATGTGCAC
TGCCACCACACAGGAGGACATGGGGCCAGTCGTGGCACACGTGGTAGAGTGCACACATAA
TTCACAGTGACCTGGGTTTAGGCTTCCCATCCCCACCTGTGGGGAACACTTCATGAATGG
TGAAGAAATGCTTGCTAATGTCACCCTATGAAAGTGTTGGCACACCTGGGTGAGAGTACC
TTACCAAGCATATCCTAGGTGCAAGGCCCTGACTCCATTTATACCTACAGTGGGCAGGCA
AGACAGCTTCATGAGTGCTGCAGGTGTCTCACTGTCTCCCACTGCCTCTGCCAAATAGTT
TTTTTTTTTTTTTTTTTAAAGAAAAACAGTATCTTTATTGTGTGTAGTTTTAAGTAAAGG
AAAGCAGAGTCTTGAAAAGGGGGTTATGTAATACATGAATTCTGAAGGTTTCTTCCTATT
TATTACAGGATGGCTTATATTGAATTTAAGACGGAAGCTGAAGCAGAGAAAAACTTTGAA
GAAAAGCAAGGAACAGAAGTAGATGGCCGATCTATTTCCCTGTACTACACTGGAGAGAAG
GGGCAAAACCCAGAATACAGAGGCGGGAAGAATGCCTGGAGTGGTAAGAATACAAGGCCT
TCCTTGCACGTTACTAGTGCTGAGTTTGCAAAACCCTCTGCAACTTTGTACTTATAAATT
GAATGTAAATATATGTCAGTTTGTAATTAAGTGTTTTGAGTGAGATGTATGAAAGCACTT
CAGGACAGACGATATTGAGAAAGATAGAAGAGAACCAGACATCACTCTGATACATGTGCT
GCCAGGGATTGAACTCTGAACCTCATGCTGAAGAGGTCAATACATTATCTATTGAGCCAC
TTGGACCACCCCACTGTTATCTTCATATGGTATCTTTTTATTTGTAGGTGAGTCCAAAAC
TTTGGTTTTGAGCAACCTTTCCTACAGTGCAACAGAGGAAACACTCCAGGAAGTATTTGA
GAAGGCAACTAATATTAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTAAAATCT
TGTTAATATTTACTGTTAATTCCTAGCTGTACAGGTTTAGTCTCTGGACTACCATAAGCC
AAGAGCTGATTAATGCTCTATTCTTTGTCTCACTCATTTAAATAAAGGTAACGATCTTTA
AAAAAGATAAGTAAGATATTATTATATTTATTTTCCCTTTTGTTGCCCTTGTTTTTTATT
GTTGTGGTTGTTATTGTTGCCATCGTTGTTGGATAAGACAGAGATGGAGAGAGGAGGGGA
GGACAAGGGGGGGGAGAGAGAAAGACACCTGCAGACCTGCTTCACCACCTATGAAGTGAC
TCCCTGCAGGTGGGGAGCCGGGGGCTCGGCCCAGGATCCTTACGCCAATCCTTAGGCTTT
GCACCACATGAGCTTAACCCGCCATGCTGCTGCCTGACTCCCCAGATCTTAGTTTTAAGC
ATTTACTTGATTGCCTCTTAGCTAAAGGAAAAGGCTAAACGCTTGCGAACTTCTGAATGT
TGACTCTTGTCTGCAGGTATGCATTTATAGAATTTGCTTCAAATGAAGACGCTAGAGAAG
CTTTAAATTCCTGTAATAAGAAGGAAATTGAGGGCAGAGCAATCAGGTTGGAGTTGCAGG
GACCCAGGGCGTCTCCCAATGCAAGAAACCGTAAGTTACTGTTGCGAGAGCCTGTGGCAG
GGGAGCAAACACCTTGGGGTTCTGTTCTGCATGTCAGGCTATATTTTTTTGCAATTGCTG
CTGAGTGAAGAATACTGGATGTGATGATTGATTATCTGAGTAAAACTGATGAAAAATCAA
GAAAAGTCCTCTAGATAGTCAAGTTCTGATCCAGTTCCAAACAGCACTTAACCCATGGCT
GGCTGTCTGATACAGAGGGGAGCTGAGGTGTAAGATGAACACTGTGGTAATCCAGAGAAC
CGAGCCTTGTGCCGCCTTGACACCCCCCCCCCGCTGCAGGTGGGGAGCTGGGGGCTTGAA
CCAGGACCCATATGCCAGTCCTTGTGCTTTGCACTGTGTGTAGCTTAACCTGCTATGCTA
CCGCCCGACTCCCTCAGACAAACATTCTTGGTCATTACTCATGTAGGAAGCTCACAAATT
TAGTATTAGTTTTTGGAATTGTTACTTTAAATAAAAGACAAAATTTTATTTTTCAGAGCC
AACCAAAACTCTGTTTGTCAAGGGTCTGTCAGAGGAAACTACAGAGGAGACATTAAAGGA
GTCATTTGATGGTTCTGTACGGGCGAGGATAGTCACTGATCGGGAGACAGGTTCCTCCAA
AGGGTAAGGTGCTGGGCAGGTACTACAGGGCCCCAGTATCTTCTCATTGAGCTCCTTTCT
GTCAGCCAGTGGCAGTTTAAGGATTCGCACGAGAAGAAGAGGAAATTCACATAACTAGCT
CTTTTTTGGCCTCTTCTGAGGCACATTTTGCTGTTTGTGAGACATGGTGTCAAGCTGTCA
CTTGGTTTAGGCTGGGAAGTAGTTTGCCCTCTTTTCTAATGCCCTCTTGGCAATTTTCCA
GGTTTGGCTTCGTAGATTTCAACAGTGAGGAAGATGCCAAAGCTGCCAAGGAGGCCATGG
AAGATGGGGAAATTGACGGAAACAAAGTCACTTTGGACTGGGCCAAGCCGAAGGGTGAAG
GCGGCTTTGGGGGTCGCGGCGGAGGCAGAGGTGGTTTCGGTGGCAGGGGCGGTGGCCGAG
GAGGCAGAGGAGGTTTCGGCGGCAGGGGCGGTGGCCGAGGAGGCTTTGGAGGTGAGTATG
AGGGACGTGGGCTGCTCTTTGTCCACTGGGCCCACACAGCACAGGCACCTGTGCTCCTGG
GCAGGGCAGGGCAGGGCAGGGCTTACAGCAGCTTCACATTCATGGCACCTTTGCTTGCCA
CAGGACGAGGTGGCTTCCGGGGAGGCAGAGGCGGCGGTGGAGACCACAAGCCACAAGGGA
AGAAGACGAAGTTTGAATAGTTTCTTCCATGCCTGGCTTCCCCTCTTCCATTTGAAAGAA
AGGACTCTGGGTTTTTACTCTGTTACCTGATCAATGACAGAGCCTTCTGAGGACATTCCA
AGACAGTATACAGTCCTGTGGGTCTACTTGGAAACCCGGCTAGATAACATTTCAAGGGAG
AACACCTGTTGGTTGGTTTTGACTGGATATTCATATAAACTTTTTAAAGATGTGAGCGAT
AGAGCTAATCCTTAACTGTAAGTTTGGAATTTATATTGTTTCTTCCCATGTACAAAACCA
TGTTTTTTCCTACAAATAGGTGTTTTTTTGTTGTTGTTGTTTTGCGTTGGGGTCATAAAG
GAAAGCAGAATGTTATGATTTTGCTTCAACTTCGGGACAAATTAAAAGTCCTAAACTCTG
GTGTCAGACTTGTACTTAATAGAATGCTTCTCTGGAAATGAAAAGAAACACTGCCGTAGG
TGTACATGTACACCCCCACACACACCTGAGGAGAGGAGCAAATTGTCAGGCCACCTTGCT
AGAAGTAGCTTGGATGGGGAGGGTGCAGTCTAGAAATGGCTGTGGGGGACGCCAGAAAAC
TCCTCAGCCAGGAGTCTGTCAGTCAAGGACCTCTGGGTTTATGTAGAGTAGGCAGACAAT
TCTATTACTTAATCCCTCACCCACTGTCTAGTTGAAAAATACTCGCTTTAGGTATCAAAG
ACTATCAGGGTGACGAACCACTGAATAGAGGTCAAATTGTCTGGTGACTTCCCTGTCAAG
GTTTTCTCCAAGCAAAGTCATGAAAATGTGAGATGAGATCACCCTGTTAGGATTCAATAA
ATTTTAGAAAGCAACCTCAAGGAGGTGGGGCATTAAATTGTCCTGATTGTGATTATTTAC
CAGGAGGGTGAGGTCAATCTTGTGTTGTACTCAAATTTTTTTTCTTCTTAAATTGCCACT
AGTGTTAGTGTTGGGCATTATGAATCCACCTGTAGACCTGTTTCCTATCTGTTGAGTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 3178..3294, 5348..5822, 6017..6201, 7020..7104, 7286..7427, 7693..7817, 8712..8835, 9455..9609, 9914..10037, 10543..10676, 11183..11309, 11548..11777, 11910..11986
1001..1018, 3178..3294, 5348..5822, 6017..6201, 7020..7104, 7286..7427, 7693..7817, 8712..8835, 9455..9609, 9914..10037, 10543..10676, 11183..11309, 11548..11777, 11910..11983
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved