Erinaceus_europaeus Locus MITD1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus MITD1
Erinaceus_europaeus
MITD1
GeneScaffold_5669
SNORA30
17037..17159
18147
AACCTAGGTGGACCCAGGCCATCGGCACCCGACGGGCCCCATTTAGGGTCTGGCTTTAA
CACGGCACTTTAAAAAGTCCCCTAATAGAAAAAATCATCCCCGACCTCCTGCAATAAGGG
TTCCCCAGAAAATACAAATCCTAGCGAAAAATGCAATACTACTTGTCACGCATATCCACT
CACCACAGCTAAATGTCGCCCGGCTGGAAGTTACACCGGAGAGGAAGTTAAGCAAAGACC
ACAGAGCGCAGCACTCAAACCCTGCCACCAACCTGAGAGCTGCGGCACTTGCGTTCCGGT
GTCTAGACTCTATCAATAAATGACGTAAAACAAAAGCGCGGGCGCGTTGGTATTATGTAA
GCACTACCCGGATAAAAACAGGAGACCCAGCCCAACTTTGGCTAGGTTTGAGGTTCCGGG
GAGTTAGCGGAAAGAAACATGGCCAAATCTATGCTGGGACAGGATCCTGAGAGCACAGCC
GCGGTCACTATGTTAAAGCGGGCAGTGGAACTAGATTCCGAGTCCAAGTACCAGCAGGCT
TTGTTGTGCTACCAGGAGGGGATCGACTTGCTCCTGCAGGTTCTCAGAGGTAAGCCGAGC
CACTGGGGGAGAACTGAAAAAATTAAGTATTTCCCACGGTTTCTACGTCAGAGAAGAAAG
GATTGTTAGATGGGGCGGGGCCCGGTGGCGCAGCGAGTTAAGCTCACATGGCATAAAGCG
CAAGTACTGGTGGAAGGATCCCGGTTCGAGCCCCCGGGCCACCACCTGCAAGAGGTTGCT
TCACTAGCGGTGAAGCAGGCAGTAATCCTGGAGGCGAAAAGAAAAGAAAGAAAGGGGGGG
AGGATTGTTAGAAGGGCCGGGTGATGGTGCATCTGATTGAGTGTACATTGTTACAGTGAG
CAAGGACCCAGGTTCGAGCCCCCAGACCTTACCTGCAGAGGGAAAGCTTTTTGAGTGTTG
AAGCAGTGCTTCAGGTGTTTCTCTCTCTCATTCCCTTGCTATCACCCTTTTCCCTCTCGA
TTTCTGGCCCGTCCTCTGTCGAATAAATAAATACATATAACAATACATAAAAAATTGATT
TGTTAAACCGCCACGCGACAGAAGTTCTGAATTGAGGAGAATGGACCTATTTCTTCTAGG
AACAATGTGAATCCGTTTTTCTCCTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNACTGTGGTTATTCTGTCTTGACAGTACACAAGTAACAATGTT
CACCATAACTCCAAGAACAGCAAATTTATCTGTGTTATGTACTAAATTAAGAGCATTTCT
ATTCCCTTTCCTGTAGAACTTCCAGTCAACTAGGAAGTCTTTTCCCTGTATTATGTATTA
AATTAAGAACATTTCTATTCCCTTTCCTGTAGAACTTCCAGTCAACTAGGAGGTCTTTTC
TTTGTGCCTTCTAATTTATTTATTTATTTAGTTTACCAGAGCACAACTCAGCTCTGGCTT
ATAGTCATACTGGGTAGGTATTGAACTTGGGACTTGGGAGCCTCATGCATTAGTCTTTTT
GTGTAACTATTATGCCGTCTCTCCCACTCCACTGCTCCTGGAAGCTATTTTTTCCCTTCT
GTTGCCCTTGTTTATAGTTACTGTTGTTATTATTACTGTTGTCATTGCTGTTGTTGGTGG
AAAGGACAGAGAAATAGAGAGAGGAGGGGAAGACAGGAAAGACAGACACCTACAGACCTG
CTTCACTGCTTGTGAAGCAACCCCAACTCTTAGGTGGGGAGTGAGTGGCTTGAACTGGGA
TCCTTGTGCAAGTCCTTGGGCTTTGCGCCATGTGTGCTCAAGCTGCTGTGCTGCCACCCA
GCCCCCCCCCATTTGTAATTTTAAGTGTCACTGAAGTTTTGAGACAGCAGAGGGCTTTCT
CAGAATGCTTTCTTAAGGACTATAAACAACACATGATGACATGATGATGCTAACCTATGA
TAACAAGATAATCATTTATGTAAGCTGAGTATCAAGCATTATGAGAATAAATTCAAACGC
ATAATCAGAGTGTCAGGCTGTGGCACACTCGGTTAAGCCCACATAGTACTAAGCACAAGC
ACTCGTGCAAGGATCCAGGTTTGAGCTCCCAGCTCCCTATCTGCAGGGGGGATGCTTCAC
AACCAGTGAAGCAGTTCTGCAGGTGTCTCTTCTTTTTTTAAAAAAGAATTTATTTATTTA
TTTATTTATTCATGAGAAAGATAGGAGGAGAGAAAGAACCAGCCATCACTCTGGTACATG
TGCTGCCAGGAATCGGGACCTCATGGCTGAGAATCCAATGCTTTATCCACTGCTCCACCT
CTTTATCTCTCCCTCATCTCTCAATTTCTCGCTGTCCTATACAATAAAATGGAAAAAATG
GCCACCAGGAGCAATGGATTCATAGTGCTGGCACTGAGCCCCAGAGATAACCCTGGAGGC
AAAAATAGGTAAATAAAAGCATGATTATACCCTTAAAATTGATCAATGAAGTAGGTGATA
ATCCTCATTTTACATCATAGAAAAATAAATTTAGTTTTTCAGTTGTGCCAGTAGGAGGTG
GTAAAGTCACAATTGGAATTCAGGGCTCTAATGGCTCTGGTATACTGCCTTCTCTGAAAA
AAAAAAAAGGGGGTGATGTACAGTGTTGCTCATGTGGGACATTGCTCAAGTCCTGGCTGA
AGAATAAGTACCAGGGAAACAGATCTATATAGGTGCACTGAAGATTTGAACAGTTAAATG
TTGCTTCTTGCTGGGCAGGGGATTCCTAGGTCCACTGGAGTGTTATAGCTCTCATAGAGA
AACCCAGGTGAACCTCTGAGCACAGGTTTGCCACAATCAGAGAGACAGACTTAATTTATA
GGGAGCAAGTGAGATGCATGTATAGACATATACAGATGCCACAAGAGAATAAATCCTAGC
TTTCGGCAGGGTTAAGATAGCATAATCATTATGCAAACAGACTGTCATGCCTGAAGGCTT
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCCCTTTCTATCCCCCTTCCCCTCACAATTTCTCTCTGTCCTATCAAATAAAAAAAAA
ATCACATAGCTGGTAAATACTGGTGAAATTTATTGACTGCTTCTTTATTACTATTGTAAA
AATGAATGAGGACAAATTTTATCAAATGATGGTATAAATTCCATAATATATTAAGTGAAA
ATTGCAAAGAACAGAATATTTATAGTATGCTATCCTTCATGTAAAAAGGAAGATACAAGA
AGATATTCATGTATCTATTTCATTTGCTTAAAAAAAAAATCCACACATTCAGGAAATATA
AAAGCAGAAACTAATAAGGTTAATTACCTGAAATGAGTGAGTGGGAATGAGGAGGAAAGA
AGGGGAAATGGGAATGAGGTATTAAGATGAGAGCATGAGAGACTTGTAATACAGAAGGAG
ATTGGGAAGAAAATAGGTAACCTAAGAAACAACAAAATAGACCCCTTTGTGGCCCCTCAT
AGGACCTTGCCTTCAACTTGGATCAACAACGGTAGAGAATGTTCCATCCTCTGAAGGGAA
GATGGACAACATACTCTGTGCTACACCTGAGAAAAATGGGTTGATATTGGGGCAGCTTGA
AATATGCCTACTAGCTATCTACAAGACAGAGTACCCCCCAGCTCTTCATCTGCACTATTC
CAGCCTTTAGGTTCATGATTGGTCAACAATTTGTTTGTTTGGCTTTATATGTTAACTCTC
TTTTCAGCCACCAGGTTCCAAATGCTACCATGATGTCAACCAGACTTCCCTGGACAGACA
GCCCCACCAATGTGTCCTGGAGCTCCACTTCCCCAGAATCCTGCCCCACTAGGGAAAGAG
AAAAGCAGGCTGGGAGTCTGGATAGACATGTCAATGCCCATGTTCAGCAGGGAAGCAATT
ACAGAAGCCAGATCTTCCACCTTCTGCATCCCACAATGACTGTGGGTCCATACTTCCACA
GGGTTAAAGAATAGGAAAGCTATCAAGGGAGGGTGTTGTTAAAATTCGGAGGCTCTTGCT
GGCCGGGCTAGCTTCATGGGCGGGTAACAGAGACGACCAGAGACATACGGCTGGGCAGGG
AAGCTGTATTTCTTTATTCAGGAACAACGATTTATAAACTAAGACAAACTAATCACCAAA
CAGAACTCTGCTGCCTCTTTCCCCCGGCGGTGGCGCAAGCACTCTCGAACTCTGGAACTC
TGGCACTTTCGAACTCTCTCGGGGTTCCCAGGGGCGGGGCCAAGTGGCCCGCAAAACTAA
CAGGACTGATCCAATTCTCTTGGCGGGGGAGAGCTAGGACAACCCAATGTAAAGCATACA
ACAGGAGGGGATGGGATATGGAGGGAGTTCTGGTAGTGGGAATTGTGTGGAGTTGTACCC
CTCTTATCCTATGGTTTTGTCAATGTTTCCTTTTTATAAATTTTTTTTTAAAAAGTAACA
ATGATCTTCAGAAGATGGTATTTTAACTACTCTGTAAGGTTAAAAACAAAAAGTATAGTA
TATAAACAGAGTTGTAGTTACTAAAAAAAATTCCTAGAGGTCTGAGTTCAGGATTCTGAA
GTTATGTATACATTGAACAAACCAATAAATACATTATGAATAATAAAAGTTACAAATAAG
AAAGGGGGGGCTAGTTTGAGCTCACATTACAAGGTCATAGCTAGGAACATTCTAGGCCAT
ACTCATTTCAGGACCTGTCTCCCTCAAGTTGCAGATTATGTTGACCCAGCCTCCCTTTGG
AGAGTGGTGCTGTTTCTTCCATTGTTCCACATTGAGGGCAAGTCCTGTAGAGGCCCACAA
GAGGGTTTATACTGTTGTTCCTAATGGAGATGACCAGTGATGTGGAGAGAGGGGTCCACT
AGATGTCTAGGCCCATTATATCTATGTGGGTATCCCAGGATCCCCTGACTAGGGCCCTGG
ATGATGGGGTGGCCTGGTAGTGACCAAAAGAGCCATCATTAGAGTGCCGGTTTCTTGCCC
TTATCTAGCTTTTGTAGTCCTTACTTTGTCTAATGGGATTTAATACAGAACTCTTGGTGG
TGGGAATTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTAATTTATGGTGGGAAAATCTGTGATTCC
ACATTAACCAAGTTAATCAAAGTTAAGACCACTAAGAAGGCATATTGACACAAGTAACCA
TGGCCATGATCCTTCTATGATATTATTGCCAAAACACGCATGACCTCATTTTCGTTATGC
GAAAGACATCATTAGAAAACTACCTAGAAATAAGAAATTAGTGGGAGGGCAGGGGTAGAT
AGCATAATGGTTATGCAAAGAGTCTCTCATGCCTGAGGCTCCAGAGTCCCAGGTTCAATC
CCCTGCACCACCATAAGCCAGAGCTGAGCAGTGCTCTGGTAAAAATAAATAAATAAATTT
GTGGGAAATGGACAGTGATTTCTACATTAAATAGAAAAAATTGTTTTGAAACTTGAGAAC
TTTTATTTTAATTTGTAGGCACTAAAGATGATACAAAAAGATCTAATCTCAGAAAAAGAA
TTTCCCACTATATGGACAGAGCAGAAAACATAAAGAAATACTTGGATCAAGAAAAAGAAG
GTAAAGAGACCGATTAGAGAATAAGACCCACTTCACCCATTGCTTTCAACTCTGCCCTTT
GGTCTGGACCATATATCTCTGGGAGCTTACTGAAATTTATTTGACTGTTCTGTTCCTGTT
GAGAGTCTGTGAAAGCTGTACATACTGCTAAACTTTGAGTGTCGTCATAAGGAATTTACA
GATACCTGTGGAGTTTGTGAGTTCCATTTTAAATAATAATACAGAAGAACACTAGATATA
AGTCTCATATTCTATGTATCTTTTTTTTCTTTATTGGGGGATTAATGGTTTACAGGTGAC
AGTAAAATACAGTAGTTGGTACATGTGTAACTTTTCTCAGTTTTCCGAATAACAATCTAA
CCCCCCCACCTAGGTCCTCTACCACCATCATTTCCAGGACCTGAATACCCCCCCTGTGTT
TACCTTTATAAAAATAGCCAAGATATTAAAGTTTTAAAGGAATTCCTGGAACTTTAGAAT
TATGTTCTAACTTAAAACATTTCAGGAGTTAATTATTACTACCAGCTAGAAGTACAGTAA
GTATCACTCAGTTATTCCCCACTCATAAGCATTCAGGTATCTAGATCTATTGGATTGTCT
GAAAAGTAATGTGTTTTTGCAGAGAAAAACAGAAGAGTGATCCAAGAGGAGGGGCAGTGG
GTAAGACATTGGACTCTCAAGCATGAGGTCCTAGGTTCAGTCCCTGCCAGCACATGTACC
AGAGTGATGCTCTGGTTCTCCTCTTCCTACCTCACTCATGAATAAATAAACAAACAAATG
TAATAATTTTTTTAAAAAGAAAAACAGGGGAGTCTGACGGTAGTGCACCGGGATAAGTGC
AGGTGGCACAAAGTGCAAGGACCGGACTGGCGTAAGGATCCCGGTTGGAGCCCCTGGCTT
CCCACCTGCAGGGGAGTCGCTTCACAAGTGTTGAAGTAGGTCTGCAGGTGTCTTTCTCTC
CAATCTCTGTCTTCCCCTCTCCATTTCTCTCTGTGCTATCCAACAACAATAACATCAATA
ACAACAACAATAATAACTACAATAAAACAAGGGTAACAAAAGGGAATAAGTAAATATTTA
AAAAAGAGAGAAAGAAAAACAAAAGAGTATGTCCCAATATTTCCACCTTTGCCTAGAGTG
CACAATCCTCTTTGATAGTCATACTGTAGCCCTCTCCCTGTCTCCTTCTTGTATTCTGCA
CCAGCTCATACCCTGAGGACCCCCACTGAGCTCCTCTGTTGAATGAAAATTAAGTTATTT
CCTTTACCCCAAATTGAACTCTATAATGAAATTTATAATATTGGAATTATGATTTAGAAA
TAATAAATTAGGGGGTCCAGGCCGTGGCATACCTGGCTAAGTGCCAGGATAGCCTGAGGG
TGCTTCTTCCCGAGCAAGTGCTCTCTGGGTTGGAGAGAACTCGACTGGAGACAACCTAGG
CTGCTGTGTGGTAGAGGGATCAGGAACTTGTGCCGGGCTAGCTTGCAGGAGAGAGACTCT
GGAACTTGCGGAGCCAGAAGGCAATCCAATGTGTGTTTAATCAGAAAAGAATCTGTATTT
ATACTTGCCAAGAAGGAAATAGTAGGGTGGAAAACAGGATGTGACAGAGAGGGTGGAACA
AAAAGTGAGTGCAAACCAGTGGGATTAAACCAGTGCCCTGTAGGCAGGGTGGGTCTCAGG
TAAAACAGTGATTATGTAAATAGACCACAGTGTTAAGCAATGGAGCAGGGGGGAGCTAGC
ATACTGCCCAACAACTAAGCACACATTACATCCTGCAAGGACTCAGGCTCAAGCCCCTAG
TCCTTACCTGAAGGGGGAAAGCTTCACAAGCAGTGAAGCAGGGCTGCAGGTGTCTCTGTC
TCTCCCTGTCTGTCTCCCCCAGTCCTCTCAATTTTGCTCTGTCTCTATCTAGTAAATAAA
TAAATAAATGAAACACTAAATTATCTGATGTAACTAGCTTGGCTTAAAAATGGATGTACA
GGGAGCTGGGCGGTAGCGCAGCAGGTTAAGCGCATGAGGCGCAAAGAGTAAGAACTGGCA
TAAAGATCCCAGTTCGAGCCCTCAGCTCCCCACCTGCAGGGGAGTCACTTCATTGGCGGT
GAAGCAGGTCTGCAGGTGTCTGTCTTCTCTCCCCCTCTCTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGTTTCCTCAGGTAAATGGAGACTCCAAGGGATGCTCCCTCGAGTATGTTC
GTTTCATATAGGTGTGGGGGAGGTGGGGCCTGTACCTCGGATCGTTGTACCTTTTAATGT
GTACAAAATGTGGTGTATTTCCCACCCAGGGCTCTTCCCCTTTCTTTTTTAAGTTAAAAG
TGCATTCATCATGTAATTCTGGATCCACAATTGGGTAGTTTTCTGTGTTTTTTTTTCATT
ATTACCACTGTACTGACACAGCTCTAGCTTATGGTGGTACATGGAATGGATGGAACCTTG
AAATTTGTTGGCGCCTCAGGCATGAAATTCTCGCATAAGCATTATGCCATCTCCTCAGCT
ACTTCTCTGTTTTGTTTTTTAATCTTAAAAGGGTTTGGTAATTTTTTAATGATTCTTCAT
TTTGATTAAACAAAAGCAGTGGCACTATCCTACTGTTCTTATGGCATGCCTGTCTTACCT
TGGTTTGTTAATAAGTACTATCATTTTCTGCTTTAAACGATAACTGCGAATTGTAAGAAC
AATTAAAAAATTTTTATTAATATTCCCTTTTGTTGCCCTTGTTGTTTTATTGTTGTAGTT
ATTATTGTGGGTTGTTACTGATGTCGTTGTTGTTGGATAGGACAGAGAGAAATGGAGAGA
GGAGGGGAAGACAGAGAGGAGAGAGAAAGATAGACACCTGCAGACCTGCTTCACCGCCTG
TGAAGCTACTCCCCTGCAGGTGGGGAGCCAGGGGCTCCAACCGGGATCCTTACACTGGTC
CTTGCTCTTTGCACCACGTGCGCTTAACCCACTGTGCTACTGCCGACTCCCTGTAAGAAC
AATTTCTACACTCCATATTATGCTGCATTTATGTACTTAGTACTCACTTTAGTTATTGTA
GGTCATAAAAAGACCTTAATCTAGAAAGTAAGGCCAGACAGACACTAAATGTTAACTTGG
TTCTATTCACTGTGACAGGAATATCAGATATCCTTCTACATATAGTCTTCTCCTGAATAA
ACTGCCTGGCCTGTAGGAGTTAACTCAAGTACTTTCTCCAGAAACTCTGGATTTCTGCTT
GCCTGACTTTCGTGAAGGTAGAAATTATTCGTGGAGAAGTTTGCTTTATTTACCTCTGTA
TGTTTAACATCATTTAGTCTGCATAGTGTTTACCTATCATTCAGAAAAAATGTTGGTGGA
TGGGGGAGTTAAAGTTAACTTGTATCTGATCCTGATTAATCACTGCATGTGCAATATATA
TACATATATATGTGTGTGTGTGACATGGTCATTGGCTTTATTGTTGAGGCTTGTATTTTG
TAGATGGAAAATATCACAAGCAAATTAAAATAGAAGATAATGCAACGGGTTTCAGTTATG
AATCACTTTTTCAAGAATACCTTAATGAAACAGTTACAGAAGTTTGGATAGAAGACCCTT
ATATTAGACATACTCATCAGGTAGGTAAAATGTAGTAAAACATAATAATAAAGTATTATG
TATGTATTTGCTAGTAATAATCCATCCTACTGCCTTTCAGCTGTATAATTTCCTTCGATT
TTGTGAGATGCTTATTAAAAGACCATGTAAAGTAAAAACTATTCATCTTCTCACCTCTCT
GGATGAAGTAAGTATCTGAAAGTAGTTACTATTTAACTTTATTCCATTACAACTTGTAGT
TATATCAAGGAAAACCTGGATTTAATGTGTTAGCTGGCGCTTCATCTGTGGGAATGAATT
TATTACCTAACAATAGGCATAAAACACCCTGAGAAGGCCAGGGGTAGATAGCATAATGGT
TATGCAAAGAGACTTTCCAAACCACCGTAAACCAGAACTGAGCAGTGCTCTGTTTTGTTT
TTTTTAAGTGCTATTGATTCTAGTATGTCTTACCTTGGGGCTTGGCCACTTTGCCAAGTT
CTCTTAAAGTTTGTCACTTTAGTCTCTTGGATATTGTAGAAGATGATGANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTTCTCTGACCATCAGTGACTTGGAACAATTCTTCATACGTCTGTTGACTTTTTG
TATCTCTTCTGTAGTGAATATTCTGTTCATATCCTCTCCTCCCTTTTGATTTGGGTCATT
TGCTTTCTTGTTGCAAAGTTTGGTGAGCTCTAGAACTCTTGCTGTTTATGTTCCCCATCT
CTATGTACAAGAACCCCCCCCCCCAAAAAAAAACAAAAAGAAACCCCAAGGCTCCACCAT
ATGTTTGAATATATATATATATGTGTGTGTGTGTATACTTATTTATTCCCTTTTGTTGCC
CTTGATATTTCATTGTTGTAGTTATTGTTGTTATTGATGTTGTCGTTGTTGGATAGGACA
GAGAGAAATGGAGAGAGGAGGAGAAGACAGGGGAGAGAAAGACAGACACCTGCAGACCCT
CTTCACCGCCTGTGAAGCGACTCCCCTGCAGGTGGGGAGCCGGGTCTTGAACTGGGATCC
TTACACCAGTCCTTGCGCTTTGCGTCACGTGCACTTAACCTGCTGCGCTACCACCCGACT
CCCTGTTTGAGTATATTTTAAAATCACTTGCTAACTAGCACTTTAACAGGCCCCACATAT
TGGGGCCAGGATTGGTAGCTAGTGCTAAGAGAAAATCCTTGATTACATTTTTGCCCTAGA
ACTGTTGCAGTGGCAGCTAACATTCAATGGGACACCATAAAGTTTAAAAAAAAAAAAAAA
AGGAAAGTTTTATCAACAAGCTAAAATTCAAAGAGTAAGTTTTAATTTATTGTTAAACTT
TATCAGCTAATCAAATCAACTCATGGTTTCTGTGAAAAGTGTGTTTCATTATAGACATAG
CTACCTGGATCAACTCATGCCATGAGGGAAATTATTTTCCTGGCTAAGGGAAAATCTAAC
TGATACTTAATACAGTACAATTCTGATAATTATCTGACTTAAACTGGGAATTAATGCTCA
TATGAATTCCATAGGTCTAACAATGGGTGGATAATTAAGATTGGAAGAGGACTTGATTAT
TTTAAGAAGCCACAGGTAATAAAACACACTCTTGTGAGTGAGTGTATAGCACTATTTTTT
GGCACTAAACAAAATGGATTTGGTCCTTTTTTTTTTTTTTTTTAAGAAAACTCTCTTTTC
TTCTCTTCTTAGGGTCGTTATTCCCTTGGATATTGTGATTTTGATTTAAGACCATGTTAT
GAAACAACAGTGGACATTTTTCATAACAAGCATACCAAAAAGATATAATGGTCAACCTAA
TTTACATTGTAGATTACTATTTTAAGTGAATATTAGATTTTTTATGTTGACAGATCATTC
CTATAATGTATGAATTTAATAATAAACTTTTACATTTCTAGTCATTTATGTTCAGTTTTG
AATAACCCTGTATGCTGTTGTAAATTATATTGATCAGTTGATGTACAGTGCTTCTTTCTA
AGCCATACAGTTAACATTTTACCAACCAGAAATTTAGCCAGATTTTTCTTATTTGAATGT
TGGAAAGGTGGGGTAGATAGCATAATGTTAATACAAAAAGACTTTCATGCCTGAGGCTCC
AAAGTCCCAGGTGAAATCCCTAGCACCACTAAGTCAGAGCTGAGCAGTGCTCTGGTCAAA
ATAAACAAATTAACAACCAAAAAACCCCTCCTAAAAACAAATAATGAGTGGTCCAGGTAG
TGGCGCAGCTGATTGAATGCACACATTACAGTGTGCAAGGACCCAGGTTCAAGCCCCCCC
AGTCAAACCTGCAGGGGGAAGCTTTACAAGCAGTGAAGCAGAGCTGCAGGTGTCTCAATT
TCTCTTTTCATCTTTCCCACTTTGGAGAAATATGTGAAAACTCACCCCATCTAAGCCCTA
GAAAAAGACTTAAGAGGGCAGAGGTACATAGCATAATGGCTATGCAAAGAGACCCTCATG
CCTGAGGTTCCAAAATCCCAGGTTCAATCCCCCGTACCACCATAATCCAGAACTGAGAAG
TGCTCCAGTAAAAAATAAAAAGAAAGGAAAAGACTAATACACTGAATCATGAGCAAGGAA
ATATATATGTATGTGTAGGTATCTAAGACAGCAAGCACTCCAGGGTGGTCTTTGGGGACT
TTTTAGATATTACTAGGAGATAGCAACAAACTGTTCTCTTCCCCATTGGTAAATGAAAGT
AGACTCACAATCCAACCATATTTGGGGAGGAGGTGAAGGAGTGGATGTATGGGAAGTGAA
GAGGGGTCTGATGGGCTAGGTTAACTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1151, 11141..11242, 15506..15642, 15723..15809, 16252..16367, 17437..17497, 17615..17710
1001..1151, 11141..11242, 15506..15642, 15723..15809, 16252..16367, 17437..17497, 17615..17707
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved