Erinaceus_europaeus Locus ATP5B
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ATP5B
Erinaceus_europaeus
ATP5B
GeneScaffold_2183
SNORD59, SNORD59
1830..1904, 3181..3252
8744
AGATAGAAATAATCCTTTTTAATTCTCCCAATTGTGGAGCGGCTCCCCTGCAGGTGGGG
AGCTGAGGGCTTGAACCGGGATCCTTAGGTTGGTCCTAGCGCTTGGCGGCCACCTGTGCT
TAACCCGCTGTGCTACCGCCCAAGTCCCTCCAGTACAGTTTTTAATTTGATGTGGATTAT
ATCTTGACTTGCTGAGCTGCCTGGGATCTTCCAATATCACTACAGTGAAAGAAAAACTGT
GTCTTGACTCTAGAGGAGAGTACTAACTTCGGCAAGGTCAGAGGCACCAATGATACAGGC
CAACATCGCTTCCTTAACCCCCATCCCCTTAACAGCGACTGCCACTCCTCAAGGTCCTAT
CTAAGGAGAGGGCCCAAGGACAGCCAAAGACAGCCCACGTGCTTCCATCCGGAACTCTAC
CTCTTTTCTACAAGAATTTCCGCCAACTAGACTCTGCAACTGACGTCCCCGCTATCCAAT
GATGTTTCGAGGCTTTGAGGATCGCCCCTTGCCTATCATTGTCCAATAAAAAAAGAACTT
TAGATTGGCATCAATTTTGACCAATGGAGTAGATGAAGAGACATTATTAACCTATAGAAG
CGAAGGTAAGGATGATAAGCAGCAGGTTTACCCAATGATGAGCGTACTTCAGAGTAGGCC
ACGCCCCGACTGCAGGGGAGTTGGCAGTCAGATCACTGCAGCGATCAGTCTCCACCCGGA
CTCCGCCATGTTGGCGTATGTCGGTCGTGTGGCCGCTGCCTCGGCCTCCGGGGCCTTGCG
GGGACTCAGCCCTTCAGCGCCGCTGCCACATGCGCAACTCTTACTGCGGGCGACTCCTGC
AACGCTCCAATCTGGTAAGTGCCGTTATCAGGGAGGCCAAGGCCATTCCTTCCGTCCCAT
GACCTTGAACCGAGGCCTAGGGGAATTGTGGTGCTAGAAGGACTCTAGGGCCAGTACCCT
GCCCTCTACGGGCGGGAAAACAAAAACGGGGCCCGAATAGAAGCTTCCATCTAAGTCCGT
CTTCATTTATAAAAGGAGTGTTGTGCGATGGAAAAATACTTGCACGTACATTGACCTTCC
TATGAAATAGTCACATAGCTTTTTTAAAAAATGCCCTTTTGTGCTTGAGGATGAGACTGT
TGTGCTGCGCCACTCTTTCTTTGGACACACTGCACGCAGGAGGCAGGGCCTGCATTGAAT
GCACCAATCTTTGTGGGTTAAGTCAGGCCTTTCGGTGACCTTTAGCTGTCCTGATCCCTC
GACTTCTTTGAACACATTTTTTTCCCTTATTTTTTATCAGCTAGGGACTATGCCGCCCAA
ACATCTCCTGCCCCAAAGGCAGGAGTCGCCACTGGACGTATTGTGGCTGTCATCGGTGCC
GTGGTGGACGTCCAGTTTGATGAGGGTCTTCCACCCATCCTAAATGCTCTGGAAGTGCAA
GGCAGAGACACCAGGCTGGTTTTGGAAGTAGCTCAGCATTTGGGTAAGTAGAAATTGTTA
GGAATTGTTAAGAATATGTTGCTTACTCTTAAGAGTCCTCATAACCAGCTGGTCTTCCTT
CTATGATGATTCTATCCAAATGACTTTCGTTCTTCTGAGTTTGCTGAAGCCATATTTAGG
CTCTGAGAAGGAATATTGGTTGGTATAAGTTGTTGGTTCCAGTTACACTGAAGTACATGC
CACAAGGCAATCTTGACCTTAGGTATAACCTGCAGTGCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGGTTCGAGGGCAGAAAGTCCTAGACTCTGGTGCACCCATCAA
AATTCCTGTTGGTCCTGAGACCTTAGGCAGAATCATGAATGTCATTGGAGAGCCTATTGA
TGAGCGAGGGCCCATCAAGACCAAACAGTAAGTACCAGTCTTGTCACATCAGTGGCATTC
TGTTGCACTTTGATTCATTGAGATTACTTACTTAAAATATTGATAATATGGACTGTGGAG
AGATGATAATGGTTACACAAAAAGCCTCACATGACTAAAGCTCCAGATTCAGTCCCCTGG
ACCACCATTAGCCAAAGCTGAACACTTTTATGGTTAAAAAAATAATAAAATGTTGATATG
ATCATTTTTTAAAAAAAGATTTTATTTATTAATGAGAAAGATAGGAAGAGAGAGAGAGAG
AGAACCAGGACCTCATTCATGCTTCAGAGTTCGCTGCCTTAGACACTGCGTCACCTCCCG
GACCACATTCAGTCATTTTTAACCAGTTATTAAAACCATATAATGTAGATTATTTTTGAA
TCAAGAGTATGCAGCAAAACTGCATAGAATCAAAGTTGATTTAAATAAGTTGTAATGCAG
ATCTTTGTATTTCCTGTTGGCATGTGAAAACAGTGCTGTTTATAACTCGGTAATGGTAAA
TATTTTTTTGTTTGGACCAGAAATTGAACTTACTCTTTTATTGAAATGTGTGTGCTATAT
CCCTGATCCAAGGAAAACCCCTGACGGTTAAAATTGTCAGGGCATTAACTACTGCTTTTT
GATATAATGAGATCCCCTTTATTGTAGAATATTATCTGTGGATAACTCACCAGGGTGATA
TAACACTATAGAAATAACATCCTAGGGCAAGGGATGGATGAATAGATATTGACCCTCTTT
GTACCATTACAGATATGCTCCTATTCATGCTGAAGCTCCAGAGTTCATAGAGATGAGTGT
CGAACAGGAGATTTTGGTTACTGGTATCAAGGTTGTGGATCTGCTGGCTCCCTATGCCAA
AGGTGGCAAAATTGGTATGTTAGTGGTGGGTACATAGTTTCCAAACAGTGTGGGGAGGAA
AATTTAAAATTTACTGAGTGGGTCCACCCTTCACTGATGAATTATATTCTGACTTTCGTT
CTTCTGAGTTTGCTGAAGCCAGATGTGATTCTGAGGAGGAAAACTTTTTTCACTCCTCCC
TGAGGTTTGCTTATTTGGGAATATAGAACCCTCAAATACTTTGATTAACTTTTTCCAGGA
CTCTTTGGCGGTGCTGGTGTTGGAAAGACAGTACTGATCATGGAGTTAATCAACAATGTC
GCTAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAGAGGACCCGCGAGGGC
AATGACTTGTATCATGAAATGATTGAATCTGGTGTTATCAACTTAAAAGATGCTACCTCC
AAGGTGAGCACAGAGCTGACTGATAACTAGCGAAAGTCATATTTTCTATTTGCCTTGTAG
GTATCTCAGTACCTAGAAAGAGAATTGATCTTGTTTCCCCCTCAACCTCTCCTATGTCAG
ATTGCATTCCCAGGGGGTGGTTCATAGCTCAGCCCTGTTTTAAGATTTTCACTTAACGTT
CCTTCTAGCTGTAGGAGTTTTGTCTTAGTAGTCTAATAAGGTATTGTGTATGTTTTGAGT
TGTAGCTTCAAAAGGGGAAATATATTTGTGAGCAAAATAGCACCTTGTGAAATGGAAGTT
TTGATAGCTTACCTGATTTGGGGACTTTGGGTATTACAGCTTCCATACTTAACCTGTCAC
CGTTTTTTCTTTATAATTTCTGCAGGTAGCACTGGTGTACGGACAAATGAATGAACCACC
TGGTGCCCGTGCCCGGGTAGCTTTGACTGGATTGACTGTGGCTGAATACTTCAGAGCCAA
GAAGGTCAGGATGTGTTGCTGTTTATAGATAACATCTTTCGATTCACCCAGGCTGGCTCA
GAGGTGAGAGAGGAATCTTGAGAGGACCTTTGGCTCATTTGACTTATCTGCTGGAATGAT
AATGGATGAGCCAAAAGATGAAGACATCTATTCTAAGACCTCTGTTTTTATCCTTTTTAT
TTTTATTTTTTAGGTGTCTGCTTTATTGGGCAGAATTCCTTCTGCTGTGGGTTATCAACC
TACCCTGGCCACAGACATGGGTACCATGCAGGAAAGAATCACCACCACCAAGAAAGGATC
TATTACCTCTGTACAGGTAAGAACAATTGAATGGATGGTCTTGTTTACATAAGAGTGTGT
GTAGTCTGGGCGGTTGCACAGTGGGTTAATCCGAACCAGCATAAGGATTCTGGGTCTAGC
CCCTGGCTCCCCACTTGCAGGGGGTCACTTCACAAGCAGTGAAGCAGGTTTGCAATTGTC
TTTCTCTTCCCCTCTCTGTCCTCTGTTCCTCTCAGTTTCTCTCTGTCCTGTCCAACAACA
GTAACAACAGTGATAAACAACAACCATAAACAAGGGCAGTAAACGGAGAAAAAAAAGGAA
AACCTCCAGTAGCAGTTGATTTTGATTTGTAGTGCAGGCACTGAGACCCTGCTATAACGC
TGAAGATAAAATAAAGTGTGTGTAAAGAAGTGTAAGACCAGGAGGTGGCGCACTGAGTTA
AGTGCACATATTACGGAGTGCAAGGACTAGTGAAAGGATCCTAGTATGAGCGCCAGGCTC
CCCACCTGTGGGGTGGGGGGTTGCAAAACAATGTAAGAGCAGTGGATTTGTAGTGCAGGC
ACTGAGCCCTAGCTATAACCCAGGAGAAGTGTAAGATGTAGTTACTGTGTATATCAAAAG
GCTTTTTAAAAAATACTTATTTTATTTTTGAGAGTGATGCAGAGAGATAAAGAGACAGTA
ACACCAGAGCACTGCTCAGCTCTGGCTTATGGTGGTGCAGGGGATTGAGCCTGAGACTTC
CAGAGCCTCAGGTATGAGAGTTTCTTTGCATAACCATTCTGCTGTTTACCTCCGCCCTCA
AAAGACTCTTGACTTGATTCATGAGGCCACTGAAGTTCTGTGTGAATGTTAAGATTTCCT
ATAAGGTTAAGGTTACAGGTCCATGAAGGATGATAGAGGACACAGTGGGGGTTGTATTGT
TATATGGGAAACTGGGGAATGTTATGCATTTACAAACTATTGTATTTACTGTTGAATGTA
AAACATTAATTCCCCAATAAAGAAATAAAAAACAACAACAAAAAAAAGGGCAACAAAAGG
GGGAAAAATGGCTTCCAGGAGCAGTGGATTCATGGTGCAAGCACTGAGCCCCAGCAATAA
CCCTGGAGGCAAAAGAAAAAGCTTCTATTCTCTCTCTTTCATACTGAAGCATATTTTTAA
ATAAATGAATAAAATGCAAAAACGAAAAAAGAAAAACAGTCATCAGGGGTCGGATATAGC
ATATTTGTTATGCAAAGACTTTCATGCCTGAGGTTCTCCACCATAAGCCAGAGCTAAGCA
GTGCTCTGGTAAAAAAAGAAAAAGAAACAAGTCATCTAAAGTAATTAAAGATATATATGT
AAATGCTGATCACAGAGTAGTGATGGGGGTCTAATTACATGGAAACTGGCCATAAAATGT
ATCTGAAGTACTTTTTTTTTTTCTTTTCTTTTTACTAGAGCACTGCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAATTGCCCT
GGACTTATCTACTGCTGAATAGCATTTCCAGAGAGTGGACTACAGCACTAAAATTTCCTA
TAGTAAGGCCTAGCCTAAACCTCAGTGTGTGCATGGGAAAAGCAGGCCCACTATGCAAGT
GACATTTTGCTGCAGCACACTTTTGTGATTTGATTTGGAGCAGTGGTGAGATTAACAACT
TTTTTTCAATTTTTTAATTATCTTTATTTGCTTACTGGATAGTAGAGACAGTCAGAAATT
GAGAGGGAAGGGGGAGATAAAGAGGGTGACAGAGATACCTGCAGCCCCTGCTTCACCACT
TGTGAAGCTGCAGGTGGGGAGCAGGGGCTCAAACCTGGGTCCTTGCACATTATATCATGT
GTACTCAACCAGGTGCACCACCACCTGGCCCCAGGAATAGTAATTTCTGTTGAGTGGTGA
GGTCATTTTTGTAAGTCTTACTAATTAATTGGAATGTAGTTTTACCCTTCACCACACTAC
AATAGGATAAGCAGAACAGTCATTAATCTTATTAGCAGAGGACCCTCATTACTGAGCATG
TAACTTCTCTACCAACTTGTTTCACGTAAGTTGTAGAATAAGATAATAAAATGCTTACTA
AAATGCAAAGTTCTTTGCAAATAAGAGGTTATTAATCCTGAGGGTTTTGCACTAGCTATA
GGAGTGAATATTCACTTAGACCTCTCAATTTTGTTTTCTCATAGGACTACAAATCCCTCC
AGGACATCATCGCTATCCTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGACTGTGT
CCCGTGCACGGAAAATACAGCGTTTCTTATCTCAGCCTTTCCAGGTTGCTGAGGTCTTCA
CAGGGCATATGGGGAAGCTAGTACCCCTGAAGGAGACCATTAAAGGGTTCCAGCAGATTT
TGGCAGGTGAGATTGATTATAAAGCTGAATGTCAAAAGACAAGCTAAAAATCTCTTGAAT
GCTGACTCTACTTGTATTCCCATAGCAACAACTATCAAACTGTATTTTATGCTTTTCTTG
CCATTGGGGCTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1574..1756, 2046..2220, 2986..3107, 3332..3516, 3899..3988, 3991..4056, 4187..4309, 6305..6517, 7818..8018
1001..1127, 1574..1756, 2046..2220, 2986..3107, 3332..3516, 3899..3988, 3991..4056, 4187..4309, 6305..6517, 7818..8018
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved