Erinaceus_europaeus Locus RPL34
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus RPL34
Erinaceus_europaeus
RPL34
scaffold_349536
SNORA76
1608..1731
5120
ACGCCCCCTTTCTGGACGTCACTTCCTGCGCCGCGCGGCCTGAGGGGACCTTTGAACTC
GCCAGCACTCTCTTCTTCCTCTTCCGGGGACGGTGTGGACAGGTATGGCCGTTTTCCCTC
CCGCTCCCGGCGGGCCTCGGTTTGCAATCGGCCGCCATCCGGGAAGGTGGGGGACGCCGC
GGACCCCTGGGCGTCCGCTTTGAGAGGACGAGGGGTAGGGGTGCAAGAGGGAGGCCGATG
GAGGGGAGCGGCTCCCCCCCTTCCCGGCTCAGGCGCTCCGCGATGGGGATCTCTCCCCGC
TCCGCAGTCGTGAAGCCGGCGCCTGCCACCCCCCGGCTCGGTCGCTTGTGAAACCTGGCG
GCTGCAGACAGGCGGGTCGCGGGATCCCGACCTGTGACACCTCCCCCCCCCCCCCCGAGG
ATTTGCGGGTGGTGGTGGGGTGGGGTGCTCTGACACCTGTCTACACTGGGGCGACACGGG
AGAGGGTTCGGGGCCGATGGCTCGCCTTCCTCTGATGGAGGCGGGGTCGCCCCGGCGCCC
GGGGTTTTGGCGTCTCCCGGGCTGGAGCTCCGGCCCGCCCCCACTGAAAGCGCCCGTCAC
GGGCGGGCGGGCCTGGCGGGGCCTGATCGCGCGCGCTTCCCTCAGGCCTCACCCCGTCCG
TTTCTCTCCGTCGTTTCTAGGCGTTCGCGATGGTGCAGCGTCTGACCTACCGGCGTAGGC
TGTCCTACAACACCGCCTCCAACAAAACCAGGCTGTGAGTGTCGCTGCCCCTTACCCCGC
GCCCCGCACCGCCCCGCACCGCGCTCACCCGTCACCCTCCGCCCCTAGGTCCCGCACCCC
GGGCAACAGGATTGTTTACCTTTACACCAAGAAGGTCGGGAAGGCTCCCAAGTCCGCGTG
CGGTGTCTGCCCGGGCCGACTGCGCGGGGTGAGTGGCTGGGGGCTGCGCAGGTTCAAGCC
CCCGCAGGGGGAAAGCTTTGCGTGGTGTGGCCGGGGGTCTCTGTCCGATAGATAAATAGA
AGAATGACCTCCAAGTTGTGTGTGCGCGCAGGTCCGTGCAGTGAGGCCTAAAGTGCTCAA
GAGGCTGTCCAAGACAAAGAAGCATGTCAGCAGGGCCTACGGCGGCTCCATGTGTGCCAA
GTGCGTCCGGGACAGGTGAGCGCTTACTAGGCCTAGCCGCGCGAGGTGCTGGGCCAGGGG
CGGGGTGGTGCTGGTCACCTGTGCTGGTGGCGGCACTCCCCTCGCGCCCAGGGAGCCCGC
CGCGAGCGCCTGTGTCCCCCCCGGGCAGAGAGAGACGCGCCGCCTTTGAGCCCCCGCCGC
CTGCAGTGGTGCCGGGGGTCAGGCTGCGGCGCCAGAGCAGCCGCTCGTGATAACTGGGGC
TCCGCGCTGCCGGCCGCCCTTTTAGCCACAAGCCACATGGGTCTGTAAAGAAAGAGTGAC
AGAGGGGTGGGGGAGATAGCGTGATGGCTACCCAAAGAGGCTAGGAGTCCAGGTTCAATC
CCCTGCACATCATAAGCAGAGCTGAGCAGTGCTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTCCTTTCAGAATAACAAGATAGAGGGT
CTTGGGAGCTCAGTAAGTAAGGCCTCTGGGCATGGCTCTTTAGAGGCCCACAGGTTACAG
CTAAGGCCCTGGGGCCGCCTCCTTAATGCTGCAGCTCACCTTACCGTCTATGATCTTGTC
CGGGAGGGTGCCAAAGTAGGTGAGATGCTGGATTCTCAAGCATAAGGTCTCGGGTTCAGT
CCACCCACATCATAGGTGCCTGAGTGTGCTCTGGTCTCTTCTCCTCGGTCATTCATTGGT
TCCCAGACTGCTGAAATACTCAGCACAATAAAACTAGGGGAGTAAGGGGTTGCCTTACCT
TGTAGAGCACAGGGAGCCAGGTGTGAGACTGGCCACCACAGGGAGGACCATTCAGAGGGG
AAGTTTCAGTGCTGTTTTTTGCCCTCAATCTGAAAACGAAAAGGTCAGTTGGAGGAGTAG
TGTGTGCCACACCCATGCCCCACGACTACTGAATGTTAATGAGTACCTGCTATTGGTCTC
TATAAAGTCCTGTGGAGAAAATTAAACTTGTCCAGGGTCTTTCATTATTGAGAGATGGCA
GAGACACCAGAGCAGTGCTCTGCTCCAGCTTATGGTGGTGCTGGGGATTGAATTGGACCT
GTGGGTCTGTGGTGTCTGAAATGGGGTGGTGAAATTGCACATAAGAAAACAAGCAGCTGG
GGGGCAGGCAGTGGACTTCTTAGGCATGAGGTCCTGGGTTCAGTCTCCAGAATTGGATGA
TGTTCTGATCCTTTTCTCCCCCCCCCACCCCAAACTAAACAAATGTATTAAAGCATACGT
GACTTATTTCTCTTTGTAGGATCAAGCGTGCTTTCCTTATTGAGGAACAGAAAATTGTCG
TCAAAGTGTTGAAGGCACAAGCACAAAGTCAGAAAGCTAAATAAATGGAGCATTTTTGAG
TAATAAAAATTTTAAAAGCCTTGTTCTCTTTTTCTGTTGTCTTTTCTTAGTATATAGGTT
TGATCTGGAGATCTTGTATAGGTGAATGATTGTTAGGACTTTGACCCTTGCCTTCCATCT
GATGGCAACTCAAATGTCTTTGGCACAAGAAGGGCCTTAGCCCCTTCACTACCAAGCTGC
CAGGTGGGTGGATGTTACCACCTTGCCCAACAGACATCTGCAGCATTGCTTCACCACTTG
GAAAGCTTCTGCTCAAACCTGGGTCCTTGTGCACTATAATACATGCCCTCAACCAGGTGT
ACCACTACTCAGCCCCATATATTCTGTGACTTTAACCTCCTTTATTACCAATGAGAGGGT
CCTATGATACCCAGAAAGTCCCAGGTGATGGCCAGTGAGGTGCACAAGTTACCTGAGGGG
GTGAGGTGTGTCCCTCTGGCCCTACTTTGTTGATGAAGGGGGAGGTCAGAGCTTTGCTCC
GCTCCAGCTGAAGGTGGTCCTGGGACCTCAGAGCCTCATGCATGAAAGCTTCACATCACC
CTTGTGCTGTCTTACCCACCCAGACCTGGTGCGTGGTACACCTAGTTAAACACAAGACTA
AGTGTCCCGGAAAGAAAAAAAGCGCTGGACTGGGTGGTGCTTGGCCAGCCCAGTGCCCGT
AGGCATGAGGACCCAGACACAAGCCCCTGGTGGGCATCATGAGTAAGTTGCAACTGCAAG
TGTCTGGGGATAGTGGAGCCAAGCAGGTGCCAAACCCTGACGATAACTGGTGGGACTTTA
GGCCTTTTAAGTTGGGCATTTAACCTACTACATCACCTCATGGGCTAAGTTACATGCTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1065, 1140..1239, 1363..1466, 4351..4432
1001..1065, 1140..1239, 1363..1466, 4351..4432
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved