Erinaceus_europaeus Locus ENSEEUG00000008454
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ENSEEUG00000008454
Erinaceus_europaeus
ENSEEUG00000008454
scaffold_297899
SNORD48, SNORD52
1371..1434, 1748..1815
2929
TGTCTCAGACATGTGAGTCTGCTTGCATAACCATTATACTGTCTACCCTCTGCCCTACT
TTTTTTTTTTTTTTTAACCAGATCACTGGTAAACTCTAGCTTCTGGTGGTGTTGGAGATT
TGGTGCCTTAGGCATGAAAGTTTTCCTGCATAACCACTGTGCATTATTATTATTAATTAC
AGAAGCAAATTAAATACCACAGCACAAAACTTCCTTCAGTGCAGACCAGGCTCAAGCCTG
GATTGAACACATGGCAAAGTATTATTTCTTGAAAAAAAATGTTTTTCTTATCTTTATTTA
TTGGATAGAAGCAGCCAGAAATTGAGAGGGCGGGGGAGATAGGGAGAGATACCTGCAGCA
CTGCTTCACCATCTGCAAAGGTTTCTCCCTGCAGATGGGAACCAAGTGTCCGAACTGGGG
TCTTTGCACATTGTAACATGTGCGCTCAACTAGGTGCGCCACCCACACGACCCCTATTAT
TTCTTTAAGTTTTGAAATCCCCAGCACCACCATATGCCAAGACTGAGCGCTGCTGTTCTT
TTCATGACAAAACTTTTTCTCTTTAATTTTTTTAAGTTTCGAAGAGCAATGTGGCTGGCG
GGACTGGGGACGTGATTTAACCCGCGTGGAGCGAAACCCCTTAGAGTGACCCCAAGCGCA
AGGAGGAGGTGGACAGTGCAAGGATCACCCAGGGCTCCAGATTCAACCTCGCAGCAGGCT
GCAGCTGGGGACTTTTTAAGGGGTGTCCGGTCAGGTTACCTATTTCTTTTTGAAATTCGC
AAAACGTCTTCAGATATTTGCCCAGATGAATGTGAAATTTTAGTCGTGACTTTTCTTTCA
CTTCCTTTTATTCTCCTTTGGACGAACAAAGGGAACGATGCTGCAGAGCCAGCCAGGCAT
CACAGAAGACAGCTATATCCATCAGGACCCCGTAACCCGCGCTCCTATAAATAGCCGTGA
GTCCGCCATTTCTTCCTTTCATGCGATGAAGTCCTTACAAGGCGAGTCTTTTTGTTTCGG
TGCTGCTGGGACGCTTTCCCCTATCCGGGAGCACGGCTGCTTGGGAAGTCTTGGCCTGGC
TACTCACGTGCAGGTACTTGAGTGTGCGGGTTGCAGGGCGGGGGTGCGCGCTGACTCGGG
CCGAGCAGGATGATCCACAATTACAGACTAGAGTTTCTGATCCTTCGTGACGCCACTATT
TGGAACTGACCTGGCTCCGGGCTGGGGGTATTCAGCTGGGGTCGCTTTTACTTCTTCTGA
ACCTCTCTCTCTTGTTGTTTTTTCCTTTCCCCCATTGCTCAGCTCCACGACCTGCGCGGG
AATGTCTTCGGCGTCGCGGAGGTGAGTTGTGTCATGGGTCGGGCGGGGGAGGATGATGAC
GACCCCAGGTGAATCTGAGTGTTTCGCTGACGCCATTCACCGCAGCGCGCTGACTGCCCC
CGTCTGCACTGGTGCCGGTATACGGCGCGGGGAAGCTTGAGCGCTGGGAACGTGTGCTCA
CTGCACAATTTGTCATTCGCCCATCAGGTGCTCCCGCGGCCTACCGGTGTGTCCTGCTTT
GATAAAAGTGAGTACCCATGATGCCAGTAATCGATAAACTTTTGCAAAAACTGTTCTGTA
GCTCACCGCTACTTGTACAACCGTCGGTTATGCGATCTCACGGGACTGGAGTGCCAGTTC
TTAGCATTGTTTATATATATTTATTGGGCCTCTTCAGAATGGCTTCCCTTTATCCAGATC
TCCAGATTGGGAATGATGATTCTTAAGACTAGAGTCTCTGACGCTGGTTCTGATGGCAGA
AATTAGTTTCTGATTCAATTGGAGAACTGGGTATTTGGGTGGCTGAGGAAGGGCACTTCA
GAACACAACACAGTGAGTCTCTTCATTGCATTGCTTGTTCTGTTTGCAACTTTCTAGCAT
GATTTCTGGAAGGCACTCTGGTGATTGCAGGCCTGTTTACTACAAGTTCATCCTGTTGAA
GCACCATTGAGACGATGTGTCTGCAGTGGTTAGTTTAACCAACAGCCTCTGTTGAGTGAC
GAACCATGTTTATGCAGAGTGGTGAGTTTAAAATTGGTTTGATAATCTAGCCATTTCTGT
AGCTGTATCAGCTGCCTTCATGCTACTAACACATGTTGCTTTTTTGAATTTCAGGATTTT
GCTGTTAGAAGTGTTCACTGGAGAGGTTCACCAGAAATGAAGGGTTTGCTTCTTGGCTGC
ATTACAGATGCTGGAGAAAACTGATTTGAAATGGGTGTGGTATTTGAATACTAGGCTGTA
AACAAGTACATGTCTTTATCCACATGAATCCAATAAACTTTTAAGGCAAAATAGTTTGGT
CTCTGAATAAAAGTGGTGGATTGGGAGAGAATTTTAGTAGTTAGACAAATACTAACATAA
GCCAGAGTTGAGCAATGCTCTTGTAAAAAAAATTAGCAAAGTGAAAGGTAACAAGTTATT
ATGGTCTGAATAGAAGATTTTTGCTATTAACTTTTATTATCACTGGTACATGTGTTGCTG
TGGGGATCTGCTTGGAAGTCCACTGTTTTATCCACTGCCACCTCCCAGAGCACATTTTTC
TTTTAATTTTTTTTTTCTCTTGCACTGGTTTATCATTATAGTTGATCTACTGTGCCACCT
TCTAGCTTGTACTTTTTTGCCTCCAGGGTTACTGCCTGCACCACGAATCCAGTGCTCTCA
AGGGTTATTTTTGCCCTTTTTTATCATTATGATTATTAATATTGTTGGATAGAGGATGGG
AAGCGACTTCCCTGCGGGTGGGGTGCTGGTGGCTCAAACTGGGATGCTTATGCTCAGTCC
TTGGTCTTTGCGCCATGTGCACTACCACCCGACTCCTGCCCCCCTCACCTACTTTCCCCT
TCTCTTCCTCCTTTTAAACTATTGCATGTGATAGAAAAAGAAGTCTGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1041..1053, 1058..1090, 1093..1098, 1104..1130, 1134..1180, 1191..1259, 1297..1307, 1322..1322, 1917..1929
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved