Erinaceus_europaeus Locus BAT1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus BAT1
Erinaceus_europaeus
BAT1
GeneScaffold_8685
SNORD83
7589..7665
19523
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAAAAAATAGCCTTCAGAAGCAGTGAATTCATGATGTAGCACTGAGC
CCCAGCAGTACCTTGGAGGCAAAAAAAAAAAAAAAAATTCCAGAAGAGTATTTCTATTCC
CAGTTACATAGTACATTCTGAGGGGTTAGAAGGCTTTGTCATCCTCGACCCAATAACCAA
GGGGTTAAATAATCACAGTGTTAATTTAAATATCTGCCAGGTGTACATTTGTGACAGTGA
CCCTGAGGAGAAATACTATGTATCTTTCCATCCTCCATTAGGTGTCTGTGCTGGTGATGT
GTCACACTCGGGAATTGGCTTTTCAGATCAGCAAGGAGTATGAGCGCTTCTCTAAATACA
TGCCCAATGTCAAGGTAAGCCAGAATGAAGGGAATGTGAGGGTGTGGGGATTTGGAGACG
TTGAAGAGTTGTATTTTTGTAGTCTTCATGTCCCACAGGTGTTCAGTTATCTATGAATCT
CAGTGTACATTTAACAGTTCTGTACTTGGGTGTACAAGAAGTTTAAAAGAATCTAGACCT
CATTTTATTTTATTTTATTATACACACACACACACATTATATATTTAAGATTTACTAATG
AGAAAGATAGGAGGCAAGAGAAAGAACCAGACATCACTCTGGTATATACTGCCAGTGATT
GAACTCAGGGCCTCGTGCTTGAGAGTCCAGTGCTTTATCCATTGTGCCACCTCCCAGACC
ACATATTTTAAATTACATTTTATTTGAGACATAAATTGAGAGGGAACGGGGAGCTAGAGA
GGGAAAGAGACAGAGACACCTGCAGCCCAGCTTCACCACTTGTGAAGTTTTCCCCCTGCA
TGTGGGGACCAGGGCCTTGAGCCTGGGTCCTTAAAGGCACATTGTAATGTGTGCACTTAA
CCAGGTGTGCCACTACCTAGCTCCCTTGATTTTTATTTATCTGCTTTGGCTTTTTGAAAA
TATATATCTTTTAAATTTCTTTATTAGAGGATTAATGGTTTACGTTTGACGGTAAAATAC
AATAGTTTGTACATGCATAGCATTTCTCAGTTTTCCACATAACAGTTCAACCCCCATTAG
GTTCTCTGTCATTATGTTCCTAACCCCCTCTCTCCACCCCTGAGTCTTTTACTTAGGTGC
AATACATTAAAAATATTTATTTCAATGAGAGAAATACAGAGAGATAAGTACACACACCAG
AACACTGCTCAACTCAGGCTTATGGTGGTGCTGGGGATTGAACCTGGGACTTCAGAGCCT
CAGGCATGAGAGTCTCTTGGCATAACCATTATGCTATCTACCCCCACTCTGCTTTGTTTT
TTTAATACCTTACACCCATGTAGTAGACCATAAGATTGGACTTTGGAAGGTACTTAACAC
ATGATCAAGTTTCTTTACACTGACTTTGAATCACTACACTGTGATATGGTTGATAGTTTG
AGAAGTTAGGACAGTGCCAAAGAAAAAGCTGGAAGCTTAAAAATGTCTTTAGTGTGTAGT
GTGTGGATTTTGAAGATTCTTTAAAATGGTAGAAAATTGTCTCAAGCCCCCAGCTGGCTC
CCCACCTGCAGGGGAGTCACTTCACAGGCAGTGAAGCAGGTCTGCAGGTGTCTCTTTCTC
TCCCCCTCTGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAGTGATGACA
TCAATAACAACAATAACTACAACAATAAAACAAGGGCAACAAAAGGGAATAAATAAATAT
TTAAAAAAAAATAAAATTGAAAAATGTCGTGGCCATAACAGCTTTTGCTTATTTTTTAAT
ATTTATTTAATAAGAGATAATGGAGAAAAAGATACAGAGACCGAAGCTCAGCTCTGGCAT
ATGGTAGTGCTGCTGATTGAACCTGTGGGACCTCAGAGCCTCAGACATGAAAGCCTTTTG
CATAACCCTTATGCTGTCTCCTCAGTTTGTTTTTTAATTTTCGTATGTGGTTCCCACACT
AGTAGTTACAGCATCATTTAGGATGTGTGTTGTAAATGTAGATACATAGTTCCACTCCAG
ACTGAGTATGACTCTGAGTTCTAACATGGTCCCTGGTAATTGGAGAAGCACAAATTTTAT
TTATCTTACCACCTGGGCTAAGTCTGTATAAGGAACCCACCATTCTCTCTCAGTGGCCTC
CCCCCCCCCCCCATTGATAGAGACATAGAGACAAAGAAATTGAAGGGGGAGCTAAAGAGA
GGGAAGCTTCCCTTCTGCAGGTAGAGTGTGGGGGGTTGAGCCTGGGTTCTTGAATTTAGT
AATGTGTGTGCTATGCCTGATGTGCCACAACCCTGGAACCTGGCATGAAAAGTGTTTCTG
CATAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCTGTTTTGGAA
CAGCTAGTAGATCTATTTTAGGTATATTCCAAAGGGCCCATGACTTTACTAGTTTTTGGC
TGAGCCTGACATCTAATATGCAGGTGGAACCAGGTTATTCTCTGGGGAGATGGCATCATA
GTTGGAAAAAGGACTAGAAAGCTAGATCAGGGAAAAGAGTAGCTCCCAAATATGGGGAAA
GTATATAAATATTGTTGACTGCAATCCCCATCAGCTTGATCTGGAGCCCATATTCAGCAC
AGGAACATGTAACCTCTGCATCCCTGTAGGTCTGAGCCTGCATCCTGTGGTTACGGCTAG
GAACATTCCAGGCTACACTAATTTCAGGACCCATCTTCCTCTGATAGTAGGTAGAGTATG
TTGTCCAACCTCCCTTTGGAAAATGGAACAGTCCCTACCATTGTTGATTCACATTGAGGA
CAAGGTCCTATAGGGGCCCACAGAGGGGTCCATTATGTTGTTCCTGATGGAGAAGACCAG
TGACAGTGGCAAGAAGGATCTGTTAGAGGTCTAGGCCATCATGTCTGTGTGGGAATTCTG
GAACCCCCTGACTAGGGCCCCAGGTGATGGGGTAGCCTGGTAATGACTAAAGAATCATCA
TTAAAGTATGCCAGTCTCTTGCCCTTATTAACCTTTTTTAAAAAAAAAATATTATCTTTA
TTTATTGGGTAGAAACAGTCAGAAATCGAGAGAGTAGAAGGAGATAGGGAGATAGACACC
TGCAGCCCTGCTTCACCACTTGCAAAGCTTTCCCCCTGCAGGTGGGAATCAGGGGCTCAA
ACCTAGGTCCTTGTGCATTATAACATGTGCGCTCAACTGGGTGTGTCACTGCCTGCCCTC
CTTATTCAGCTTTTGAAGTCCTTACTTTATGTCTTACAAAGTTAGCTTTGGTGTGATTGA
GGGACGTGTAATAGGAGGTAGGTCAGGAGAGGGTATCTAGTTCTAAGTAGAAACTTCTCT
CCTCTCCTTGCCTCTTCCATCTCTTCCTCTCCCCTCCCCTCCCCTTCCTTCCTTCCTTCC
TTACTTACTTCCTTCCTTCCTTCCTCCCCCCCCCCTTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCTGATGGCTCTGATATCCCTGGTGGGTTCTGCTAGTTTTTTGGA
CATCCTTGGTGATCAGGGAGAATGTCATGCAATTTTGTGATGATTACTTTGATTTTTTTT
TTTTTTTTGAGAGAAAAGACTTTGCTGAGCTTGCACTGGATATCATAGTGAAGATATTGC
AAGCTGACAAGTGACAGTGTATTCTAATATTTCAGTATATGTCATCAGAATTTGTGGCTG
GATAGGTCTCTAACTTGTTCAGGGTTGATAGGGAAATTATTTGTGGGCGTTTGTGTGGTG
TGGTGTTCCAAGTACTATTAGAGCAGTGGGAGAAAAAAATTTCCCCATTTTCCTTTAATA
GGGCAATACAGGGAGTTAGAAATTCCTGCTGCACTGCTCCACCAATTGTGAAACTTTCCC
CTGCAGGTGGGAACTGGGGACTTGAACATGTGTCTTTGTGGGCTGTACCACTACCTGGCC
CCAGAGGGAATTTTCTTCAAAGAATGCAAGTTTAGTTAATAGATGTCATTCTAAGTGATC
TTTGACTATGAAGCTATGAAGGATGTCAGATAGAGATAACATACTTGCTTGACTGGTTAG
GAAGGTATGAATGATGTAGATGGAGGTTGGACTGACCGCTGCTGGAATGTAAGGGGGGTT
GGTCCATGAATTCTGGAGACAGACTTGGAAGAGGGGAATGGGAAGAAGAACTTAGCACTT
TTGAAACTTATCCTTGAGGGCCTTACCCCCATTTCATAGTTGTGGACTTTGGAGTTTCAA
TTATCTTTTTTCTCTTGTGTGGTTAAAATGCCATAGAGCTAGAATCAGATCCCAAGGTTA
GAATTATCTTGTTTACCTGTTCGTAGCAGTCTTAAACTCATTGAGAAGTCTATCTCTGGT
CTCTGGCAATCTTGTTAATGATTTAGTGCTTTTTTCTCCTAAAAGTTTTTTCCCCCTTTT
TCTTGTAGACATGCGTCGGGATGTCCAGGAAATTTTTCGCATGACCCCCCATGAGAAGCA
GGTCATGATGTTCAGTGCTACCTTGAGCAAAGTGATCCGTCCAGTCTGCCGCAAGTTCAT
GCAAGACGTAAATACCCTTCTACCTTCTCTTCCTCCACTCCCTGCCCGCTGCGTCCTTCC
CTTCCGCGCCCTCTTCCTCCAGACTCCCTTGTCCTTCAAGTGCCAAGAAGGGGGCACGTA
CCCATCCGGGAGTGATGACTCCTTGAAGAGACACACAGAGTTAGAGACAGTTAGTGTTAG
GTTCTGCGCGGGCGTTAGGGAAACTCCGGAAGACTTGGTCGGGTTAACTTGAGAGCGGGT
AGTGTTCGACATTTTTTATTTCATCACAACATTTTTGAACCTCTTCTCCTTTTGGGGGAG
GGCAGAGTTTTCTGCCCTACCACCCACCCATTGTCTTCTACATGCCCCCTACACCACACA
CCCTCAAGGTGGCATCGAGCATACACTGGAGCTTTCTGCTCCCAAACTCATAACCTCCCG
GTGACAGAGAGTAGAGAGGACAGATGACAGTCATGTTCAGAGAGAGCAACAACCAAATGC
AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACTTTGGGGGGAA
AGAGGGGTGAAGCTTCATAGCTGGTGGAACAGTGCTGCAGGTCTCCCCCATTTCATTTCT
AATTGTCTCTATCCAAATAATAAGGCTGCTGGGAGCCATGGAGTTATCATGTAGGCACAG
AGCTAGTGATAAACCCTGCTGGCAAATGCTTGATCAAGTCAATGGGTGTTGGCCTGGGAT
GGGTAGTTATCTGAGGGTTGCCTTTGAGAGCCAAATGATGTTTATTTTGATGCAGGAGCA
CTTTTGTGCCAGGACGACTCTAATCTATCACCCATGACTGATGGCTCTGGCTTCCCTGGT
GGGTTCTGCTAGCTTTTTGGACAACCGTGGTGATTAGGGAGAAGGGTGTCATGTTATTTT
TATGATGGTTACTTTGTTTTTGACAGGTGGCAAAAAAAGCAGCACGCACACACGGGTTAT
CCATTATCCAGTATGCTATTGGGGCTTGAATCCAGGACCTCATGCAAGGTTAGGTGTGTG
CTCTTGAGTCTTGTACTCCTTTGAAAGAAGGAAAGGCAGAGCATAAACACCATAAGCACC
ATTCTGCTCTCTGTGGAGCTCCTTGTGCTCCTGTGTGCTTACCAGTTGAACTATCATCTA
GCTTCTCGTTTTTCCTTAGCTTCACTGCTTAGGGGGGTATAATGTGTATTAGATGACCAC
TAACGTTCCATCCACTTAGCTCTGAAATGTTCTAAGACATGGTTTTTTTTTTTTTGTTTT
TTTTTGTTTTTTTTTTATCAGAACACTGCTGAGCTCTGACTTGGCTGCCTGCTTTTGGAC
CTGGGACTCCAGAGTGAGAGTGCCACCTCCCGGTCATAGGGCATGATTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAGCAGTGGAGTGTTTCCTTCCCTCCCTGCTTGCTCC
TACTCTGGATGATAATCCATCATCTTTAGCCTTTATTTGGGGCTAGATTAGATTTGAAAT
AGGAAGCCATGGAACTTTGCAAAGTCTTTTGCTAGCCTGCCGTCTGTGGTAGGCTTCTAA
TTATCTCCAGTGGCACACATGTTCTTTCAAAATCTTTTAAGTTCTGGGTCTTTGTGTTAA
TTATGTCCCCATCTTAGTGAAGAGTGCCAGGAAAGCTTGCCTCTGAAGTTACTTTGTTGT
CAGTTTTTTTTATGCCACTTTACTCCCTTAAAGGGTTTTGTGCCCCCTCCCCCTTTGATT
TTAAAAGATTAATGCATAGCTGCTGCTTTGAGGGTTTTTTTTTTTAAAAAAAAACAATTA
TTAATATCTTCCATTAACTGTAGATGGTTTGAATCTTAAGACTAATCTAAAACTTCCATT
GTGGTCTGAGGACAAATTTCTTAAGTAATTTTTACTTCTGCTTTTATGACATTTTTATTA
CATCCATTGTAATAATCTAATAATAAAGACATCTACCTTCCTAATGTAGGTGATTCTAAG
TGGGAAAATACTCAGCAGTCCTTGTCCTCTTCCTCATTGATAAACCGATCTGGTGGAGTT
ACTTTGACCATCAGTCATTATTTTTCTGTTATTTCTCAGGTGGTGATTGATTTTTTCTCC
ACCTCCATTTAAGATAGTGGCATTTTGCCATTGGTGGTTTCACTGCTTCCTAATCTTTCC
TGAAAAGTTCCTTTTTCTGGATAAAAGAGGACAGTTTTAAATTTGGTAGTCTTAAAATTC
AGATGTAATAGGAATGGAATTGGATCTAGTGTGGAAAAGACCACATTAAAGTTTGGGTAT
TTTTGGGGGGGTTGGTTGGGGTTTTTAAACCTCTCTCTTTTCCCCATCCCTCCATGGGGT
GTATTGGAGATCAACTTCCTCCACCCCCCCAGGTTTAACCCCCCCACTCTGCCCTCCTCC
CGTCCCCATCCCCTCCTTACCCCCCCTTCCCCCCAGCCAATGGAGATCTTCGTGGATGAT
GAGACGAAGCTGACGCTGCATGGGTTGCAGCAATACTACGTGAAACTGAAGGACAACGAG
AAGAACCGGAAGCTTTTTGATCTTCTGGATGTCCTTGAATTCAACCAGGTTAGATCTTCA
AAGTTCAGTAGGGGAATGAGCGTATTTCCAGCTGTGGTGGAAATCTACGTTTTATTGATA
AAACTTATACATGAGAGAAATTGTAAAACAATTAAGGAGCCCAGGTGGAGGGGCGGGGAG
TAGATAAGTATAATGGTTATTTGAAGAGACTCAGGCTTGAGGCTTTCAAAAGTCCAGGGT
TCAGTTGGCGTGTACCACCCATTAAGCTAGAACTCAAGCAATGACCTCCGTCAAACATCA
TCATAATAATACTCAAAAGTAATGATGGATTAAAAAGATACCCAGGTGGCAACAAGAAAA
GATTTTATTTAAATATGAATGGCCTTTTTTGGAAATGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAACCATCCAAATATTTATTTAGTAGCTT
TGAAACATACTACAGTATGTACATCAAGTTTAACAATATCCATGAAACCTTTCATTCTTA
CTGAATTAAGAATATTTCTGTGGTCCGGAACGTGGCACAGTGGCTGGGGCTCTAGACTCT
CAAGCGTGAGGTCTTGAGTTCAATCCCTGGCAGTACATGTAGCAGAGTGATGCCTGCTTC
TTTCTTTCTCTCACCTATCTTTCTCATTAATAAATAAATAAAATCTTTCTTTAAAAAAAT
AAAATAAGAATACTTCCTATTCTGCCTACTGACTCAGAGTTGTGAGAATTAGTGAGATAA
TGTATACTCTGTTAGTTATACTTACATAAGATTGCATTGATGATTTTATTGCCAAATTTG
CAGAGAAATCCTCAGAGAGAGTAAAATAAAATGCTTTTATCTGCATTTATTATCATTCCA
AGAATTATTTAGTACCTTTGAAATCTAATAAGTATACTGAGAAGTAGAGTAGATAGAGTA
ATGGGTCTTCTTCTAGCATTTGCCCTTCTTCCGTAGCCAGTCAACAGGTCAGGCTGAAAG
CTGTCAAGAGCTGCTTGTTGCTGGCTTTGAAAGTGACTAGGATCCATATGGATTCAGTCG
GCTAGGAAGGATCGTCAGTTTCCCCAGTGAATGGGTACTCACGGGATGCACCACGAGAAG
GTCCATCCAATGCATCCCAGCTTTCCCCCTGTAGGTGGGGAGCAGGAGCTTGAACCTGGG
TTCTTGTGAACTATGATGTGAGCGCTTAACCAGGTGTGCCACCACCTGGACCCTGTTACG
TGCTTTATTTGGACTAAAACCTACTTTAAAATTTTTCTTTTATTAGAGCACTGTTAAACT
CTGGCTTATGGTGGTGCAGGGGATTACACTTGGCATCTCAGCCTAAAGCTTGGGAAGTCA
TTCACACAACCATTAGTTGAACTCCCCACCCTAAAGCCTGTTGTTTAGAATTAGGGTAGA
TTGTTTATGTTTGATGTTTTGATGAGTAGTAGAAATATAAAATTTACTATGGAATTTTAC
AGCTCTGTGAGGTAGTTTACTAACACTTCTGGTGATTTTTGATTACTGTTTTCCACATCT
CTCCAGTATGTCCACTTTGGTAAAATTCAGTGAGAGGAAACTCCTTTTCAGAGCAGAAGA
GACTGAGAAGAATTGCTTTTTAGAAAACTGCAATTAACGAAAACTCTCTGCCCATAATTT
CACTTGCCCACCTCCCTCTCCTCCTCTTCCTTCTCGGCTCCCTGCCCCCACACATACACA
GGTGGTGATTTTTGTCAAGTCTGTGCAGCGGTGCATCGCCCTGGCCCAGCTCCTGGTGGA
GCAGAACTTCCCAGCCATTGCTATCCACCGTGGCATGCCTCAGGAGGAGAGGTGAGCTGG
AGATGGGGAAGATGTTTTATTTCCTTAGGAGGAAAAGGGATCTCAACATTTTCTTAATTT
TTAATCTCATAAAGGCTTTCGAGGTATCAGCAGTTTAAAGATTTTCAACGACGAATTCTT
GTGGCTACCAACCTTTTTGGTCGAGGCATGGACATCGAGCGGGGGAACATTGCTTTTAAC
TATGACATGCCTGAGGATTCTGACACCTACTTGCATAGAGTAAGCTCACACTCAATATTG
TGTCCTTCCCCACCTTTTTATTTTTATTGTTCATTTAAAATTTTACATTATAACATTACA
GGTGAACATCAATAAAACCTTATATATCTCCTTTGTGTCTGATTTAGCTTCTTCCCCAGT
TCCATTTAACTCCTTTATTTCATTTCCTGTGTCTTTTCATACTTTACATTTTTGTTGTCT
TTAGATGTTCTCTCTGAAGGCAGGGGAATCTTACTTTTTCTTTATTGGGGATTAATGGTT
TACACTCAACAGTAAACTACAGTAGTTTTTGTACATGTGTAACATTTCTCAGTTTTCCAC
ATAACCGTTCAACCCTCTCTACATCCTCTGCCATCATGTTCCAGGACCTGAACCTTTCCC
TCCACCCCAGAGTCTTTACTTTGGTGAATTACACCAAACCCAGTTCAAGTTCTGCTTTGT
GTTTTCTTATTTTACAGTTTTTTTCTCTCTTTTTTATTACTAATTTAATACTGATAGACA
GGATTGTGGGATAAGAAGGGCACAATTCACACAACACCCACCACCAGCATGCCATATCCC
CATTCCCTCCACCGGAAGCGTCGGAAGCGTCCTTATTTTATCCCTCTGGGAGTACAAACC
AAAGATTCCTATGTGGGCAGGGGAATCTTCTGACCGTTATCGATCTCCTCCTAGGTGGCC
AGAGCTGGCCGGTTTGGCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCAGGATCGCTTTGAGTCATATAGTGAGCTGCTGATGAGATAGACATCT
CCTCCTACAGTGAGTATTTAGATTATGAAACAGCTGGTCTAGTTTATATGTTTTGCATGC
TTAAAATTTTTCACTTATTAACGAGAGCAGGCATTCTGGCATGGGGTATAGGGGGGGGAT
CAAACTAAATCCTGTGCTCTGCCTTCTCATGCCATTGCTTCCTCAACTCTGGGGTTTTCT
TAGTATACTGTCTTTGTCTTGGATGCCATTGTTTACAATAAGAACTGTGGTGCATAGTGA
ACACCTTTCTGGTGAAAGTTAGTGATTAGTTGACCTCTATTTATTTGGAGTCTCTGTCTA
ATCAGATCCCATTTTCTCTACTCCCAAGTCTGTCTTCTGAATTCATGCAAGGAACAAACA
CTGCATGTATGGACATAGATGTTTCTCTCAACCTTAACTATCTTCCCCCCAATATCTTAC
TCTAATTGTGTTTTATTTCCTTTTCAGTTGAACAGACGCGGTAAAGGACTCGCCCATCAA
TGATAGTCTGACCCTCTTCAGGAGCATGGGGATGAAGGAGACACTACTGCCCCTACCAGT
GATAACCCCTTGACTTCCCTCTTTTGCAGCACCACCACTCCTAAACCCCCATATCTTGAA
TTGTCAACTTTTTTTTAAACAAAACTAAAAATCACACGTGTCTATGGTGTCTGTAAGCGC
TTCATCCCTTTATTGGACTTTGGGTGAGGTTATTTTATAGCATGAATTTGGGTACGTTCC
TATATGGGTTGTGCTTTATGGGTCCTGGGGGTGGGATAAGGGGGTTGGAGGAAAGATGAC
AAAAGACTTCAGAGACCATGACTACCACTTTTCAATTTCCAGCCTTAGTAGAGGTATCTT
ACATTTTTTCTTAATGGCCTGGGAAATGCTAAGATATTTCTGATTAAAAGGGTTCCTAAG
AAGTATTTTCATTGTTGGAGGGTGAAGTGGATTTGGTGGAAAGTTTAGTTGTCTTCTCTT
AGGCTCTCACGATGTCTCCTCATCTGTTCTTTAAGCTTCTGAATCTTGAGCACCAAGGCC
TGGGCTTCCCAGGCCCCTTCTTGCCCTTCCAGCAGGGCCTGGTACAACTCCAGCTGCTGT
TCTAGCAACTCCTCTGCTTTGGCCAGCTCACCTGTGGGGCGGGGCCTGGGACCCTAGAGG
GGGGGGATAAGGGAGGAATCTCAGCTAGATGGTGTGGGGGGGTGGGGGAGGCTGAGGCTT
GCTGAGTGGAATTCTGCATTTTTTTTTTTTTAATGCTGTTTAAGGTCATCGGCTGTGGAT
CTTAGGAATGGGGGTGGGTCACCGTACATGGGCATGGAATCATGGGAAATAGAGGACTAG
CTGTCCTTCTCCCCCCATCACTAAGAAATAATTAACTGTTAAAAGGGGAAATTCCACTTC
AAGGACTTTGTAGATTGGAAGGGAGGGAGGGAGGGGGTGGGGAGAGGGACCTCTCTGTTA
GAGCAAGCTGAGAGTTTGGGGTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 4482..4665, 5768..5886, 11736..11867, 15661..15770, 15854..15998, 16674..16698, 17950..18041, 18044..18068, 18507..18523
1001..1093, 4482..4665, 5768..5886, 11736..11867, 15661..15770, 15854..15998, 16674..16698, 17950..18041, 18044..18068, 18507..18520
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved