Erinaceus_europaeus Locus PRUNE
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus PRUNE
Erinaceus_europaeus
PRUNE
GeneScaffold_4622
SNORD24
15956..16036
54465
CCCACAGCAAGGCCTCAGCTGCGCAAGAATCACCTTCTCTTAAGTTTCTGGCTTGAGGA
GCAGGAGCAGCTGGAGTGTTGTTGACAGTAGGAAGTAAGGGGATGGGTTAATAAACGAGG
GATCATTTGATGATGAGAGTACATTGATTTGCAACTCTCTGGGCTCTCCTGGGGTTGGCA
GTTAAACTACATCCTAAAGGACCCTTCAAACTACTTACTGGGGTGCCACGAGATGCCGCC
TCCATCTGCTCAGAAGGCTGAAACCGCAGCTGGGACAGTTAGGGATGCTGGGAGCAAAGA
ACCCAAATTACGACAGTCCAGGGGAAGAGACTGGTCACAGCTGCAGATGAAGCAGGCTAC
AGTGTTGTAAGGAAAGAAGCAGCAGCAAGAAATTATAGGTATTTCATTTATTGGGGGCCA
GTGGTGATTCGAATATGTTTATAACACGGACAACCCCAAAACTGGTAGCAATAGGTCGGT
CTGGTATAGAGAATTTGAGAAGGGAAGAAGATGAAGCACTGTTTTGCGTCCCGTGTTTAA
GATGTCAACCGAATGCTCCGTGTACGATATGGAAAGATGCTATACTTAGCCTGACCCAAG
AGGGGGAAGTTCAGATGCCACAAAAATAGGTCACTGTGACACTTAGACATTTGTGCGTCC
TATGAGTGATCACCAAAACAAACAAACAAAAAAATTCTGCTTTTCAGCAAATTCTTGGGG
CCGTTTCGGAGCTTGACTATATTTCCCAGAGTGCCCCCGCACCCCGTCCCGGAGAGATTT
CCCGTGAGCCTCTGGGCTCAAGCTCCGCCTCCCTCGCTGGGGCGGGGCGACGTCGGGCTC
ATTACGCACTTCCTCCGGGGGCTGGGGGCCGAATGGTTGTGTGGCGGGTTCGAGTCCCGC
CCACTAGCTCTGGTCGCTGGCCCCGGGTGTGGGGCGGGGCAGGGTGCATTTGCCGGGTCC
TCTCCCTAGGCGTGGGGTGGCAGCGAATCTTGGGCGTCACCATGGAGGACTACCTGGAGG
GGTGTCGAGCTGCTCTGCAGGTAGCGGGTCCTGGGGTGCCATCGTAAGGAAGGGGAGCTT
GGGGGGCCGGGCAGGACGAAGGCGTTGGCGCTGGGCAGTCGCCAGGGTCTGCGGGGCGGC
GGATTTGGGATCTGATGGGCCCCGGGGTCTGCTTGTTGGGGGGCTGCCCGAGAGCGGGGC
GGTGGCGTGGGTCCGGGTTGTGCCTCCGAGCGCCCGCTCGCTGGTGCCTGAGTCGGTTGG
GTGCAAAGGTCCGGGGCTGTGCCGTCCCGCTGGGGGCCAGGTGCTTGGCTTCGCTTCTCC
CCCGCCCCTCTGTCGGCCCGTGGCCCCCTGGCCGGCGGGTGAACCCCGGGGGTGCCCGCG
AGCCTCGTCCTTCCAGACGAGACAGGGTCGCTCGCGGCGGAAAAGGGACTGTCGCCCGGG
AAAGGGACTGACATCTCCAGGTCTGTCAGTGGCCGGTGCCCGCGCGTCTCTGCTCGCCGC
GCACACCCGCTACATAAAACCCGCGGCCGGGCGGGCGGCTGGAGCACAGCGTGAAAACGC
AGAGCTTTCGGCCCTCTCCCAGGCAGCGGGGCTCAGGCGACCCCGGGCTGCGACACCCCA
CCCCCTCCTGGGCCAGGGAGGGACTCCAGGTCACCTGCCCCCTTTTCTTGAAGTGACACC
GCCCCTGTAGAGACCGAGAAGGAAGGTTGGCCGTGCCTTCCATTGGTGTTTTTCTAAAGA
TATATTTCATTGATGTCTTATCGCATAGAAAAGCCAGAGCACCACTCCCTTACTTGCAGA
GCTGCGGTAACACAGGGAGCCGCGGGCATGCAGGACTTCACTCTGTCTGCTAAACTACTT
CCCCAGCCTAGGTCGCCGTTTGTTTATATTTTCTTAAATTACAACCAGAGCGTAGCGGGC
ATATGTGATGCCGGGACTGAGCTCAGGACCTCGTGCTCATGAATCCAGTGCTTTATTTTC
TGCGCCTTTTTAAAAACATTTAATTTATTTATTAGAGACAGAGAAATTGAGAGTGGAGGG
GGCGATAAAGGAGAGAGACACCTGCTGCTCTGCTTCACCACTTGTGAAGCTTTCCCTCTG
CAGGTGGGGACCAGGGGCTCGAACCAAGGTCCTTGAGCACTGTAATGTGCGCTTAACCAG
GTGCGCCACCACTTAGCCCCCCCTCATTTTTAAAATTTGTTTTTGGATAAAGAGAGAAAT
TGAGAGAGAAGGGGGAGATAGAGAGGAAAAGAGACAGAGAGACACCTGCAGACCTACTTC
ACCACCTGTGAAGCGACTCCCCTGCAGGTGGGGAGCCGATTCTAACGGGTCCTTGTGCTT
TGCACCACATGTGCTTAACCCGCTGTGCTACCGCTGGACTCCCTGCCCGTTTTTTTTTTT
TTTTTTTTAGTACCTTACGCTCTACAAATTCTCCTGAGCAGTAGTCCTTTTTTATTTATT
CCCTTTTGTTGCCCTTGGTTTTCTTTCTTATTGTTGTAGTCATTGTTGTTGTTGTTGATG
TCGTCCTTGTTGGATAGGACAGAGAAAGGAGGGGAAGACGGGGAGAGAAAGATAGACACC
TGCAGACCTGCTTCACTGCCTGTGAAGCGAACCCCCTGCAGGTGGGAAGCCGGGGGCTCA
AACCGGGATCCTTACGCCAGACCTTGCGCTTTGTGCCACGTGCACTTAACCCGCTCCTCT
ACTACCCGACTGCCTGCAATAGTCTTTCTGTTTATGCCCACCCCCAGCATACTGTTCAGC
ACACTGTTCAACCTGGTTTATGGTGGTGCTGGGATTGAACCTAGGATTTGGGAGTCTCAG
ACATAAAAGCCTTTTTTTTTTTTTTTTTTGCTTAACCACTATGCTATCTCCTCAACCCAG
CAATAGATTCTTTAACAAATCTTTTTTTTTTTTAAATCACCCTGCAGATTCAGCTGCTAT
CATAAAAAGTGTAGTTTTGTTTTTCACACCAGTTACCAGTTATACCTAATTTTCCCTTGC
AAAGTACACACATTTGGGGAAAGTTATTTTAAAGCAATTAGATACGACCAGTTGGAAACA
ATTTTGTTTTCCTGTTTTCCCACTTTATGGCAGGGTGGGGGGAGGTTAATGGTTTACAGT
ATAGTTAACACATAGGTAGGTACAACCTAGGTTTCTTTTTATGATCACAGTAGTAAATGT
ACACACTGAAGATACTTAAATACAGAAAGTATGATATAATATCCAGGAAGCCTCAGCTCT
TATTTGTGTATGTGGTGCCTGTGCCTTTCTACCACTCCTGGGCCATCATTTTCATTCTTT
ATTTTTTTTAATTTTTATATTTATTTATTTTCCCTTTTGTTGCCATTGTTATGGTTATTG
ATGTCGTTGTTGTTGGATAGGACAGAGAGAAATGGAGAGAGGAGGGGAAGACAGAGAGGA
GGAGAGAAAGACAGACACCCGCAGACCTGCTTCACCACTTGTGAAGCGACTCCCCTGTAG
GTGGGGAGCAGGGGGCTCGAACCCGGATCCTTAAGCCCGTCCTTGCACTTTGCGCCACGT
GCGCTTAACCCGCTGCGCCACCACCCGACTCCCGATTAAAAAAATTTTTTTTATTAATAT
TTTGCCTCCAGGGTTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGCCTATTGGGTG
AACTCTTTCCTGGCCCCACATACTATCTCTTAGGGCAAGAAAGATATTATCAGGCTGAGC
GGTGGTGCATCTAGTTGAGCACACACATTACCATGTTCAAGAACCCAGGTTTAAACCCCC
AGTTCCTACATGCAGGGGGGAAGCTTTAACTAGCTCTGAAGTAATAATGCAGGTGTTTTT
CTCTCTCCCTTTCTAGCTCCTCTCCCCTCTCAACTTCTGTCTATCTTATGAAATAATAAG
TTAATTAATTTAAAATTAAAGACATGGTGGGTGGGTGGTGGCGCACCGGTTTAAGCACAC
ATATCTGGGTTTGAGGCCCACTCCCCACCTACAGGGGGGGGCTTTCACAAGTGATAAAGC
AAGTCTACAGGTATTTATCTTTCTCTCTCTCCTTATCTCCCCTTTCCTCTCAATTTCTGT
CCTATCAAGTGTAATAGAAAGGGGGGGGAGAGGGAAAAATGGCCACCAGGAGTGAATTCA
TAGTGCTGACACTGAGCCCTAGAGATAATCCTAGTGGCAATTAAATTTTTTTTATTTTTG
AAGACATGATTAGACAGAGACACTGAAGTTGGGTAGAACTGTCAGGGGATTGTAATGCTT
GGCTTTTAGACAGGATAAGAACAGCTGGTAACCCCCCAAATTTCCTGTCGATGCCATGTT
TTCAGCAACTGATAACCAGGGACATTTTCTGTAGCCTCTGCCACATTGGTAGTAAGATTT
TCCATCTAAAAGGAATTCTATTGAACTTTGTGTCCTCTTTGGAGTGACTCATCCTTTGGT
CCTGGGGGAGGAGACAGGAGGATCTTTGCCCAGGGTGGGGCCACATTTGAGTCTCATCCA
GAAGCCCTTGGGTGTCTGTATCCCACTCACTGTCCAGGGAGAACTTGCAGTGTTCTCTCT
TCTGGGAGGGTATCTCTGGTTCTGGCTCCCTGATTCATGAGTTTTGTCCCTCCTTTATTA
ACTATTTTGGAGGGTAGGCACCAGACCACATTTGCCTTCGAAGGGAAGTGGCTTACTTTG
CCAGCCTTGAGCCTGTCGCCTCCCCCATGGAGGCCACAAAGAACACCAAGATCAGTCATT
TCAGCCTGTGGATTTTTTTTTTCTTAATTATTTATTCCCTTTTTGTTGCCCTTGTTGTTT
TATTGTTGTAGTTATTATTATTGTTATTTATGTCATTGTTGTTGGCTAGGACAGAGAGAA
ATGGAGAGAGGAGGGGAAGACAGGGGGAAGAGAAAGATACACACCTTCACCATTTGTGAA
GTGACCCCTCTGCAGGTGGGGAGCTGGGGGCTCGAACTGGGATCCTTACGCTGGTCCTTG
CGCTTCCTTCGTGCCACCTGCGCTTAACCTACTGCGCTACCACCGGACTCCCAGATTTTT
TTTTTTTAAAGGGAAAGATAGAGAGGCAGAAAGAGAGAGTGAAAGAGACGATAGCATCAA
AGCTTCCTTCAGTGTGGTGGGGGCCAGGCACATGGCAAAGTAGCACTCTATTCAAATGAA
GTCTTCCACTGGCCTTGTTTTTTTTTTCTCTCTCTCTTAATAACAAAACAAACAAATAAA
ACTTAAAAACAAACTGATTCTCAGAATTGGAGGAAGCCATAGGTATTATGAACTAGCCCC
ATCCTTCATAATGGACAATTCCTTGTCCCTCAAGATATATGTTTCATTGTATTTAAAAAA
TAAAAAGAAAAGAAAAGGAAAGAAAAAAAGAAAANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTAGGCCTGCTGCTTCTGGATGGGGACAAAGTGCAGAGCTGAGAATGTGCACATCATG
GTTTGTCGGGGTAGCTGGACAGACCAGTCATCCCCAGGCGCTGTGGGCACTGCTACACGA
GAAGAGTAGACCTCCTCTCTTGAGCTCTTTTTTTTTTTTTTAATTTATTTATTAGAAAGT
TGAGAGAGAAAAAGGACCAGACATCACTCTGGTACATGTGCTGCTGGGGATCGAAGTCTG
GACTTCATGCTTGAGAGTCCAATGTTTTACCCTCTTCACCACCACCCAGACCACTGAGCT
CTTTTATTATTAATTACTGGTGATTTAATATTGGTTTGCAAAATTACAAGATAATGGGAA
CAATTCCACACTGTTCCCTCCACCAGAGTTTTATGTCCCTAATTCCCTCCATTTGAAACT
GCAGTGGTTCTCCCAAGGTCACAGATGTGGGTTGACTGTTATTTCTACATCTATCTAAAA
TTGTCCCTTGGTCCTGCCTTCTCTTCCTTTCTAACTCACACCTACACCTGTTAGTACTTC
CAAATGTCCTTCCTTTTTTCCCTCCTCTCTCTCCGTGTCTTGATGGAATTGGGTTTCAGA
GCCTTCTAGTCATCTTCCCCTAACATTTCTCCCCCTCTGCGAGTATGGACCAAAATTATT
TTGGGGTGCAGAAGGTGGGAGTTCTAGCTTCTGTCCTTACTTCTTCACTGAAGCTCTTTT
ACTTTTTAGATTTTTAAATTTTTCTTCTTTGTGTTGTATAGAGACGCATAAATTGAGGAA
GGAGATGAAATAGAAAGGAAGAAACACTTGCAGCACTGCTTCACTACTCTTGAAACTCCT
CCCATTCCCCCTCCCGAAGGTTATGGGAATGTGAGAGTAGGTCCTTGCACATGATAATGG
AGGCACTCTACTGGGTGCTTCACCACCCAGCCTTTTATGCTTTATTTATTTAATTATTTA
TTTTTACTAGAGTACTGATCAATTCTGGCTTATGGTGGTGTAAGGGATTAAATTTGGGCT
TTTGGAGCCTTAGGCATGAGAATCTCCTTGCATAACCAGTATGCTCTCTACCTCCTCCCT
TTTATTTACACATTTATTTTTAATACTATTTTTTTTATTGTTGTAGTTATTGTTGTTGTT
GATGTCATCATTGTTGGCTAGGACAGAGAGAAATGGAGAGAGGAGGGGAAGACAGAGAGG
AGGAGAGAAAGATAGACACCTGCAGACCTGCTTCACCGCCTGTGAAGCGACTCCCCTGCA
GGTGGGGAGCCAGGGTTCGAACTGGGATCCTTATGCCGGTCCTTGTGCTTTGCGCCACCT
GCGCTTAACCCGGCTGCGCTACAGCCCGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCCTTTTGTTGCCTTGTTGTTTTTCATTGTTGTCGCACCTTATTAATTGT
TGTTGTTATTGATGTCATCGTTGTTAGATAGGACAGAGAGAAATGGAGAGAGGAGGGGAA
GACAGGGGGAGAGAGAGATAGACACCTGCAGACCTGCTTCATCGCCTGTGAAGCGACTCC
CCGGCAGGTGGGGAGCCGGGGGCTCGAACCGCAGGTCCTTGCACTTTGTGCCACGTGCAC
TTAACCCGCTGCACTACCGCCCGACTGCCTGCAATAGTCTTTGTTTATGCCCACCCCCAG
CATACTGCTCAGCACACTGTTCAACCTGGCTTATGGTGGTACTGGGATTAAACCTAGGAC
TTGGGAGTCTCAGACATAAAAGCCTTTTTTTGCTTAACCAGTCCCTGTGCCTTGCGTCAC
CTTTGCTTAACCTGCTGCGCTAACGCCCGACTCCCCAGCTTTTTTTTTTTTTAAGGATTT
TATTTATTCATGAAGAAGATAGGTGGAGAGAGAAAGAACCAGACATAACTCTGATACATG
TGTTGCCAGGGATTGAACTCGGGACTTCATGCTTGAGAGTCCATTCTTTTTTTTTTTTTT
AACATTTGTTTGTTTGTTTGTTCGTTCCCTTTTGTTGCCCTTGTTGTTACTGATGTCGTC
ATTGTTGGATGGGACAGAGAGAAATGGAAAAAGGAGGGGAAGACAGAGAGGGGGAGAGAA
AGATAGACACCTGCAGATCGGTTTCACCGCTTGTGAAGCAACTCCCCAGCATGTGGGGGG
AGCCAGGGGCTGGAACTGGCATCCTTAGGCCGGGTCCTTGCGCTTTGCGCCATGTGTGCT
TAACCCGCTGTGCTACCACCGGACTCCCAAAAGTCCATTCTTATATCTGCTGCGCCACCT
CCTGGCCCACTCCCTTTTATCTTTTTTTTTCTTTTTTAAATATTTATTTATTCCCTTTTG
CTGCCCTTGTTTTTTGGTTTTTGGTTTTTTTTTTTATTGTTGTAGTTATTATAGTTGTCG
TCGTTGTTGGATAGGACAGAGAGAAATGGAGAGGGGAGGGGAAGACAAAGAGGAGGAAAG
ATAGACACCTGCAGACCTGCTTAACCGCCTGTGAAGTGATTCCCCTACAGGTTGGGAACC
GGGGGCTCAAACTGGGATCCTTACTTGTGCTTTGCACCACATGCGCTTAACCCGCTGTGC
TACTGCCCAACTCTCCCTTTTATCTTTTAACAGAAAGATTATTGTGTGTATGTATATGTG
GAGGAGTAGAGAAGGGCAGTTGGTGGTGCACCTGGTTGAGCACATTTGTTACAATATGCA
AGGACCCAGGTTCAAGTCCCTGGTCCCTGCCTGCAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAGATGGTGAAGCAGGTCTGCAGGTGTCTTTCTCTCCCCCTCTCTGTCTTCCCCTCCTC
TCTCCATTTCTCTGTCCTATCCAACAACGACAACAATGATAACTACAACAATAAAACAAA
AAGGGCAACAAAAGGGAATAAATAAATATTAAAAAGAGAGAAAGCACTGCTCCAGTACAT
GTGCTACTGGGGATTGACAAGACCTCACATGTACAAATCCAGCATTCACTCTTGTTCCCA
AATTTGCTCAGAGTTTGAGAGAACTTGTTGTGTATTGGTTCTTTTGGGCTGCTTTCTGGG
TGAAGTCCAGCATAAGTTAGTTTATTTTGCATACTTGCTTCTCACCTCCATCAATAAGTT
ATGCTTGATCCTTTTTGCTTTCCTTAAAAAAAGTGTATTTATGGGAGTTGGGCAGTAGCG
CAGTTGGGTTATACGCAGGTGGTGGAAAGTGCAAGAACCGGCATAAGGATCCCGGTTCAA
GCACCCGGCTCCCCACCTACAGGGGTGTCGCTTCACAAGCCTTGAAGCAGGTCTTTCTCT
CTCCCTCTCTGTCTTCCTCTCCTCTCTCCATTTCTCTCTGTCATATCCAACAACGACATC
AATAACTACAACAATAAAACAAAAAGGGCAACAAAGGGAGTAAATAAATAATTTTTTTAA
AAAAAGACTATTAACACTAGAGAAAGAGAGAACACCAGAGCACCACTCTAGCACATGGAT
GTTAGGTATTGAACTCAGAACCCCATGCTTCCAAATGTAGTGTCCTCCTCACTGCAGTAT
TTCCTGGGCCCTCTTTTTTTTTGAGTCACATTTCACACTTATTTTTCAGTTTTCATTTTT
CTTTTTTTGTAAACAAGTGATGGGTGAAGGAACGCAACACTGTAAAATCACATTCAAGGA
TTATTAGACTTATGCTTCAACCGGTCAAAATTGGATTCCTTAATGTTGTCTCGCCATAAC
ATGCAAAACATGAACTTGTATTAATCCTATATAATAAATTTATCATGCACTGTATCCACA
AAAGGTTGGAAAATCATGCCAGTTTCTGGAATTTAAGTTTTGTTGTTGTTGTTGTTGTTG
TTTTTCCCAGAACTCTTTGTTCTGGCTTGGGACTGAACCTGGGACCTTGGAGACGCAGGC
GTGAAATTCTTCAAGTATGACCATTACATTGTCCTTAGCCCTGGGCCCTTCTTTTTGCTT
TTCCTTTCGGTCTCCTCTCCATTCTGGTTTCTAACTGATCTGATCCCAACTCAGATGCCA
CTGGGGATGAGGTGGTATGTATGAGTAAGAGTGGGAACAATGTTCCAAGGGTCCTTGAGC
CCAGTGACCCGTCTCTCTCCCCTGGCTCTACTTCCTCTCTGTCTGCTCTGTCCTTGTTTC
CCCAGAGGCAGAGCCATATGGCCTGGCATGTTTGCACAGCTCCCTGGAGAACACAGCACA
CAGACTTTCCCATGCACTGAATAAGTGCTCTGGGCAGTCCCGTTACCTTGAGTGCCTCAC
TCACTTTAGGTCCCAGCCATCTGGGCAGTTCTCGGTAGCCAGGTAACAGAGGGGCCTTCT
TGGGTGTCAGGAGGAAGAATTGCAAGTCAAGAGTTACCATTAGAACTGGGAGTCCTCTAT
AACAACAACAACAGTAATAACTACTACAACAGTAATTTTTAAAAAGGGCAACAAAAGGGA
AAATAAATAAAAATAAAAAACTGAGAGTCCTAGGTATAGAACTCTCAGTGTATTTGGAAA
AGGGTTTCATATGAAAGGTGCCTAGCTCACCTAGTAAAGCACACCTACTGCCGTGTTCGA
GGACCCTGGTTTGAGAGAAAGAGAAGCAGGCAGAGAGGGAGAGCCACCACGGCACTGCAC
CATCATCCATGGAGCTTTCCCCAGTATCATGGTTCTCCCAATGGTGCTGGGGATTGAACA
GTAGCCTCCCACATGAGAGGGCTGGGGCTTTGTCAGATAAGCTATTTCCTGGCCCTGTAG
GTATTGCTTGTCATGAGTGGGGTGCTACTAACATTAGAGAGTGGAGTCTACCGTTCTGAC
TTCTCTGGGCAGACAACCCTACCTATGTGTCCTAGATCCTCGCACCTCCAGAGCTCTGGT
CCACTAGGGAAAGATAGAAACAGGCTGGAGGATGGATTGACCTGTCAACACCCATGTTCA
GTGGAGAAGTAATTACAGAAGCCAGAACTCCTACCTTCTGCTCCCCAAATACAACCTTGA
TCCATACTCCCAGCAGGGGAGAAGTGATAGGATGAAGATAAGAGGACTCTGCACTCCAGC
GCCATCAGCATCCAGAGAGAGAGAAGGAAAAGGAGAGGGACATATGGAGGTAGTTATGAT
GTCATGAGTGCCTTGGAGGGGAAGAGAGGGTTGGATCAGGAAAATGGGCAATTATGTATA
AATATAGACAGTTGTAGAGATGATGGTTGACCCTTAGGGGAACTGTGGTGGATTGCAGTG
GGGAGACTGAAGATTCAGAACTCTGGTGGTGGGAATGGTGTGGGTTCAAACCCCTGTTGA
CATGTAATTTTGTAAAATAAAAAAAATTAATAAAAAGAAGAGAGTGGAGTCCAGGGATGT
TGCTAGACATACTGTAGTGGCCAGGACAGACCTCCACAACAAAGAATTCTGTACTCCCAA
ATGCCCATAATGCTGAAATTATACTCCAGAGTTCCAGGTTCAGTCCCTGGCATCACCATA
AGGCAAAGCTGAGCAGTGCTCTGGATGAAAAGAAAAGAAAAACCCAGATATAACCAGTGA
GACTCACTTAAATATTTCTTATCCCTTCCTCTTTCAGAATAAGACTGACATATAGGTTCA
GAAAAGCAACTTTCTAATTCATAGCGATTAGGCTGAGCTATAAACTTTTTAAATTTATTC
CCTTTTGTTGCCCTTGTTTTATTATTGTAGTTATTGTTGTTATTGATGGATAGGACAGAG
AGAAATGGAGAGAGGAGGGGAAGGCAGGGGGAGAGAAAGATAGACACCTGCAGACCTGCT
TCACCACCTGTGAAGCAACCTCTCCTGCAGGTGGGGGAGCCAAGGCTTGAACTTGAATCC
TTACGCTTGCTTGCTTGCTTCCTTGCACTTTGCGCCACCTGGCCTTAACCTGGTGTGGCT
ACCATCCCAACTCCGAAACTTTTTTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTGAAA
TACTAATTTTCCCCACCAGGGTTATTTCTGGGATTCAGTGCCTGCACAACTCCCAGCATT
CAGTGGATATGTATATATGGAGACAAAAATAAAATGGTAGAAAGGGACAGAGACAAACGC
AACACTGCTCATAAAGCTCTCTCCCTTCCAGATAGGGAGGAGGTGCTTGAACCCATGTCC
TTGTACATGGTAATGTGTGCACTCTACCACGTGAGCCGCCATCCAGCTCTGAAAATCATA
CTTCTATTTATTTATTTAGGATAGAGACAGAGAAATTGAGAGGAAAGGGGGAGATGGGGA
CAGAGAGAGGGGAAGGGAGAGAGAGATACAAAATTGCTTCACCACTTCACTGCTTATGAA
GCTCCCCCCATGCAGGTGAGTACCAGGGACTTGAACCCAGGACCTTGCATACAGTAGTTG
TGCCCACGGCAAGTGCTCCATCACTTGGCCCAAAACAGTAGTTCTTTTTTTTTTTTCTTT
TAATTTCTTCATTAGGGGATTAATGTTTTACATTTGACAGTAAATACAGTCATTTGTACA
TGCATAACATTTCTCAGTTTTCCACATAACTACAACCCCCCACTAGGTCCTCTGTCATCC
TTTTTGGACCTGCACTCTCCCCCGACCTACCCCAGAGTCTTTTTTACTTTGGTTCAATAC
ACCAACTCCAGTTCAGGTTCTACTTGTGTTTTTTCTTCTGATCTTATTTTTCAACTTCCG
CCTGAGAGTGAGATCATCCCATATTCATCCTTCTGCAAAACAGTAATCCTTAAAGTATGC
TATCATGAGGCTAGGGAGAACAGTATCTAGTTAGTAATGGACATCAGATATATCAAATAC
ATCAAATATCCCAGGCTCTCTTCTCAAAAATCAAAAGGAGCATAAGAAAATTAGAGAACT
GGGGCTGGGTGGCAGCACACCTGATTAAGCACACACACTACAGTGCACAAGGGAACTGGG
GTTCAAGCCCCCCAGCCCTCACCTCAGGGGGAAAGCTTCATAAGCAGTGAAGCAGGGCTG
CAGGTGGCTGTTTGTCTGTCTCTCTCTCCCTTACTTTCAATTTCTGGCTGTCTATCTGAT
AATAAGTAAAGATAATAAATAATAATAAGAAGAAGAAGAAGAAATTAGAGAACTATGGCC
CAGGAAGTGGTGCAAAGTCTAGAGCTTTGGACTTAAAAAACTGAATTCCCAGTTTGATCC
CTGATACTGCATATGTGCTAGAGTGATGCTCGGGTTCATCTCTTTCTTTCATTACTATTT
AAATCTTTTAAAAAGTATTTTCTTTATTTATTAATGAGAGGGATAGAAGGAGAGAGAGAA
AGAACCAGGCATCACTCTGGTACATGTGCCGCTGGGGATTGAACTCGGGATCTCATAGCT
TGAGAGTCCAACACGTTATCTACTGCGCCACCTCCCGGACCACTAGTTAAATCTTTAAAA
AAAGAGAAATTAGGGCTGGGGATCCAGCATAATGGTTATGCAAAAGCCTTTCAAGCCTGA
GGCTCTGAGGTCCCAGGTTCAATTCCCAGCACCACCATAAGCCTGAATTGAGTAGTGTTC
TGGTCTAGGAAAAAAAAAATTAGAGGGCTGGGGAGACAACAGAATGGTTATGCAAAAACC
TCTCATGCCTGATGAGGCTGTAAGCTCCCAAATTCAATCCCCAGCACCATCCTAAGCTCT
GGCCTCTGTATCTCTCTGTCTTGTAAAATAAATAAAATGTTTAAAATAAAAAAAAAAACA
AGAGAATGATTTGCTGTTTTCAGTAATTCAACACTGAAGAAGTCAGTGTGATCGAGAAGA
AAGCGTACTTTTCCGTTAACTGTACATATGTGGAATTCTTAGACTTTAAGACACATTGGG
TCTTTTAAGCTAATAATAGCCTCATCCAGAAATGAGCACCCAACGCTAATGTGATCTCCC
TTCTCTGCAGAGAGCAGTGAGCAGATGTGCATGAAGACTGCTATAAGATAAGGTAAATAA
AATTAAGTAGAAACACTTTGCTTAGTTTCCTCCTCTCCTTCCTCTCCAGGAGTCCCGACC
ACTCCAAGTGGTGCTCGGAAACGAAGCCTGTGACTTGGACTCTGTGGTATCAGCTCTCGC
TCTGGCTTTTTACCTGGCAAAGGTGAGTCCTTAAGAATAGAGCTCTGGGAGGGGCCTGGT
GGTGGCATACCTGGTTGAGTGCACACATTACAGTGCACAAGGAGTCAGGTTCAAGCCCCC
ACCCCCCCACCTGCAGGGGCAATGTTTCACCAGTGGTAAAGCAGGGTTGCAGTTGTCTCT
CTGTCTCTCTCTTCCTTTCTATCTCCCCTTCCCTCTTGATTTCTGACTATCCAATAAATA
AATAAAAAAATTAAAAAAAATAAAGCTCTGGGGTGCTTGCTTCTGGGGTGCAGTACATAT
GAAAATTGGAACAATACAGAGAAGATTAGCATGGTCCCTGCACAAGGATGTCACGCAGTT
TCGTGAAGAATAGAGCCCTGTGGCCAGGCAGTGGTATTTCCAGTAGAGCATGCATGTTAC
CGTACACAGGGACCCAGATTCAATCCCCTAGTCTTCAGTTATGGGGGCACCAGACGGAGC
TTCATGAGCAGTAAAGCAGTGCTGCAGGTGTCTGTCTCCCATCCCCTCTCAATTGTTTAA
TCCAAAAATAAATAATAAAATACTTAAAAACCAAAAACACAAAGTCTCTTAGAATGAAAA
GATCTGGGGCCAGGGAGATAGATTACACAGTGGTTATGCAGAAAACCTTCATGCCTTGCA
GAGGATGTGAAAGAATATTTGCTATCTGAGAGATAGTGATGACATTCCAGACCAAAATAA
AAGAAAACTTTAATGCTTGAGGTTCTTAGGTTCAATCCCTAACATCATGATAAGCCAGAA
CTGAGCTTAAAAAAAGAACTAGAACTGTTAAAAAAAAAAAAAGGGGGGGGGGTCCAGGCA
GTATTATATCCAGTAGAGCACACACATAATAATGCATGAAAATCTAGGTTTGTACCCCTC
CCCTGTCTCCCCACCTGTAGGGGGGAAGAAACTGCTTAAGCTCCCCCCTCCCCAATTTTC
TGTCTCTATAAAGAAAAATGTATGGGAGAATAATGGCCACTGACTAGGAGCAGAGGAGTC
CTCATGTAGCCACCAAGTCCCAGCAATGACCCTGGTGGCAAAAAAAAAAAAAAGATCTTT
TAAATAAAATATCTGAATTCAAAACTCAACTCTGCTACTTTATACTAGCTAGCCTTGGGT
AAGTCAAATCCATTAACTTTTCTGAATCTCATGTCACCATCTGAAATAATAACAGTTCGC
ATTTCAGCTCTGAGGATCAAATGTGCAAGTACATTTTGAAGGATTTGTAAAGCATAAATA
ATATTCAAGCCGTTTGTTAGAGAGTGTTGGGCAAGAGTAATACAGTGTAATCTTTCCCAG
GTCAGAATCGGAACCGAAAATTCCATCTCTACAATTTCCAAAACTATTTTTTCGTGTGTT
CTCTTCCTGACCCTCGGCATTGCTAAGCAGGGCAAGAGCTATCGTTTCATTTCTGTGGAC
TAGGTGATTATAGCTTTGTGAAAGGTCATGGGTTCACCTAAGATAATTTCTCCCCAGTCC
CAATAGTCTTACTATTTCTCCTGCTAACTCCATAACATCGTCATATCTTTTCCACTTCCC
TATGCAGACAAATGAGGCAGAAGAAATCTTTGTGCCAGTTTTAAACATACAGCGTTCTGA
GCTATGTCTTCGAGGTGATGTCGTCTTCTTCCTTCAAAAGATCGGCATTCCAGAGTCCCT
CTTGATTTTCCGGGATGAGATTGATCTCCATGCATTGCACCAGGCTGGCTGGCTCACCCT
CATCCTTGTTGACCACCATGTCTTACCCAAGTAGGTGGGAGGCAGTTCAGCTGACCCTTT
CCAGGTGTCAGGTTGAGCTTCGTTGGAAGGAACTGAAAGAGAAAACATGCTTGCTTTCAG
GGATCTCACAGGCTAATTATAATTGATGGGATACATCTACTGTAGAGAATAAACATCATC
AGTTCTGCTGTAATGCCGGCATTAGAAGGAGAAACATGGAGAGTACAGGCTGGGGGCAGG
GGTAGATAGTATAATGGTTAGACAAAGAGATTCTCATGTCTGAGGTTCCAAAGTCCTAGG
TTCAATCCCCTGCACCACCATAAGACAGAGCTGATCAGTGCTCTGGTAAGAAATAATAAA
AATAAATAAATAAAAAAGAATATGGGCTGGGTAGATAGCTGAAGGTCTTAGGACTTTCAT
TTTGGAGGGGCCAGGTTTGATCCCTGGCATCTCATATGACAAAGCTGACTCTGGCCGCTT
TGTTTTTAAAAATTAATCTTGAGGCCAGATGGTGGTGCACCAGGTAAAGTGCATATGTTG
ATGTGCAGGGATTGGGTTCAAGCCCCTGGTCCCCACCTGTAGGAGGGGAAGCTTCACGAG
CAGTGAAGCAGTACTGCAGGCATCTTTTCTTTTTCTCTTCCTCTCCATCTCCCCCTGTCC
TCTTGGTTTCTCTATATTTCTATCCTACAAATAAAAAACGTGTATCCGGTTTGAGCTCCC
GGCTCCCCATCGATAAGGGGGTTGCTAAAGAGTGAGGCAGAAATCAGGTGTATTGGGTGC
GTTCCGCTCATCCATCGTTCGTCTCTCGGTTGTTCTCTCCAAACTGATCAATATAAAAGA
AAAAACGGAGTGGGGGGAGGGGGGGGAAAGGGCAATCGCCCAAACCGGTCTGCGCCGAGC
GCCGCAAGAGAGCTGCACGACGTAACAAGGCCAGGGGAGAAGAGAGTCAATTAAGAGCGT
TACAGTGAGGGATAGATATGAGAGATAGAAGAGAGGCAAAAACTAGCGGACTGGGGGAGA
GACTAGAGATGAGCATCAGGGTGATGTACAGAAGGAACAGAATACTAATTCCGAGTCAGC
TCCTTCGACACGGAAAGGGGAGGGAGGCTCGAAGGGAAGATTATAATGCCAGCAAGGCAG
GACCTCACCGAGCCGAAGGCAGCAGGAGAGACCGAAGAGAGGAAAAAGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTTTTTAAAAAAATATTGGATTTATTTATTCCCCTTTTGTTACCC
TTGCTGTTTTATTGGTTGTAAGTTATTACTATTGAGGTCGTGGTGTTGGAATAGTAGAAG
CGAGAAGGAGAAGAACAGATGGGGAGAGACAGATAGACACCTGCAGACCCTGCTTCACTT
GTGAAGCCGCTGCTCAAATCGGGATCTTTGAGCCAGTCCTTGTTCTTTGTGCCACGAGCA
CTTACCCCACTGCACTACTGCCCCACTCCCTCTCTTCACTCTTCATTCCTCCATCTCTAT
TCAAAATAAACAATTTCAAAAATGTTTTTAAAATGTAATTGAGACCTTCAGTAATGGTTG
TAATCTGATTTTCTAATTTTGAAGAGTTAGCAAAATTACTTCCTACACTGGGCAATATTT
GGACAGTGTCTGTTTAACAAATCTATGTGGTATAATGATTCGATCTTAATTTAGGACTGG
GAAGAGCTGCCAGCAAAGCCTCATAAGTGTGAGAACTTGCTATGTGTCTGACTTCTGTAG
ACATAGTCAGACACATGCTAGTGTGTATATATTTATTCCTTGAGCACACTGGGTACAGCT
GGCCATCAACAGAGCGAGGCATGGGGCCATTCATCCAACTCTCTAGTCATGCGTTAATAA
GCATTCTTAATTTTAATATCACTGTGTTCATCTATTTATTTATGCACTTATTTTGTGTGG
AGCAGGGACCTCATTTATGCACCACTTCACCGCTCTAGGGCACCACCTCATTCAGACAGT
GCCATGGGAAGCTCCCCGATGGTGCCAGAGCCTAGGCCACATGCACAGCAAAGAATGTGC
CTGACCTATTGAGCTATCTCTTCAGCCCTGCTTCCAGTCTTGAAAGATGACTTGGTATTT
GCTCAGGCAAGAGGGAAGTAAGGTAATGAGAGAAAACACCCAAGGAGAGAGAGAGCAGTG
CACACTTGCAAAGGCAGGCAGGCATGAAATGGCATGGGGAGCTGGAATTAGTTTGGTATG
ACTAGAATGTAAACTATGAGGGAGAAGTGAGACAGGGAAAAGATAAGACGAGAGTGGGGT
TTAGGTCATGGAGGTCTTGTTGGCCTGCCAAAAAGACTGGACTTTATTTTCAGAGAGTAG
AGAACTGTTGTTATTCATTATATCTGGTCCAGAAAAGTCATGCTATATATATATTTTTTT
ATCTTTTTCTGTGCAAAAATGTGTCATGATTTTTCCAACAACCCTATGTATACTCCAGGT
CACAATAAAATCGTGTTGGTTTTTTTTTTAAGATTTATTACCTTTATTTAATATGAGATA
GTATTTCCCATGAAAGAAAGACAGAAGTCAAAGCACCGCTCAGGCACATGTGATGCCCAG
GACTAAACTGGGAGCTTCAGGCTGGCAACTTCCTTCCTATACCGGTTGAGCTATGTCCCC
AGTCAAATGCTTGCACTTTTCAAATGATTTGTGAAGGACACCTTAAGAGGGCCCAAGACT
GGAAGCAGATCTTTGGAAGAAGCACTTGGAGTGTGACCTGGGAGGTGGCCCACTGGATAA
AGCATTGAGTTCTTGAGCATGAGGTCTTGAGTTCAATCTCCATTCATTCTCTCCCTTTCC
TCCTTTAATAATAAATAAATATATATTTTTAAATGTTTTATTTTTGTAGCTATTGTTGTC
CTTGTGTTGGATAGGACAGAGAGAAGAGATGAGGGGAAGACAGAGAAAGATAGACACCTG
CAGACCTGCTTCACCACCTGTGAAGCGAACCCCCTGCAGGTGGGGAGCCAGGGGCTCGAA
CTGGGATCCTTATGGCGGTACTTGCGCTTTGCCACCATGTGCATTTAACCCACTGCGCTA
CCACCCCAACCCCTGCAAATGCATTGTTCTAGGGCACTGTTCCACTTCCTGGGCTACTCT
GGTCTTTCTCCATGGATCTCTTTTTATTTCATAAAANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGAAGCAGGTCTGCAGGTGTT
TATCTTTCTCTCCTCCTCTCTGTCTTCCCCTCCTCTCTCCGTTTCTCTCTGTCCTATCCA
ACAACGATGAAAACAACAATAATAACTACAACAATAAAAAACAAGGGCAACAAAAGGGAA
TAAATAAATAAAATAAAAATAAAATATTAAAAAAAAAAAAAAAGAAGAAGCCAGAGCTGA
GCACTGCCTGCCCCCAACCCCTCTCTTAAAAAAAAAAAAAAAGAAAGGAAGAGTTGGAAT
GGCTCAGCTAAGGAATATTAAGGACCTAGAATAAGGCAGTAGCAGAGGTTAGAGAGGAAG
AAATGGATAGAAATTGGGAGAGGAGCCAGGCAGTTGCGCACCTAGTTAAGTGCACACATT
ACTGTGCATAAGGACTTGGGTTCAAGCTCTTGGTCCCCACCTACAAGGGAAAGCTTCATG
AGTGGTGAAGCAGGACTACAGGTCTGTCTCTGTCTTCCCCCCCATTTCTCTCTCTTTTCA
ATAATAAAAATATTTTTTAAAAGATTTTATTTATTTATTTTGCCTCCAGGGTTATTGCTG
GGGCTCGGTACCTGCACTACAAATCCACTGCTCCTGGAGACCATTTTTCCCCCCTATTGT
TCCCCTTGTTGTTTATCGGTGTTATTGTTACTATTATTGTTGTCCTTGTTGTTGGATAGG
ACAGAGAAATTGAGAGAGGAGGAGAGACGGGGAGAGAAAGACACCTGCAGACCTGCTTCA
CCGCCTGTGAAGCGACTCCCCTGCAGGTGGGGAACCACCTGGGGCTCTCTTGTGCTTTGT
GCCACGTGCGCTTAACCCACTGCACTACTGCCCGGCCCCTAAGATTTTATTTATTTATGA
GAAAGATAGGAGAAAGAACCAGACATCACTCTGGCACATGTGCTACCGGGGATCAAACTC
AGGAATGCTTGAGAGTCCAAAGCTTTACCACTGTGCCACCTCCCAGACCACAAATAAAAA
GATTATCAAAATGTTAAAATAAAAAAAAAAAAGAATTTTGGAGAAGGTAGTGTGTCTCAG
ACAAAAAATAGAAATAATCTAATGAAGAAATTGGGAGAGAAACAATCAGATCTGGTTACC
TGCATGATCTGGATTTTAAATGGATTGAGGAAACAGAAGAAATGTGTATGCTGGGTATCA
GTTGGAAGGACAACAAATATGCAGATGAGATATTTGTATCAGGCACATCACCAAATTCAC
TTAAACACTTTTTAAAAAATGTTTATTTATGGGAGTTAGGTGGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGACAGAGAGAAATG
GAGAGGAGGGGAAAACAGAGAGGAGGAGAGAAAGATAGACACCTGGCAGGCCTACTTTAC
CGCTTGTGAAGCGACTCCCCTGCAGGTGGGGAGCCAGGAGCTCGAACCGGGATCCTTACT
CTGTTCCCTTGCACTTTGTACCACGTGCACTTAAACCTGCTGTGCTACCACCCAACTCCC
AAAACCCTTTAAAAAAAAAAAAAAAAAAAAAGATGTATTTATTTACATGAGAGAAAGAGA
AGGGAACCTGCCATGCCAAGAATTAAACTAGGTACCTCATGCTTGAGAATCAAACACTGA
ATCCATTGGACCACCTTTCAGAATGCTATACGATTTTTAAACTTTTGTTTTTCATATACT
CTAGACAGATTCATATGAGAGAAGCCTATATGTGCGGCACTGGGAATCGAATGAGGAATC
CAGGCATGCAAGTTGCTCACTCTACCAGCTGAGCACTCTCCCCAACCCCACTTCTACACT
ATTTAGAGATGACTCGGTTATAACACAAATGGGGTGGGGGAGGGGCAGGATTAGAGAGCA
GCAAGGCAGAGGAAAAAGTGACCAAAAGTTTAAATGCTTGCCAAGTACCTTCATTTTCTT
TCATGGGTGAGGTGACTATTGCTTAGAAATAGTCTGAGCGTCCCAACTTGTATTTCTTTC
TTTTTTTTTTCTCTTCTTTCTCCACACCCTCTTCACCACACAGAAATGATGCAGCCCTAG
AGGAGACTGTAGCAGAGGTGCTAGACCATCGGCCCATCGAGCAGAGACACTGCCCTCCCT
GCCCTGTGTCAGTTGAGCTGGTGGGGTCCTGCGCTACCCTGGTAACGGAGAGAATCCTGC
AGGGGGCACCAGAGATCTTGGACAGGCAGACGGCAGCCCTTCTGCATGGTGAGGCGGCAT
GGTGAGGTGGCTTGGGGGCCGGGACCTGACTAGTTCCTCTCTCCACAATGCAGAGCAGAG
CGAGTGGCAGTGCAGTCTTCCAACCCGACCATGCCTTCTCAAAGCTGAGCAGCCCAACCA
AACCAGGGAAAGACCATGGGGTAATTGGTAGGGGAAAGAAGGAAGCCCAGAACAGCAGAT
CTGGAGGCTGCCTCCTAGTAGCATCATTTAAAGGAAAGAGGACTAAGCAAATGCATAGGC
AGTGAGGTGGCTGGGGAAATAGCTTGCCAACAGAGCACAGGCTGTGCAAGCTTGAGGTGC
CAGGTTTTATCCCTGGTGTTGGCACTGCATTTGCCAGAGTTGAGAGATGCTCTGTTTTTT
GTGTTTTTTCTTTGTTGGGTGTTTTTCCTTTTTGCTTTGCAGAGCTAGGGAACGAACACT
GTGCCTTGTGCATACATAATGCCACAGCTGAGCAGCCTCCCTGAGTAATCTTTTTTTTTT
TCCTAATATTTTATTTATTTTTGAGAGAGTGAAACACCAGAGCACTGCCCAGCTCTGGCT
TATGGTGGTACGGGGGATTGAACCTGGGACTTAAGAGCCTCAGGTATGAGAGTCTCTTTG
CATAACCATTATGCTATCTACCCCCGCCCTTTTTTTTTTTTTTAAGTGAAGGGGAAATAG
ACAATGCAGTACCATTCCCGTCACCTATGGGTCACCCCATTCCAGTCCCCTATGATATCT
ATCTGATCAAACCTAGAGCTTCACGTATAGTAAGACCAGGTGAGCCATCTCCCTGCCCCT
CTCGTTTCTCTCAAAAAAAAAAAAAAAGTCAATTTTTTTCTTCCAAAAAAGTAGGAAGTT
GTTCCTAATACCCCAGAAAGTAGTCATGTGCCCTTGAGCAAATATCTTAACCTTCCTTGT
TCTCATTTTCCTCATTTGTAAAGAAAGGAACCAGTTGGAGGACACTATCTTCTTCCAAGA
TTCTTTTGTTTTTATTTTAACCAGAGCACTGCTGACCTCTAGTTTATGGTGGTTCTGTAC
ATGGGAGCTTCAGGCATAGAAATGTTTTGCTTAACCATTAAGCTATCTCCCTGACCCACA
GAATTCTTCAGTGGAATTTGACCTGCCACAGTGAGGTCATCTCTCTCTGGAAGTTTCAAA
ACCTCCAAGGATTGAGATGCTCGGGCTTGCTTTTTGGTTGTTGTTTGTGATCCCTAGAGC
TTGACCTCTTTGGGCCAACTTTTTTCAGATAAGAGAGACGCAGAGACCAGGCAGTGGTGC
ACCTGGTTAAGAGCACAAAGTACGCCCTAGCTTTTTACCTGCAGGGAGACGCTTCACACA
TGGCAAAGCAGGTCTGCAGGTGTCTATCTTTCTCTCCCCCTCTCTACCTTCCCCTCCCCG
CTCAATTTCTCTCTGTCCTATCTAATAACATGGAAAAAATGGCCACTAGGAGCAGTGAAT
TTGTAGTGCAGGCACCAAGCCCCAGTGATAATCTTGGAGGCAAAAAAGAGATAACACAGC
GCTTCCATATGGCATATGGGAGATTCGAACCTGGGTCACACGTGGCAAAGCAGGTACCTG
TCTAGGTGAGCTATTTAGTCAGCCCTTTACTGATTTTCTTTAACCAGTGCACTGCTCAGC
TCTGGCTTATTGTGGTGTAAGGGGGTTTAAACCTGGGACTTTAGAACATAACCATTANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGATTTTATTTCATAAGAGATAGAGATTCCTATCT
ATGAATGATTAAAAAATGCACAGCACTGCTCTGATACGGGGGTTGTTACATGTGGGTCCT
GATCACCACTAGCTGAGCAGCTGAGCTCTTTCCTCTCTGTGCCTTTAAAAAAAAAAAAAA
AAAAAAACTAGAGCACTGCTCAGCTCTGGCTTATGGTGGTGTGGGGGAATGAACCTGGGA
CTTTGGAGCCTAAGGTGGTCTCTTTTGGGACCCAGTCCTTGTTTCCTTTGTTTTCATAGA
ATCTGCCATACAGTCTTTTCTGTATTGTGTCCATTTGGTTTGAAGGTACATTCATATACA
TGTGTGTCTAACTCAGGTCAGGCCAGGAAGGGATGTGAGCAAGGGAAAAAGCCAGTTAAA
CGTGTGCATGCATTCACAACAGGGTGTCCAGGAGGGGAAAGTCAAGGGTCAAGTACGTTT
CAGTGATTGTGGAGGCCACAGAGTTTCACTTCAGCCATCTCCCTTCCCACAGGAACAATC
ATCTTGGACTGTGTCAACATGGATCCTAAAATTGGGAAGGCCACCCCAAAGGACACGAAG
TATGTGGAGAAACTGGAGGCTCTCTTCCCAGATTTGCCCAAGAGGAATAACATCTTCGAT
TCTCTACAAAAGGCAAAATTTGATGTCTCAGGTATGAGGTAGTAAATTGATGCCTTTCCC
TCCCCATGAGAAAGCAGAGAGGAGGCCTCATCTATTATGATCTTGAACACCAAACAGTTT
CAGAGACTGCTTCATCACTTCAGCTTCATATCAGAAAGAACGATCCTGATCATGAACTAA
CCAATCATTACCTTATTATTCTGTCCTGATAGAGCATAATGAGGGGGAAATATATATATA
TATATATATTACAGTAAAATACATAAAAATATTATATGTGTATATATACTTTATTCTTTT
TAATGAGAGAGAGAAGAAGACACAGAAAGACCAGAGCACTGCTCAGCTCAGGATTGAACC
TGGGACCTCAGAGCCTCAGGCATAAAAGTCTTTTGTATAACCATTATGCTTTCTCCCCAG
CCCAAGAAATATGTTAAGAGTTTCAGAGAGGGGCCAGGTGGTGACGCACCTGGTTGAGTG
CACGTTACCATGTGCAAGGACCCAGGTTCAAGCCCCCGGTCCCCACCTGCAGGGAGAAAG
CTTTGCGAGTGGTGAAGCAAGGCTGCAGGTGTCTCTCTGTCTCTCTCCCCTCCTAGCACC
CCTTTCTTGATTTCTGGCTGTCTCTATCAAAAAGAGTCTCAGAAATTTCCAGTCTATCCA
AGAGTATAGATAAATATTTATAAAGTGGGGGCTGGCGGTGGCACACATACCACCATGCAC
AAGTACCTGAGTTTGAGCCCCCGGCTCTCCACCTGCACCAACCCACAGGCAGTGAAGCAG
GTCTGCAGGTGTCTATCTTTCTCTCTCCCTCTCTATCTCTCCTCCCATCTCAATTTCTTT
CTGTCTTGTCCTACCAAGTATAACAGAAAGAATATATATGTACATGTATAATGTAGAACA
TCATTATGTAAATACATATCTATATACTATATTTACATTTACTTGTCTTTTCATTTTTCA
CTTGTGATTAATGGTAGGTTACAAGATTGTAAGAATATTTTTAATTTTATTTATTTTCCC
TTTTGTTGCCATTGTCTTTTTGTTGTTTTTGTAGTTGTTGTTGTTACTGATGTCGTTATT
GTTGGATAGGACAGAGAGAAATGGTGAGAGGAGGGGAAGACAGAAAGGGGGAGAGAAAGA
TAGACACCTGAAGACCTGCTTTACCACCTGTGAAGGGACTCCCCTGCAGATGGGGAGCCG
GGGGCTCAAACCAGGATCCTTACTCCGGTCCTTGCGCTTAACCCTCTGCACTACTGCCTG
ACTCCCAAGACTGTAAGATTATAAGGTATAGTTCTGTGCCACACCTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTGGTAGTGCAGCTGG
TTAAGCGCACGTGGTGAAAGCGCAAGGACCGGCGTAAGGATCCCGGTTCGAGCCTCCAAC
TCCCCACCTGCAGGGGAGTCCCTTCACAGGCAGTGAAGCAGGTCTGCAGGTGTCTGTCTT
TCTCTCCTTCTCTCAGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAACA
ATGACATCAATAACGACGACAATAATAAGTACAACAATAAAACAAGGGCAACAAAAGGGG
ATAAATAAATAAATATTTTTTTAAAGTGTGCCATACTAGATGAGCTATCTCCTAATATCC
TAATATTCTCCATCTTAAAAGAGAGAGAAAACACAGCCCAGGAACAGAGGAATCACACAT
CTATGAGACTCTAGGACCACACGCACACATTTTTCTGCCTGTTCTGCATAATATCCTTTG
TGCTAAATGTCTCTCGCAACTATCTTTTTTTTTATCAAGATAAAATTCTATTTAATTTTT
TATTTGTGATTTATCATAAGTTACAGGATTATGAGATTACACCATACCCACCACCAGAGT
TCTGTATCCTGACCCTCCCACCTCCCAAAGATAACCATTATAGTTATCATAAGTCTTAGA
AACAGTTTGCTTGCTGCTGCTGCTTCTTTTTTCTTTTTCAAGTACATGTGTATCAGGTCT
CTAGATTCCACAGTGGAATCTAGAGATCTGATAAACCTGAATTTAAAATTTTGGTTTTGT
AGTTTATAGTATGATGCTGAGGGTTAATCCAGGACCTCATACTTTTATTTTTTTTAACAT
TTTATTTTTACTAGTGACTTAATAATGATCAACAGATTGTAAGATAAGAGGGTACAATTC
CATACAATTCCCACCACCAAAGTTCCATGTCCCATCCCCTCCATTAGAAGGTTCCCTAGG
GAGTCGGGCTATAGCGCAGCGGGTTAAGCGCAGGTGGCGCAAAGCACAAGGACCGGCATG
AGGATCCTGGTTCGAACCCCGGCTCCCCACCTGCAGGGGAGTCGCTTCACAGGCGGTGAA
GCAGGTCTGCAGGTGTCTATCTTTCTCTCCTCCTCTCTGTCTTCCCCTCCTCTCTCCATT
TCTCTCTGTCCTATCCAACAACGACAACAACAATAATAACTACAACAATAGAACAACAAG
GGCAACAAAAGGGAATAAATAAATAAAATAAATATTAAAAAAAAAGAAAAAAACTTTAAA
AAAACAAAAAAAGAAGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AAAAGAGAGACACAACTACTTCACCACTCGTAAAGCTTTCCCCCTATAGGTGAGGACTTG
GCGCTTGAACCTGGGTCCTTGCTCATTGTAACATATGTGCTCAACTGGATGCACTACCAC
CCGCCCCTAACAGATATACATTCTCAGGACAGGACATATCCCTGACTGTTTCTCCAGAGA
GAGGCTGTTTGATGTATCCTCTGAGACATGTCTTCACCTTCCTGACCTGGGACACTCTCA
CACCTGCTTTCTAGGACTGACTACTGAGCAGATGCTGAGGAAGGACCAGAAGATCATCTT
CAGGCAAGGCACCAGAGCAGCCATTAGTGCAATATACATGGACCTGGAGGTGAGTGCAAG
CTGGAGGAGAGGAGCCTTCAATTATGCACAGCCCTGCCCCTCACTCGTGACTTGCCTCCA
AAATGCATGTTTTGCTAACTCTTTTCTGTCTGCACTGTACCTCCAGCACTACCATTGCTC
ACTGCACCTTAGTGACCATCTCCAAGCTGGCTTCACTGCCCCCTTAACTGTTTCCACTGT
GTCACTTCCTGGGGCACAGTGTCTCTTCACTAGAGGTTTTCCCTGGGTCCAAAAGATAGC
TCACCCCATACAGCACATGCCTGACCAAGTGCAAAGCACTACATGGGAGCGCCACAGCAC
CAGGGGAAGCCATATGGATGGTGGAGCAGTGCTGTGATAGCTCTCCCTTTCTGTTGCTCT
CTAGCACTGGTTATGTATGGTGCTCCCATGTGATCCTGGGGTCTCAAACCCAGCTTCTCA
AGTACAATAAAATGTGTGCCGTGGGAGTCAGGTGGTAGTGCAGCTGGTTAAGCGCACGTG
GTGCAAAGCGCAAGGACCGGCGTAAGGATCCCGGTTCGAGCCTCCAACTCCCCACCTGCA
GGGGAGTCCCTTCACAGGCAGTGAAGCAGGTCTGCAGGTGTCTGTCTTTCTCTCCTTCTC
TCAGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCACAACATGACATCAATACG
ACGACATATAGTACACATAAAACAGGGCACAAAGGGGATAAATAAATAAATATTTTTTAA
GTGTGCATACTAGATGAGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTCAGTGCACTGTAACATGTGCACTCAGGTGTGCCACTACCTGCCCCAGGAACATTAAAT
TTTCTTTTTTTTATTTTAAAAATATTTTATTGGACAGACAGAACTGGGGAGGGACAAAGA
GGAGAGATAACCTGCAGCAATGCTTCATCACTCATGAAACTTTAACCTTGCAAGTGGGGG
TTGGGGCTTGAACCCAGGTCTTTGTGCATTATAACATGTGCGCTCAACCAGGTCCACCAC
CACCTGGCCTGTTCCTTTTTGTTTGTTTTGCTGTTGCTATGCTTATTTGTGGTCCGGGAG
GTGGCGCAGTGGCCAAGGCACTGGACTCTCAAGCATGAGGTCCTGAGTTCAATCCCCAGC
AGCAGATGTACCAGAGTGATGTCTGGCCCTTTCTCTCTCCTATCTTTCTCATTAATAAAT
AAATAAAATCTTTTAAAAATTTCTATCTTTATTTATTGGATAGAGACAGAAATGGAAAGG
GAAGGTGGAGAGCTACTTTGCTTTTTTTAATTTTTAATTTTGGATTGAGACAGAGAAGTT
GAGACTGAAGGGGGAGATAGAAAGGGAGAGAGACACCTGCAGCACTGCTTCATAATTTAT
GAAATCTGTAGGTTGGGACCAAGGGCTTGAATCTAGGTCCTTGCACACTATAATGTGTGT
GCTCAACCAGGTGTACTACCTCCCAGCCCCCTAAAACTGATCTTCTTTTTTTTTTTTTAC
ATATACATACACACACACATTTTTTTTTTTTTTTTTAACCAGAGCACTACTCAGTTCTGG
CTTATGGTGGTGCAGGGGATTGAACCTGGGACTTCAAAGCCTCAACTCAGACATGAGAGT
CTCTTTTGCATAACCACTATGCTATCTCCCCCGCCCCTTAATATTTGTTAATCCAAGTAA
GAGACAAGATCACCACTTCAGTGCGTGCTGTGCTGAGTCTTGATCTCATGCTTGAGCATC
CAGTGCCTTGTCCACGACACCACCTCCAGACTGCAATAGAGCTGCTTTTCAGACCAGCTC
TTTCTGAACCCAGAGCCTAACTTCTTCCATTCTGTGCGCTGCCTCCCGACATATAAATAA
CAGAGAAAATGATGGGTGTCTTTTTATGGAGTCCAAGGCCCAGGCTGACATGCAGAGTCA
CCCTTCACAGATATATTTGGTTGACGGGGACAAGGAAAGTGCAGTCAAAGCCCTCATCCC
TGGCCATTGCTTCTCTTTTAGGCTTTTCTGCAGAGGCCCGGCCTCATGGCAGACCTCCAG
GCTTTCTGCCAGGCCCACAGCTGTGATGTCCTGATCGCCATGGCTATCTTTTTCAACACC
CACAATGAGCCAGTGCGGCAGTTGGCCGTTTTCTGTCCCCATGCAGCACTCCGAACGATG
GTGAGTCTATTCCTCTTTCTACCTGGATGCACTGCTCTGGTCTGTGAAAATCTCTCATTG
ATTTTTAAATGGACATCTTGGTTCTTTTTCTAGAATCTCCCCTGTCTGCTTTTCCCCATT
CTCCACGCATGTGAATATCCTTACTGTTGTTGAGAAACAGAAATTCGAGAAGGCCGGGCG
GTAGCGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTGCGCTACTGTAGCCT
GACTGCAGAGCCAGGAGTCTACACACTCCTTGTGCTTCGCACCACTGCGCTTAACCACTG
CACACTGCCGACTCCCGGGAACTCATGTATAAGAGTCCAGTGCGCTAGCCATTGCAACAC
CTCCTGGACTGCTAGAACTCCAGTTTTAATTTAGGATTTATTTTTTTAGGGTGGGAGAGA
TAGCATAATGGCTATGCAAAAGGAATTTTGTGTCTCAGACTAGAAGTTCCCAAGGTGAAT
CGCCCACACTGCCATAAGCCAGCACCCTAAAACTTTTATAATTTTTTTTAGTTTCCCATA
GAGAGAGAAACTAATACCATTCTGGTACATACAATGACAAGGCTAGAGCTAGGAGCCTCA
GGCATTAAAGCCTCTTGCTATTTCAATAGATCTGTGTCCGTAGCCACAAGAACAACTGGT
TAGATTTATTTTATTAATATGAGAGAGGAGAGATAAAGAACTGGAGCATCACTCTGGCAC
ATGTGATGCTAGGTCTCTATATACTTATTTATAATAATTTATTTTTTGTATATATTTATT
TATTCCCTTTTGTTGCCCTTGTTTTTTATTGTAGTTATTGTAATTGTTACTGACGTCGTC
GTTGTTGAATAGGACAGAGAGAAATGGAGAGAGGAGGGGAAGACAGAGGGGGAGAGAAAG
ATAGACACCTGCAGACCTGCTTCACCACTTGTGAAGCAGGTGGGGAGCCGGGGGCTTGAA
CCGAAATTCTTACTCTGGTCCTTGTGCTTTGTGCCACCTACACTTAATCCACTGCACTAC
CGCATGACTCCCATTAATAATTTCTTAGTCATCTCTGGGGCTACATTGCTCCAGGCTGAT
TTGTTTTCTTTTTTTCTTTTCTTTTGTCTCCAAGGTTATTGCTGGGGCTCAGTGCCTGCA
CTACGAATCCATTGCTCCTGGAGGATATTTTTTTCCCTCTTGTTGCCTTTGTTGTTATTA
TTTTTATTGTTATTATTGTTGTTGGACAGGACAGAAAGAAATGAAAAGAGGAGGGGGAGA
GAAGATCTGCTTCACCACTTGTGAAGTGACCCCCCTGCTGGTGGGGAGCCAGGTTTCAAA
CCGGGATCTTTGAGCTGGTCCTTGCCCTTTGCACTATGTGTGCTTAACCCGCTGCACTAC
CACCCAGCCCTCCCCCCCCTTTTTTTAATCTTTATGTATTGGGTAGAGATAGCCAGAAAC
TGAGAGGAAGGGAGAATTAGTGGGGCCAGGTGGTCTGAGAGATGGCACAATGGATAAAGC
ATTGGATCCTCAAGCATGAGTTCCCAAGTTCACTCCCTGGCAGCACATGTACCAGGGTGA
TGTCTGGTTCTTTCTCCTCCTAGCTTTCTCGTTAATAAATAAATAAATAAAACAAAATCT
TTAAAAAAGTGGGGGACAGGTTGAGAGAGATGCACCTGGTTGAGCCAGAGAGAAAGAGGC
ACCAGGGTTGAGCACACATGTTACAGTGCACAAGGACTCTGGGATGTAAATACAAACTCC
CACCCGCAGGGAGGAAAGCTTTCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTCAGCCAGGAAATTGAGAGGGAATGGGGTGATAGGGAGCCAAGACTCTCAAGT
AGATCCTTTGAGAAACCTCAGCTCTCTGCTTTCCCATCTTTCACACCATGTCAACACTTT
TATTTCCTTCTCAGATGTGTGAAGTCCTGGAACGCTCCCAGTCTCCATCCCTGAAGCTGG
TCCCTCTCCCCAGCACACACCCTAACCTGCAGCCTACCTTCAAGGCAACACCCAGGCTTC
CCGAAAGAAACTCCTGCCTCTGCTCCAGGAGGCCTTGTCAGCATATTCTGACTCCACGAA
GAGCCCTTCAGGGCAGCCGGAGACACTGGGTGTGCCCGGGGAGCAAGTGGACAAGGAATT
GGACCGAGCAGGGAACTCCCTGATTTCTGGACTGAGTCAAGACGAGGAGGAACCTGTACT
GCCCCCCACGCCCATGAACAGCTTGGTGGATGAGTGTCCTCTGGACCAGGGGCTGCCGAA
ACTCTCCGCCGAGGCCATCTTTGAGAAGTGCAGCCAGATTTCCCTGTCCCAATCAGTTAC
AACCTCCTCGTCCAAGAAGTGACTGTGGAGAATGAAGGGAATAGCGAGCGAGCGAGGTTG
CCTGAACCACCTCCAATGCATGTTTTGAAACGTTTCTGTGAGTCTGTCTTATTGCCCCAG
GAGCTGGTGTGCTGTTGTTGTGAGCCTGGGAGGAAAAAAAGTAAGAGAAAGCAGCTGCTG
TAGGACTGGCTTCCCACTTGCCGTGCCCACCCGCCCCACAAACCACCCCCCATCTGCCAG
ACAAATGTTAATAATATTTAATTTAATTATTTTAATCTGCACTGACTTCCCTTTATTGCA
TTTGGGAGGGACCCAATGTAGTCGATACAGTTCTGGCAGAATAATACATGAAGACAGTGT
ACCCCAAAAGTACCCTCCTCCATGAGGCTCTTTGAGCAATCAGTATCGTAACACCCATGG
AGGCAGTCAGTCCTTGCTTGCCTCTGTATAGTCATTTACCTACTTACTAGTTTGAGTATT
TATTGAGTCACTACTTGAAGGTAGAGAAAAAATAACGTGCTTTGGAAAAATCCATTTTGG
TATTCCTCCTTGAGCCGTAGAGCCCCAGCTCCCTAACTACCCTTTCTGGCCCCCAGTTAG
ATAGTGGCATCTGATTCGGAAGTGGCCGACCTTTTTCATGAGCTTATGACTCAGGAGGGT
GGCGAACAGATCAGAGGCTATTATCTTCTGGCCTCATCAGGTAACCTGGCTTTTGTGGCT
CTGATTCTCTCCCAGATCCTAAAAAGAATTCTGAGGGAGTCGGGCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 15229..15321, 16867..17069, 23083..23267, 42532..42690, 47114..47208, 49281..49439, 53294..53368, 53371..53721
1001..1039, 15229..15321, 16867..17069, 23083..23267, 42532..42690, 47114..47208, 49281..49439, 53294..53368, 53371..53718
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved