Erinaceus_europaeus Locus HSPD1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus HSPD1
Erinaceus_europaeus
HSPD1
GeneScaffold_4718
SNORA42
7846..7981
10817
CTCTGATTTTTTTTTTAATTTATTTAAGAAAGGAGACTACACAAAATCATAGGATGGGG
GGTACAACTCCACACAATTCCCGCCACCCAATCTCCATATCCCATTCCCCCCCCCCCCCC
ATAGCTTTACCATTCTCTATCCCTCTGGGAGCATGGACCCAGAGTCCTTGTGGGTTGCAG
AAGGTGGGAGGTCTGGCTTCTGTAATTGCTTCCCCACTGAACATGGACATAGACTGGTCA
GTCCATACTCCCAGTCTGCCTCTCTATTTCCCTAGTAGGGTGGGTCTCTGGGGAAGCGGA
ACTCCAGGACACATTGGTGGGGTCTTCAGTCCAGGGAAGCCTGGCCGGCATCCTGATGGC
ATCTGGAACCTGGTGGCTGAAAAGAGAGTTAACATATAAAGCCTAACAAATTGTTGAATG
ATTTTTTTTTTTTTAAATAACTTCAGCCATTATGGGATTTAATTAAATTTTTTGTTTGGG
TGCATGCTGTTTATTTCCATATGACTAGAAAAGGTACTGACATTGAAGTAGTGTAGAATA
AGGAGTGTTTAACAGGGAATAAGCATTATCATGACATGTATTCTTAAACCAGGTGTGATG
TTAGCTGTTGATGCTGTAATTACTGAACTTAAGAAACAGTCTAAACCTGTGACAACCCCT
GAAGAAATTGCTCAGGTGAGAATTTAAGTTTAAAATGAATTATTAACATGTTGAGTCCAT
TCTATAGTCATACATTTCAAGGTAATAGTGCCCACTAACCAACATTGGAGGCAGTTTTGC
TATTGTTGAAATGTTTAAAGATAATGGTTTTAATCTTTGAAAAATGTTGAATAATAAACT
GAAATAATTGTAAACAACTTTTTTGTTAGGACAGAAATTGGGGGGGGGGATTGAGAGGGA
GAGTCAGTCAGTCACCTGCAGCACTGTTTCAGCTCTCTGAAAGCTTGAGCCTGGATCCTT
CCACATGGTAATGCCCAGGATTTTATTAGATCTGTTAAAACCACAGAGTCTTCTCTATCA
TGTACATATCCATAGGGGATGGATCATTTAGAATGTGAAAAGACAGGAAAGTTGAGGATA
CTAGCTCTACCTTCTGATATGGAAGAGTGAACTTATTTCAGGTTGCTACAATTTCTGCAA
ATGGAGACAAAGAAATTGGCAACATCATTTCTGATGCAATGAAAAAGGTTGGAAGAAAGG
GTGTCATCACAGTAAAGGCAAGTGTGTGTGTGTGTGTGTGTGTTTTATGTGGAAACTAGA
GCACAGCTTTAGCTCTAGCATGTTTAATGCTGGGGATCTCGTGGGGGGCCTCATGCATGC
AGCACTGCTTTACTGCTAAGATGGATTAACAGTCCACAGGATCTTTGTAATCACTATATT
GGAGGAAATGGTAGTTTATAAGACTTGTCACACTTGTAGTTTCCACAAATATATTTTATT
CTTCTGTTACTTCAAACCAGCCATAGTCCACTGCTCCTTGTAGGGTATTCCCCCACACCC
ACTCTTTCTCATCAGATGATGAGAGAGACTACAGCACCACTCTTTTGTTCAGGAAACTTC
CCTTTTGTATGTGCTCCTGTGTGGTGACTGATGGTTTGAATCTGTCCCTTGAACATGGTG
AAGTATATGCTGCACCAGTTCCTGGCTGAGCTGACTGATGGCCCCTACAAGTGTCTTTAT
TGAGGAGAGGATGAGAACATCACTGTTAACATGCAGTGCTGGAGATAGAACACAGGACCT
CATGCGGTAACCACTGAAACACTTCCCAGGCCAGCAAGTGATAATTATTACAATTCTTAG
TGGTAATTCAAAGTGAGATGTCTCATAAATAAAATTGAATTTAAATGATAAAAACAAATC
AGTTATTTATGAGACAAATCAAGAGGGTAAATAAAGAGAACAAGAGATACCTGTANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTGCAGGTGGGGAAGCCAGGACC
TCGAACTGGGATCCTTGCCGCTTTGCACCACGTGCGCTTAACCTGCTGTAGCACATACTG
CCCACTTCCAGTTTGCTTAGTTTCTCAGTTTTATACAGATGAGTTTTTTTTTTTTATAAC
CAGACCTCTGTTCATCTCTGGCTTATGATGGCATGAGGGATTGAACCTGGGACTTCAGAG
CCTCAGGCAGGAGAGTACCATTGCATAACCATTATGCTATCTATCTACCTCCACTACAAA
TGAGTTTTTCTTTGTTTAAATTATAGTGGTTTGGGGTCTGGGCGGTGGTGCACTCTATTA
AGCACACACATCACCATGCACAGGGATTCAAGTTTGAGTCCTTATTCCCCACCTGCAGGG
AGGTTGCTTCATGAACAGTGAAGCAGGTCTGCAGTTGTCTTCCTTTTTTCCTTTTTTTAA
AAATATTTATTGATGAGAAAGGGGGTGTTAGAGAACCAGATACCACTCTGGTATATGTGT
TGATTGATTGAAAACAACACATCATACTTCAAGGGTCAATGCTTTATCCACTACCACCTC
CCAGACCACTCTTCCTCACCATCTCCCCCCAATCTATGTTGTGTCAAATAAAAGCAAAGG
GAAAAGGAAAGTATGACTGCCACCGAGTCCCAGTGATTACCTTGGTGGCTATGAAAAAAA
CAAAAACTGCAGTGGTTTTCATAATGGTGTTTTCTGGGTTTTGGTATAAAATGTTTTTGT
TTGTATTTTTTGCAGGTCAGAAATGTGAGTTCCAAGATGCATATGTTCTGTTAAGTGAAA
AGAAAATTTCCAGTGTTCAGTCCATTGTACCTGCTCTTGAAATTGCCAATGCTCACCGGA
AGCCCTTGGTGATAATTGCTGAGGATGTAGATGGAGAAGCTCTGAGTACACTTGTTCTGA
ACAGGTACTAGGCAGGGTTTTTAGTTTTTCTTCCTAAAGATGTATAATTTAACTGCCTCC
TACGGCAGTTTTTTTCCCATTTGACTTGAGAGGCATATGGAAGGGCATAACCACTCCGGC
TCTCGTGTCACCCATGCACCAGGGGTAAGCTTCATGTCATGCTGAGTCGGCTGTCACCCA
TATTCCATCTAAAATGGTTCTCTCCTTCATATTAGTATTTCAGTTACTGTTTTGTATAGT
TTTCTATGAGATCATGTTTTTATTTTTAATTTACACCCCTTCCTCTCCCTGTCATTGTTA
AGGCTACATTGCTTTGAACCAATAATTCCAAACATAGCACCTAAGGTTCCTCTCGTGTGG
GGAACAGGTTCAAGACCAAGTTGAACATAGGGCAAAGCAGGTGCACTACCCAAGTGAGAT
ATTTTGTGATTTTTTTCTCCTTGTTATGTTTTTTATTTTAAATCTTTATTCATGTGTTGG
CTAGAAACAGAAACAAAAAGAGAGAGATCCCTGTAACTCTGCTTCACCACTTGCAAAATT
TTCCCCTTGCAGGTGGGAACTGGGGTCTCAAACCCAGGTCCTGTGCACAGTAACGTGCCC
AACCAGGTGTGCCACCACCCAGCTCTTGTTAGCTGTTTTTTTTTTTTAATAGCACTTAGG
TGAATTTTATCTGTTAACATAAAAATAGAACAGAATCATATCAATCTGGCATGTGAAGTC
AGGGATTGAAATTAGTATTTCATACTTTTAAATCCAGTGTATTAGTTACTGTACCATCTC
CCAGGCAACTTACACTTTTCAGGAAAAAAATTATAATAACTTTATTAAATTACTGTTTTT
TGTGTGTGTGACCACTACTCGACTCTTGCTTATGTGGTACTCAGAATTGAATCTGGAAGT
TTGAAGCACCAGGCCTGAAAGTCATTTTGTAGAACTGTCACACTATTTTTTTTCTTATTA
CCAGAGCACTGACAAGCTATGGCTTATGGTGGGAGCTGGGGGATTGAACCCTGCAACTTT
TGGAGCCCTTTGGCATGACAGTCTCTCAGAATTCAGAAGGAAGGTGGGGTGATAGAACGA
CTTACAGGCCTGGCTTCACCACTTGCAAAAGCTTTTCCCCACTTGCAAATGGGGACTGGG
GGCCTCAAACCTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGTTATTATTGATGTCATGTTGGGCAGGACAGAGAAATGGAGAGAA
AGATAAAACACCTGCCTCATCACCTATGAAGTGAAACCCCCTGCAGGTGGGGAGCCAGGG
ACTCGAGCCAGGATCCTTACACCGCTCCTTGTGCTTCGTGCCATATGCACTTAACCCGCT
GCACTGCCCATACAACACTTTCTACAAGGTGTTTAATCAAAACACTTGATGATTCTTGGC
TGTAGCCTATCATTGATTCATTTTAACTGTCTTAAGGTATTTGGAGAAGAAGGACTGACT
CTAAATATTGAAGATGTTCAGCCTCATGACTTAGGAAAAGTTGGAGAGGTCATTGTAACC
AAAGATGATGCCATGCTCTTGAAAGGAAAAGGTGACAAGGCTCAAATTGAGAAACGTATT
CAAGAAATCATTGAGCAGTTAGATATCACAACTAGTGAATATGAAAAGGAAAAACTGAAT
GAACGTCTGGCAAAACTCTCAGATGGAGTAGCTGTCTTAAAGGTAAGATTTGTAAATAGA
TTTTGGATTCTGGATCCAAGAATTTCTTTTTTAATTGACATCAGGGTTATCAATGGCGTT
GGTGCTGGCACTGTGCATCCACTGCCCTTGGTGGCTATTTCCCCTTTTTCTTTCTGTTGT
ATCTGATTAGAGAGATGGAGACAGACACTTGCAAATCTGCTTCACCACTTGGGGAGAGGG
GCCTCAAACCTAGTGGCATGTACAATTAACCTGGATGTGTCACAGACTGATCCCTGAGAA
ATAATTTTTTTTTTTAAACCAGATCACTGCTCAGCTGTAGCTGGTGGTGGTACAGGGAGT
TCAACCTGTGACTTTGGAGCCTGAGGCTTGAGAATCTCTTTGCATAACCAATAACGCTAT
CTTCCCTTGCCTGAGAATTAACTTTTCAAACTGTCAAACCAGAATTAAACTTGTTGGAGG
TTTGGGCAAGGTAGTGTTATGAGGAAAGATACTTTGTGAGTAGTCATTTGGGCGATAGAG
CATGGTGATGGATTTATGGCAGGTCCTTCTGTGTGGGCCTCTCATAGTGTACCCATGCCA
GAGTGAACTGCGGCCTCAAACCATTGCCCAGCCCCCACACAGTGAGCTGTGAGCACTGAG
TGAGGTTGTACAGTTGAAATGGAAGAAAAAGTTCTTGTTCTAGTAAGTCCAATATTAGAC
TTCTGAAAGGTACTTTTTAAAAAAATATATTTATTCCCTTTTGTTGCCTTGTTATTGTTA
CTGGTGTCGTTGTTGTTGGATAGGACAGAGAAATGGAGCAGGGAGGGGGAGAGAAAGAGA
CAGCTGCAGACCTGCTTCACAGCTTGTGAAGTGAGTCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGAGACATATTCCCCCCCAACTTTTATCATTTCTGTTGAGTTTT
CTGAATTTTATGGGGTCTGTTTATGAACACTGATGTCCCTTTGGCCATTTCATGATTTAG
TAGAGATTTAATTTCTGGCACCAAGTGGTGGTGAAGCTGGTTAAATGCACATGATACCAT
GTTCCAGGACCCTGGTTCAAGCCCCTAGTCTCCACCTACTGGGGGAAAATTCACTTATGG
TGAAGCAGGACTGTAGGTGTTTATTAAATAGTTGTAAAGTTTTTTTAAGTTTGTTTTCCT
TAAAAAATATTAGGTGCCCTTTTTTTTACTGTGCTTTCTCAAGTGAATGTGGGACTTAGT
GTTTTCTTCAGGCAGACAAAGCATATTGAATGGGAGAACCCATACTAACTGGAGTTCTCT
TAAATCTCTAGGTTGGTGGGACAAGCGATGTTGAAGTAAATGAAAAGAAAGACAGAGTTA
CAGATGCCCTCAATGCTACACGAGCTGCTGTTGAAGAAGGGATTGTTCTTGGAGGGGGTT
GTGCTCTGCTTCGGTGCATTCCAGCCTTAGACTCACTGACTCCAGCCAATGAAGATCAGA
GAATTGGTAAGACCTTGCAAAGATGGCACAGTGGCTACAGTGTTAAGTTACCTTAAGATG
GTTTTATTATAGCCAGGATGTGGCTCAGGGCTAGAGGGCAGGAGTTAAGGCCCCAGGTTC
AATTAACAAAAGCACTATACGATATAGTGCTAATGCCAGAGGTGTGATACCTTTCAAGGG
TAATACTTTTTCTTTCACCTGTGGTAGAGCTGAAATTAATTGGCTTGTATTTGCTTTCTT
TATAGGTATCGATATTATTAAAAGAACCCTCAAAATTCCAGCAATGACCATTGCTAAGAA
TGCAGGTGTTGAAGGATCATTGATAGTTGAGAAAATTTTGCAGAGTTCCTCAGAAGTTGG
TTATGATGCATTGGCTGGAGATTTTGTAAACATGGTGGAAAAGGGAATCATTGATCCAAC
AAAGGTAAGTAGTTGACCATTTTCTTTTTTTAAAAAAAGACCCATTTTATTTATTCCTTT
TTGTTGCCCTTGTTTTATTGTTGTAGTTATTATTGTTGTCTTTGTTGTTGGATAGGACAG
AGAGAAATGGAGAGAGGAGGGTAAGACAGAGGGTTAGAGAAAGACACCTGCAGACCTGCT
TCACCGTCTGTGAAGTGATGCCCCTGCAGATGGGGAGCCGGGCCTCAAACCAGGATCCTT
AGGCTGGTCCTTGAGCTTTGCACCATGTGCGCTTAACCTACTGCACTACCGCCCGACTCC
CAGTTGACCACTTTCTGAAAGCATAGAAGAATTTTTCATGTTTGCCTGTTCATTGAGAGA
AAGACACCTGCAGACCTGTTTCACCTTCTGTGAAGCAACTCCCCTGCAGATGTGGATCCA
GGGCTTCTTAGGCTGGTCCTTGTACTTTCCGCCACGTGCGCTTAACCTGCCTGACTCCCG
CCTTTGTTTTTTCATTGTACTTATTGTTGCTGTTGTCATTGTTGGATAGGACAGAGAGAA
ATGAAGAGTGGAGGCGAAGACAGAGAGGGGGTGAGAAAGATAGACACCTGCAGACCTGCT
TCACCGCCTGTGAAGCGACTCCCCTGCGGGTGGGGAGCCGGGGCTTGAACCGGGATCCTT
AAGCCAGTCCTTGTGCTTTGCGCCATGTGCGCTTAACCTGCTGTGCTACCACCTGACTCC
CCTGCCTTTGCAACCTTTTTATTTTTACTAAGCTCTAAACTTTTTTTTTTTTTTAGGTTG
TAAGAACTGCTCTCTTGGATGCTGCTGGAGTGGCCTCTCTGTTGACTACAGCAGAAGTTG
TAGTTACAGAAATTCCTAAAGAAGAAAAGGACCCTGGAATGGGTGGAATGGGTGGAATGG
GTGGAATGGGAGGTGGTATGGGAGGTGGCATGTTCTAATTCTTAGAATAGTGCTCTACCA
TTATTAATGAACTGTGAGAGGGAACTCAGTAGTGTTCCTCATCAATAACTTCAGAGAAGT
CAGTTGAAGGAAATAACTGAAAAAAAAAAAAGGCTGGCTGATGCTTAGGAAAATCACTAT
AATCATCAGTTACTGGTTTTAGTTGACAACATATAATGGTTTACTGCTGTCATTGTCTAT
GCCTACAGATAATTTATTTTGTATTTTTGAATAAAAAAGACATTTGTACATTCCCGATGA
CTGAGTGCAAGAGCCATATAGCAATATACTGCTTTCAACTTAAATCACTGAGGCATTTTT
ACTACTATTCTGTTAAAATCAGGATTTTAGTGCTTGCCATCATCAGATGAGAAGCAGCAG
CCTTTATGTGGAGACTAAGAATAATGATGTACAAAGTAGAGAACTATCCAATTATGTGAC
AACTTTTGTGTAATAAAATTTTTTGTTTAAAGTTAATTGTGTTACCTTTCCATAACCTAG
GAGAGACATGTGAAAGTGGGTTGAGGAATGGGGTTTGATACAAGAGTATAAAGCATTCTA
CCTGGAGAGTGTGTGTGTGTAATTTTTTTTGTCGTTACACACTGAATGCATGATGTTGAT
AATGGCAATTTTTTTGATACTTTTGGATAGAGAGAAACAGAAGGAGAAACAACCAGCAGT
ACTGTTTCACTTCTCATAAAGCTTTCCCCCTAGCAGATGGGGGTGGGGTCTTTAAGCACT
GTGATGTGTGTACAACCAGCTAACCTGAGTAACCTGGTTGTTACTGTAAAACAAATGAAC
TATGGGTTCCTGCTAAGTGCCTTCAAGAGAGGAGAGCCAGGGTTAACAATATAACTTAGC
AGAAAGGAAAAAGAAATGTCTGTGCATGATAGTAGGGAAAACCACCCTTAGCTTTATAGG
CACAATACAGTGCTTCAGTTTTATTTTTAAAAATATTTAATCAGACCAGAACACTTCACC
TCTGGCATATTAGTGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1081, 1528..1629, 3345..3438, 5222..5390, 6642..6741, 7103..7348, 8698..8872, 9112..9290, 10063..10224
1001..1081, 1528..1629, 3345..3438, 5222..5390, 6642..6741, 7103..7348, 8698..8872, 9112..9290, 10063..10221
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved