Erinaceus_europaeus Locus ENSEEUG00000004875
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ENSEEUG00000004875
Erinaceus_europaeus
ENSEEUG00000004875
GeneScaffold_7436
SNORD58
1082..1146
4267
TTATATCAAATAATCTGGATAGTTATCCTGTTTTAAAACTACCATCCTGATTTTAATTG
CTTGATATTTAAAAGCCACAACTTCCTTTTGGGACATGGGGGTGGGAGGGGGAACGGAGA
TGGTCCGTGTCGAAAATCGCTTTTCCTCTTCTCAGACACACCCCCCAAGTCCCTTGGGAA
CTCCGCCCTTCTCCCCTCTTCAAATCTCGTTTCACCTGAAGAGATCTCGCGAGAGATCGA
GTTCTCAAGAATTCTCCCAGCAGCCACCGCTCTTCCTCTTCCCTCAAGCGGCTTAGGTGA
GTGTTTTTGCGGGGTCTTCTCTACGACTTGAATCCTCCGGTCATCGCCGGCATCCTCGCT
TCGGCAGCGCGGGTCTCTGGGCCCGCGTGAGGAGGATTCTTTCAGCTAGCAGTGGCTTGG
TGCAGGCGATGGCCCACCGTGCGGGGGGACTTGTCAGAGCGCCCGAATCGGCGCGATGGG
GCGGAGGGGGGGCGGCGGGGTGCTGGCGTCCGGCGCCGACTCGGGATCACCGTCAAAGCT
TTAGCGGTGAGTGTTGATCAGGACGCGGTAGTTTTGCAGCTGGAGGAAGTTGTGGGGGAT
AAAGGTGGAAGTTTACTCGTCTCATCACGAGTGCTTGGAATTCGGGGGGCACCTAACGTG
AGTGGCAGCCCCAGAGCGCGGGCTTGGGGGCTGGGGGCAAGGGAAGCCTTGCGTGGTGGG
GAAGGCGGCTGCGATGGCGGCATCTTGGGGCAAATTCGCATAAGCCGAGAAAACCAGCCG
CGTCGGTGCCGCTTGCCGCGCGTTCCCGGCGCACGGAGCTTCCTCGCCGGTGGGCGCTGA
CCGAGATGCTCTGCTTCCTTCAGGTGACCCCCCACCATGGTCCGCTATTCGCTTGACCCA
GAAAACCCAACGAAATGTAAGTGATGGAGAGAAGCCGAGGCTTCCCGGCGCGGGCTAGGG
GGCAGGAGCGCGGAAACTAACCGGCCCCCTTGTGTTTCAGCATGCAAGTCCAGAGGCTCC
AACCTCCGCGTGCATTTCAAGGTATGTCGGGTGCCAGGACGCGGGCTTCCTGGAAACGGC
GGCTGCGGTGATGCTTCTCTTAGGACACCTTTGGATTTACCGTGAAAACAAACCAGTTCT
GAGCAGCCACCTTTCAAACGCTGGTTTCCGCTGCGCGGTGTTCGGGGGGTGGTGGTGTAG
AGTAAGGAACGAGTTGGACGATTGTGTGTAAATCGAGGGTTGCGAGCTGTTGGTATTAAA
ATGCTTAAGTGGGGAGGGCTAGAGTTGATTTCAACCCTCGATTCACGGTAGCTAACCGCC
TGCTGTAAATTAGGTATTTTTTTTTTCTTGCCTTCGGGCTTATTGCTGAGGCTCCTTGCC
TACACTAGGAATCCACTGCCCCTGGAGGCCGTTTTTCCCATTTTGTTGCCCTTGTTATTG
TTGGATAGGACAGAGAAATGGAAAGAGGAAGGGGAGAGAGAGACACCTGCACACCTGCTT
CAGCCGCCTGTGACGCGACTCACCTGCAAGGGGGGAGCCGGGGGCTGGAGCCATGTGCAT
TTTATCCCGCTGCACTACTGCCTGACCCCCTGTAAATCCGATTTTCTCCAATAAAGCCTC
CAGGGGCTATCACTCGGCTGGAGCTGCACTACAAATCCATTGCTACTGGACACCATTTTC
CATTTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGTTT
CTGCTGCATATGCTTAAAAACGTTGAGAGCAACGCTGAACTTAAGGTACCTGTGCAGTGT
CTTTAAGTGCAGTGAGGTGCTGGCTCACTTAATTTGTGGCCTAGATTTTATTTGCTTGTC
CTATCAGCTTTTCAAAGCCTAAGTTCTCAATTGAAATATTTGGCTTTATTGGCTTCCCCC
TAATTCCAATGTCTAAACATTGACATTGAGCTGTTTTCATGAGGAAAGCATTCTCCTGAC
ACGCCTTTGGTCAGATAGACAGTTGTGTGAACTACTTTAGAATCTTTGCTGTTTCTTTTT
TTTATATTTTATTTATTAATTAATGAGAAAGAGCCAGACATCACTCTGGTACATGTGCTG
CTGGGGATTGAACTCATGACCTCATGCTTGAGAGTGGTGCTTTATCCACTGCACCACCTC
CAGGACCACTGCTGTTTTTTTTTTTTTTTTTTTTTTTTTAACATTCCTATTAGAGAGAAA
CACCGAAGCACTACACAGCTCTGTCTTATTGTGGTGTGGGGGATTGGAAACCTGGGACGT
CTCTGCAGCCTCAGGCAGGCATGAGAGTCTCTCTGCATAACCATTATGCTATCCTATCCC
TGCTCTTTAGAATCTTTGTAAAATGAAAATTTCCCACGTTTATCATATTGGGGAGACATA
TGCCAAGTCTTAGAATTTAAAGCAATGATATGTAGTAAACTTAAGAATATTTGACACAGG
AGTTTTTGCAGTTTGGACTTAAGTAGATTCATGTTTGTTTCAAGGATTGTTTTTCAAAAT
GTCATGGGTGGTGAATGACACGGTTTTTTCTCAATGACAGTTTATGGTATTAACCAAGTA
TTTTGCTGTCCTCACCATTCTAGGGCCTAGATGTAGATTCCCTGGTCATTGAACATATCC
AGGTGAACAAAGCCCCGAAGATGAGGCGCCGAACTTACAGAGCTCATGGTCGGATTAACC
CCTACATGAGCTCTCCCTGCCACATTGAGATGATCCTCACTGAAAAAGAGCAGATTGTCC
CTAAACCGGAGGAGGAGGTTGCACAGAAGAAAAAGGTGGTTACTTGGTTTTTACTTAGTT
TCATTTGTATAGTGGTACCAGGTTTTAGGTTGCTGTGATGACTAACTTAGGACACCTTTG
GAATAACCGTGAAAAAGAAAACTGTTCTGAGCAACCTTTTAGGCCTTTTTAATTTATTGA
TTCATGAGAAAGAAGCAGACATCACTCTGGTACGGGATTGAACTCAGGACCTCATCATAC
TTGAGAGTCAATGCTCTATCTACGCCACCTCCCAGACACTTTTTTCTTTTAAATCAGGTC
ACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1018..1040, 1788..1788, 1889..2023, 2124..2172, 2275..2324, 3143..3238, 3241..3267
1001..1015, 1018..1040, 1788..1788, 1889..2023, 2124..2172, 2275..2324, 3143..3238, 3241..3264
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved