Erinaceus_europaeus Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus GNB2L1
Erinaceus_europaeus
GNB2L1
scaffold_219770
SNORD95, SNORD96, SNORD95
1385..1452, 2261..2342, 3512..3578
6152
CCAACGCAAAGGGTGTTGCTAAGGTGCCCACATTTTACTGTGTTCTGGGCACTTCACCT
ATAGGAACCCTAGATTTACTCTCCGAACCACTATATGAAGTACTGTTAGTATTAAATATT
TCCACAACTGAGAAACTAAAGGTAGTACATATTAAAACAGAAAAAGCAAAAACCCTATGG
ACAAACTTCCTCATATTTGGCATCCATGATATGGAACATTATCATCTGAAGTCTCAATTA
CTGTCGGAGGTCCCCGTTCTCGAGGCCCAGTGAACAACTGTCCCTTCATCCCCGGCTTTC
CGTTCCACCACTCAACCCTGGCTTAGTCCTGCCTGGACAAAGTCCTCTAAACAAAAAAGG
GCCTCAGCCAACACCAACCGGGCATGAACTTCCACTGGAAAGAGCCACCCTCTCCACTCA
CGTAAATGTTAACAATTTAATAGTCCACTTGCGCACAATTTATTATTTTCAAAAATTAGC
ACCGTATTTTTCAGATTGCCACGGTTACTCACAGTTGCGACGTCGAAATCTAGCTCGCTT
TTCGTTTTCCTCCGAGCCACCCAGCGGAAAAGGCGGTGCTCTAGCGGTGCCACATAGGAG
CAGAGAAATGCCACATAGGGGCTCAACGCGTTGGGAGGTGTGGGGGGCACTTCCGGTCAC
CGGCTCTTTAGACTTCAGGTCCCAATCAGCATCTCAGCAGGCTTTTTATACACCCAGTCG
TGCTGGTTTTAGAACGTGAGTGTCAGACGTTGCCACACCGTGGGCCAGAGAGGAACCCGG
CTCCTGTGACTCTTCCTAGACACTAGAGGGCGCTGCCTCCTGGAGAAGTGAATCATGGGG
ACCGCCATCTTTCTCCGGTGAGCTGGTATTTCCGCTTCCGGCGGCGGGCTGCTCGGTCTT
TTTCTCGGCAGGGCGGCGGCGGGAGCGGCTGCGGTGCTCCTCTCTCTGAGCCATCCAGTC
TCATCCTTGTCGCTGCGGCGACCCCCGCGCCCGCCGTCACCATGACTGAGCAGATGACCC
TTCGGGGAACCCTCAAGGGCCACAATGGCTGGGTAACTCAGATCGCCACCACCCCGCAGT
TCCCGGACATGATTTTGTCGGCCTCTCGAGGTATGGAACAGAGGAGGGAAGGGGGTGGGG
TGGGGGACTCAAGCTGGCGCGCTTGGCGAGCTGGGGCGGGTGGTGGTGCGGTTCTGCGGG
GCTTGGAAACTCGGTCCCGGTGCGAGTTGGTAAACGCGGCCCCGTGCCTAGGCCTTTGCA
TGGACAGACCCGGGAGTGAAAGACTAGGTGCCGGCAGTGTTGAAGAGTCGGATGTTTTTC
TTTTTCATTTTGTCCTGCTCCGTGCACGTGTTGCTGAGGGTGCCCCGGAGCCTGGGAGTC
GGGCGGTGCGGTGATGATCCCCAACATGCCATCTGAGCGCCCTTGCTGAGAACCAGAGGC
TGTTTCTGAGTTGCCGCCCGGCGGGCCCACATCTACCCTTCCACCCTGTCCCCTGCCTTT
GGCCACGTTCCGTGAGCCTACGTTTGGAGGCCTCTTAAGCTGTCCGTTTTTTTCCCCCAG
CAGTGAGGGTCATGCCTGCCACAGAACTTGGAAAACTTGTGGAGTGGACCGTGAATTCGG
TGAAACTCCCAATTCTAGAGAGTATGAATCCACTGTTTTAATCCCACTTCTAGCAATTTC
TAGATGTAAAGGAAGTAGATCCACAGCTAGTACCTGCGGAACCCAAGCTGCTGTTTGCAT
TAGATCTAAGATCAAACTCAGACAGCAGATTGGTCACGGTGTCAGGAAAGCTGATTTCTG
GTCTGTGTATGAATCGCATGCCTGTAATTTGTGCTTTAAGCCCATCGATGACCTTTAAGC
ACTCTGGGTTACCTGGCTCAGCAAGTGGCCTATAACGTTTCCTCACTTGTTTTTCCCTCT
TTCAGATAAAACAATCATCATGTGGAAGCTGACCAGGGATGAGACCAACTATGGCATCCC
ACAGCGTGCTCTCCGGGGTCACTCGCACTTTGTTAGTGATGTGGTCATCTCCTCAGATGG
CCAGTTTGCCCTCTCAGGCTCCTGGGATGGAACTCTGCGCCTTTGGGATCTCACAACGCA
AGTAGCTGCTCGCTTAGCTCTGGGGCCTTGGGGGGAGGGAGGTTGGTAGAGTTACTGCAG
GCGATGTTAACATTTGTTGGATAGTGTGCTTAGGAAATGGGTGCTCTGTGGGTGGTTTAT
TGAGGGGGGGGACAGCCTTTGAGTGGTCAGAAGTACTAGAGAATCCTGATGATGATAATA
AGACATTGTTAACCTGATCCCCACGTGGGGGTTGAGGACAAGTCCTGCAATTCTGAAAGG
GTTCTCTGGCTTGTCAGCCAAAGGCCTGCTGTAACCCAGCCTGTGGGACTGATGAAATCC
CTTTAAGCTAGAAAAAGGCTAGGGAAGTAATCTTGAGTGTTTGCAAAGTCTGTAGAGTGA
CCAAGTACTTCTTTTCTCAGGGGCACCACCACACGCCGGTTTGTGGGTCATACCAAGGAT
GTGCTGAGTGTAGCCTTCTCCTCTGACAACCGGCAAATTGTCTCTGGCTCCCGAGATAAA
ACCATCAAGCTCTGGAATACACTGGGAGTGTGCAAATACACCGTGCAGGTAAAGGCACAA
GCACCCAGTACATGGCGGGGTTCTTTCCTAATCTTTGGGCTTAAAATTTGGGACTATCCT
AAATGTTTGGCTTTTTGGTGACTGCATTCATATGGGGGGTGGTTAGAGGTTTTGTTGGGC
ACAATCAGGATCTCAGTTTACTTTCTTTTGTAGGAAGAGAGCCACTCAGAGTGGGGGTCT
TTGTGTGCGCTTCTCGCCCAACAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTTTTTTTTTTTTATGCCTCCAGAGATATTGCTGGGGCTTGGTGCCTGCACCAT
GAATCCACTGCTCCTGGAGGCCTTCCCCCCCTTTGTTGCCTTAGTTTTAGCATTGTTGTG
GTCATTATTATCAGTTATTGATGTTGTCATTTTTGGGCAGGACAGAGAAATGGAGAGAGG
AGGGAAAGACAGAAAGATAAACATCTGCAGACCTGTCTCACCACCTGTGAAGCAACTCCC
CTGCAGGTGGGGGAGCCGGGGGCTTGAACCAGAATCCTTACACTGGTCCCTGCACTTTGA
GCCACATGCACTTAACCCACTACACTACCTCCTAATCCCCCAGGCTTTGTTTTGGTTTTT
TCCCTCCCCCACAGTTATCACTGGGTAACTGCAAGAATAAGGCCTCCCAGGTGACTTTGT
GCCTCAGCTTTGAAAACCATCTCTGTTGACTATTCCTCTTTGCGGTTTAGCCCAAAGTAT
GCAAGGCCGCACTGTATTTATTAGCTGTCTCAATGGTCTTTGAAGTGACCAGACTAACTA
GCTCGTTTGTGTGTGTGTTTGGGAGTAAGGTGGTGCAGTGATGATCCCAACATGCCATCT
GAGTGCCCTTGCTGAGAACCAGAGGCTGTTTCTGAGCTGCCACCAGATTCTCCTGATTTA
CCCTCCCACTTTTTTTTTTTTATCTTTATTGGGTAGAGACAGCCAGAAATCAAGAGAGAA
GGGTGATAGATACCTGCAGTCTTGCTACACCACTGAAGTTTTCCCCTGTAGGGGGGACCG
GGGACTCGAACCCAGGTCCTTGCTCATTGTAATACATGAGCTCCACCAGGTGTGCCACCA
CCTAGCCCCCCTGCCACTCTTTCATGTTTGATCTGTGCCCTCCTGACCACTCTGTCTTCG
CCCACCTCAAACACAGGTGTGGAACCTGGCAAACTGCAAACTAAAGACAAACCACATTGG
CCACACAGGCTATCTGAACACAGTGACTGTCTCTCCGGATGGGTCCCTGTGTGCTTCTGG
AGGCAAGGTATTTGGGGCTGGGGATTTGCACATGATGAGAGGTGATTGAGGGCAATGTCA
ATAACAGACCTTAGAGTCAATTTATACACATGACACTACCAGAAAACTATTTTTTCATAG
ATTAACTCTTTATGCTGTTGGTGAGATTGACAGTTTCAGACCACAGAGTTGATGATGGGG
CATTGGGACTTAAAAGCAAGGTTTATAATGACAGCCTGCTGTGGGTGTTTACAGGGAAGG
CTTTTAGGGGAGCAGTCTTGAGACAAGCAAGATTAACCCAGAAGTGGATATTGCTTATTC
TCATCTGCCCAGGATGGTCAGGCTATGCTGTGGGACCTCAATGAAGGAAAGCATCTTTAC
ACGCTGGATGGTGGGGACATCATCAACGCCCTGTGCTTCAGCCCCAATCGCTACTGGCTC
TGTGCTGCCACTGGCCCCAGCATCAAGATTTGGGTGAGTGAACTGCCTGCCATTGAGACT
TCCTGGGCCTACTTCTTGGGCCTCAGACCTAGCAAGCCCTGACAGTGTTTTAAACATCTA
CATTTGGGGTGGGGGTAGGTAGCATAATGGTTATGCAGAGACTCAATCCCTGAGGCTCAG
ATCCAACCACCATAATCCAGATCTACTGTTGTATAATGAAAACAGCCCCTCCCTTTTGCT
GTGAGGCAGATAGCACTGCATCTTTAATGGCAGCACAACTGTAACAGTGCCCTGAGTTCA
GTCCCTGCCAGCATGTGTGCCAAGGCAATGTTCTGGCTTTGTCTTCACTGATAAAATTCC
TCCTAAAGACAGCCAAAAGTAGTGACTAGGCCTTCCTCCTGTCAACTTAAATCATGCTGC
TTTTGCCTCCCCCAGGACTTGGAGGGCAAGATCATTGTGGATGAACTGAAGCAAGAAGTC
ATCAGCACCAGCAGCAAGGCGGAGCCACCACAGTGCACCTCTCTGGCCTGGTCTGCTGAT
GGCCAGGTAAGCACATTGAGCTCCTTTCTGGCATGTTTCCCACGTAAGGCACAATGACAG
GAATGAGCGGGTTGGTTGGGAAGGACCTAGCTAGCTGCGTCAGTGGTTATATCAGAAAGG
CACCACTGTAATTTTTGACTCTGACTTATCACCACTCTCTTTCACAGACTCTGTTCGCTG
GCTATACTGACAACCTAGTGCGGGTGTGGCAGGTGACCATTGGCACACGTTAGGAATACA
TGGCACAAGTCTGTCTATAAATAAAAGTTGGTTTTCTCAAGTGTGCTTTCTCTGGCAAGT
TTTCATTTAGGGTTATTCCCTTAAACTTGGACTTGGGCCAGTCTAATAATGTACTGTTAT
TAGGGGGTGGTTCTAACTTTTGGTGTGGACTAAAGCTCAGTGTTAAGTCCTGAAGTGTGT
CCGAAAATAGGGCTTAGTGTTACCTGAATGGATAGAGTCCACAAAGAAGCAAATAAACTT
TATTTCCACAACACAGCCCCTTTTTCCCCCAGGAACATGAAGTCAACCTCAGCCACCAAA
GCAGAGGGTAAAAAGCCATTAAGTGACAGAAGGCAAGAAGTTATTAGAAAAATAGATTAT
ACCCAAGGCTGTCCTCCCAGGAATATGCACCTCTGTTCCAAGCTCCCTGTGTGAGGGCAC
ACCAAATAAAGAACAAACAACATGGAGGCAGTTAACTGACAAAAGGAGCTCCACTGAACA
GGGTAGAGGGTGGGATAAGCTTTGCTCCCAGATTGAGTGCTGGAAAGAAAGATGGGGGGG
GAATAATTTATTGGGTGAGAACAGTGGTACTGTGATGGTGACCCATTCCAGACATCAGAA
GCTAAATTCTGGGTGGTCTATGGAGGTAGAAATTAGGGATGGAAGGAAAGTTTAGAATGC
CTCCTTCTCCCAGAGTAGACATTTAATTATTAGCCCAGCCTGCTTTCCCCAAAAATGTTT
CCAGGTCTCTTAACTAGTTAGTTGAGTTTTGCACCAGAAAACAGCTGGAATGGGAGTCGT
CATGGACTCTACCCAGATCTCCCAGCAGTAGCTAGAAGGTTAGAGAGCAAGGCTTAGGAA
AAAAACAGAAAATACCTCCCCTCATCCCTTACTCAGGTCCCTGGATGGACAAGGAAGGGA
AGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 1925..2096, 2480..2627, 2793..2818, 2820..2889, 3856..3966, 4272..4412, 4815..4925, 5087..5152
1001..1109, 1925..2096, 2480..2627, 2793..2818, 2820..2889, 3856..3966, 4272..4412, 4815..4925, 5087..5149
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved