Erinaceus_europaeus Locus PABPC4
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus PABPC4
Erinaceus_europaeus
PABPC4
scaffold_217710
SNORA55
9011..9140
13517
GCTGTGGCGCTGTGCAGCTGCACCGGGTCGCTCTCGCTAGGCCGCCCCTCCTCGGGCCC
CCCGGCCGAGTGGGCGGGCACGACTGCGCCCAGGTCGCGAGGCGCCCTCCGACCAGCAGC
GCCCGGGGCGGGCGGGTATAAATGGAGCGGTGGCTCAGCCGGCCGCCTCTCTCCGCCCCG
AGTTGCCGCAGCTTACGCCGCTTTTGGCCTCCGCGGCCTGAAGGGGGAAAAAAAAAAAAT
TAAAAAAAATCTGAAAACGCTTTAAAAAATCTTAAAAAAAAAAAAAAAACAGTAAAAGAA
AAAAAAAAAGAAGGGAAGAAAGAAGAGAGTCCTCAAAGCACCCGCGGAGAAGTCACGTTC
GCACGCTTCCAGCCAGCCCACCCGCCCTCCGCCGCACCTGGACGCCGGTCTGTCTGTCCG
TCCGTCCGTCAGTTCGCCCACCCGGTGGTGAGCCGCCCGCGCCGCGTGGCCGCCCCGCGC
CCCGACCCCGGCTCCCGCGACCACGTGTCCGCGCTGCCCTTCGCCGCCCGGCGCGGGAGG
GAGCGAGCCCGGCCCGGCGGCTCCCACACCTCCTGCCGGCCGCTGTAATCCTAAACCACC
GGCCGCCCGGGGCCTTTATTTATAAGCGGGACGCGCGTCCCGGAGGCCGCCTCGTGAGGG
AACTGGATCGTTTGCGCAGACCCCTCGTTTTTAATTTAAATATATAATTTTCCCCTTGGG
CCACTGAAATTGGGCTTCAGCCCGGGACAGTGCGAGTCACAAACTCCCGGCGAGGAGAAA
GCCTGCTACTTATCTTGTCCTTCCGACAGGCTTTTGTCTGCGGGCTTGCAGCGTCGCGCG
AGCCGCCCCTCAACTTGGACCCGCCGCGGGGCGAGCGCGCGCTGCCACCTGTGAGCCGGC
GCGGCCGCCCGCGCGAGCCCTCCCGCCCGCTGTCCTTCTGTCCGGCGGGGTCCCTCTGAG
GAGTCCTCCTGGCGGGGCTCGGGGTGGTGGGGGCCGGGGAGATGAACGCTGCGGCCAGCA
GCTACCCCATGGCCTCCCTGTACGTGGGCGACCTGCACTCGGACGTCACCGAGGCCATGC
TGTACGAGAAGTTCAGTCCCGCCGGGCCGGTGCTGTCCATCCGGGTCTGCCGCGACATGA
TCACCCGCCGCTCCTTGGGCTACGCCTACGTCAACTTCCAGCAGCCGGCGGACGGGTGAG
TGCGCGGGGACACCCCCGGCCCCCCAGCCCCTCCGGGCGGCTCTCCACCCTCGTGGCGGG
AGGGGACCTCACGACGGACGGCACCTGGTCACGGGCCCTCGTGGGAAGCAGGTGATGCGG
GAGGGGAGAGCGCGGTGCTGGCACCAGACGATGGGACTGGCGATCTGGCTTTCGCCACTT
GCTACTGGGTGACCTTGGGCTAATCTGGTGGCCTTGGGGTTGAAACCCAAGGAGACTAAA
ATGGGGTCAGAGGAAGTGACTGTCATTCTACTTCACGTGTGTGGAGGGGTGTTAAAAAGA
GATACTTGCCCGCGCGGGGGTAGATAGCATGATGGTTATGCAAATAGGACTCTTAATGCC
CAAGAATCTGAAGTGCCAGGTTCAATCCCCAACACCACCATAAGCCAGATCTAAGCATTC
TCTGGTTTAAAGAAAGAAATACTTGCCTGGTGGGCAAAATGGGCTTGTGCCCCCTCATAG
GCCTGACAGAAAGGCAGAAGGGGGGGAACACAGTTCTCGCAGGACAATTTAACCGGCAGA
GGTACTAACCCTTTCCCTACCTTGATTTAAAAGTCGAGTTCGGTTTTGTGTTGGTAAGAG
AAGCCTTTCAGGGCAGGTACAAAAGGTAGTGGGAGCGCCCTTGATAAACTTGCCCAGGAA
CTCACATTGGCACCGTGTGCCAGGCCAGCTCCCTGGGCTGTGGAGAATGGTGCTCAGGTA
GTTCTGGGGGCAGCGCTGGACCTGGTGGGGCTTTATCCCCTCAGATGTGAACAGTGCTTC
TCACGGGTGGGAACCCTTTAACTTGACCCCAGTTGCAGAAAATAGGGCTGCTGAGCGGGT
AAAGGAGCCCCGAGGCTGAGCCGGGGAGGCTAGTGCAGTGCCCTGGGGGCTCAGTTCAGG
GCTCCTCTGGAGTATGGGGAGGCGGGCTGCCAGACTCACAGGAGTGAGGCCAGCAGAAAC
CTAACCAGGGGTCGCACGTGACTCCAGATTAAAAGGAAACAACTGTACAGACGATTGCTG
GGAGAATTGTAGCCATTCTATGGCAAGGGATTTCCATGTCCCTGTTTTGTCCCAGCTTTT
AATTCACTGTGAGGTAAGAGGCCTGTCATTTGCCCAGAATGCAGCTGAGACCAGAGAATT
GGACTTGTTGAGAAAGAACCACTGCTATCAGTTGTCTGGCCAGGGGCACAGGGTAGCTGA
ATGCCCCCCCCCCTCGTTTTTTTTTTTTTTTTAAGGGTTTTTCTTTCACATAACTATATC
TCCCCCCACACAAAGAGATTGTCCTTCCCAAAACCCCCCCCCCCCCCCCCCCGCGCCGGG
AAACCCAATGGCCACCCTCCCCTTCACCACAGGGTTTTACTTAGGTGAAAGTTTTTTTTA
ACGGGGTAGTGTACTAGTTGTTGCCACTGCCTTCTTGATTCTTAAGAACAAAAACCTGTC
ACTTTGGAGAGATGGAAGCCACTGATGGTGTGTTTGCCAACACATACCTTTGCAGGGCCT
CTCCCTGCTATAAATAAGTGTGGCCAGATCTGTCAGACTAAGCCAGCTTGCCTTCTCTGA
TATCTGGAAATAAAGAGCAAGCTATGCTGAGACAGGCTTCTTTGCTGGTAATGGACAGTT
TGGAGGCTCCGAAGCATCGTTTGCTATCACAGTTAGGTCTGTACTTGGACTTTCCTCACT
TGGATTTGCCCTGTTCCCCTCTCACTTGACTTTCCCCCCTCCAACACCTAAGAAATCCAC
TTTCTGAGGATGGATGTAAATGAGAGGAGACACACTCCCTTGCTGACTGGCAACTGAGCT
TTTGGGGCAGTGTTACCTTGAGCCAATAGATTTAACTAACCTCTTCCCCACCTCACCCCA
AATCTGATAGGCTTAAGTCATGAAGGTGATAACAGCTTTTTTTTTTTTAAGTTTGTTTTT
GATTACCAGTGAAGGTAGTGTCACCACTGGTAATACAGATGGCATATTTAACTCTAGCAT
ATTTAACTAGTAATGATTTCAGCACACATAGCCTTAGCTGTAAAACTATGGAAATACACC
CCAGTGGACCAAGTGGAGAAATCAGGGCCTATGATGAAGCCTTAGAATTCTCTATGACTC
TGAAGGTTTCAGAGGGTCTAAAGGCCACTGATGATACCTATTTACGTATTTATACCTGAA
GCTCCAGTCCCAGGTTGAATTCCCATGTCACCATAAGCTAGAGCCGAGCAGCGCTCTGTT
GTCTTTCTCTGTATCTTTCTGTATTTCTCATTAAAATAGATTTCAAAAAGGAATTAAGTG
TATTTTATTTATTTATGATATATAGACAGACAATTGAGGGAGAAAGGCACCTGCAGAGTT
AGTACACCACAGGTGGGGGCCTGGGACTCAAACCCAGGTGCTTGTGCATTTTAACATGTG
AACTCAACCAGATGTCCTAGCACCCAGCCCACCCCAAAAATTATTTTCATCAGAGCAATT
GCCTTGAGAAGTCCCTGGTATTGTTGAGGGACTGGAGGTACCTAGAGGATACCGCCCAGA
AAGTGGGAGTGGCCATAGAGGTGTGGCTTAGAAGGGTGGGAGTAGGGTGGAGCTGGGACT
TGGTTATTAAAAGTCAGAGCTCTGTGGGGTCTGACTCTAATCTGGATAAATCATCCAGTG
AGTATTATAACTTCTATCCCTCTCCTCTCCTTCTCTCTCCTCTCCCTCTCTCTTCCCCCT
CTCTCCTTCCCCTCTTGCCCCCTTCTCCCCCTCTTCCCCTCTCTCCCTTCCTAACGTGAA
TGTTCTCAATTTTCTTTTTTTAATATTTATTTATTCCTTTTTGTTGGCCTTGTTTCTTTT
TTTATTGTGTAGTTATTGTCAGTGTTGTTGGATAGGACAGAGAAATGGAGAAAATTTAAA
ATTCCTAAATCATGTTCTCTCAATTCTTTGAAATAAAGCTTGACAAACTTTTTAAATATT
AGGGAAATAAGCATTGGTTCTCTTCCCCCAAACAGTGTGGTGGCAGTTTTAAATTATGTC
CTCTGCAATGTTTCTCTCTTACAGCTGAAAGGGCCTTGGATACTATGAACTTTGACGTGA
TTAAGGGGAAGCCTATCCGCATCATGTGGTCTCAGCGGGATCCTTCTTTGAGGAAATCTG
GCGTGGGAAATGTCTTCATCAAGAACCTGGACAAATCTATAGATAACAAAGCGCTTTATG
ATACCTTTTCTGCTTTTGGAAACATTTTGTCCTGTAAGGTAAACACTGAGTAAATGATTT
CAGCAGAATTGTTATATCCTGAAAACAAGATAATAAAATACCGAATATAGGAAACTTAAG
AATTTGCCAGACCACTTAAAATCATTTTAGAGTTATGCATTTGCCTTGTAGGGTATTCGC
ATGTCTGACTTCCAGTAGAATTAAATTCTATTGTGGGCTTGATAAACATTCCTTACTCTC
AAGTTTTTGAGATGAAATAAGTCATTTGAAACAGAGACAGCCTAATAACTACATTTTGTA
AGTGGGAAATTTTCTAGGTCCCTCTTAGAAAAACTTTATCATGTGGTCTGGAAGGTGGCA
TATAGTAAATAAAACATTGGATTCTCCACCATGAGATCCTAAATTCAATCCCAGGCATCA
CATGTACGGTAGTGATGTCTGGCTCTTTCTCATAAAAAATGAATGAATGGATGAATAATA
ACTTGAAAGAGCTTACCTACCTTTTGACCATGAATGGGCTAAAGGCCTCTCACTCAGGCC
ACATGGTCTAGAAGGTTGAAATAGCCAGTTGACATTAAAGTGACAATGCCTGTTCCTGAC
AGTGGTATGTGATGAGAATGGATCTAAGGGTTATGCCTTTGTCCACTTCGAGACCCCAAG
AGGCTGCCGACAAGGCCATCGAGAAGATGAACGGCATGCTGCTCAATGACCGTAAAGTGT
GAGTGTCTCAGTCTGGAGCAAGAGCCATCGCATGAGCCAGCCGTGAGCCCACCCCAATAT
TAACTGTCACTGGTGGCTGCTGGTTCTCCCCCAAGTGTGGCCTGCTCCTACCTCACCACT
CCAGGGCTGGTGAGTCTCTCTGAGCTGTGGCAGCCCTTTAGACTCACCAAGGTGGGCTTC
TTGCCCAAGCCGTGGCCTGCCTGCCACCTCCCCATAAAAGTTTAGGTTTTGTGAGCACCA
GCAAACAGGCTGGCTGGAGGGCCGCTCAAAACCCACTCTGAGCAGGGTTATCGGCCAGCG
GCAGAGTGGAGAGGGCCCTGGATTGACCAGGAGCTATCATGTTAACTGTAGGACTGGCTC
TCCTGTGACTCAGGTCTCTGGGTTCACTTTTTAGTGTAGTGGTTAATACCTAGTTGATCC
TAATCTTTACTTGGCAAACATGGCTTGTGGCCTCCTAATACAAAATTGACTCTCGTAAAA
TTTGATTTGGTTACAATGGAGGAACTCATCCTGTTGGCAGCAGGAGCTGTCCATATGACC
TTGTTTGCTTTGGGTGGTTATTGCAGACCACTGGAGCAAGGGGATCTTAGCTAAGCCAAG
CAGATAGAGGAGGAAGGACAATAATAAGCCTTTGTCTATTATAAGGGAAAAATAATTTTT
GTCTTGTGTCATTCAACACACCAGGGATTGTGTTACATTGATAGTATGTATGTACCCTGT
GGTCAGTTTACTAAAGAATCACTAGACAGAAATCTGAAACTTTTCAGTGATGGGTGTATT
TTCCTCCTGCAAACAACATAAGTCTTCAATTCCAATCATCTCATTCCTTGGATTAACCAC
TGTTAACAGTTTGGTTTATATCCTTCCAGACCTTTTCTATGCATTTACATAGATGCACAG
AAATGAACATTTTAAACATGGTCACCAAGTTTCTTCATGAAAGCAGAACGATGTGGTAGG
AGTAGCCCTGGATCCTTGCAGGACAATCTTGCTCTTTTTCTTCTGGGGAGTTGGGTGATC
TCTGATTCTACTGTCAGATGGGAACTTGTGTTCTTCCCTCTCCTGTCCGTCTCCTTCATT
CCACTGAGCTCCAGAAATTAGTGTTTTCTTCTTAGTGATCACTTTATGCCATGGTTTCTT
TATAGGTTTGTAGGCAGATTTAAGTCTCGAAAAGAGCGGGAAGCTGAGCTTGGAGCCAAA
GCTAAGGAATTCACCAATGTGTATATTAAAAACTTTGGGGAAGAGATGGATGATGACAGT
CTGAAAGAACTATTCAGTCAGTTTGGTAAGTCTAATTCTTTGCCCCATTTGTCCCTTTTC
CTAGGTCTACAAACCAGGGATTTATTTTACTTACTTACACTGAGGACACCTAGACATAGA
GGAGAAATAGCAGGCATGGCAGAAGTCATAGGGTAGGGCTAGGGAGACAGCATAATGGTT
ATGCGAAAAAGAAAATTTCATTCTTCTTATAAGGCTCTCAGGCCTTATGTTCAATCCCCA
CCACCACTTTAAGCCAGAGCTGAGCAGTGAGTGCTTCAGTCTGTTTCTCTGTATTTTTCT
GTATTTCATTAAAATAAAAATATTAAGGAAAAAAACCGTAGCCCAGTCCCAGGACTGTCT
CCACAACATGGTTAGAATAAGGCCAGACTACATACGGGAGTGCATTCAGTAAGGGGTTTA
CTTAAGTAAACTAGAGTCTTCCTTGGACTGTTTTGGAAATGATGTCACTAATAGTTCTTT
CCTTTGTGAATAGGTAAGACCCTAAGTGTCAAGGTGATGAGAGATCCTAGTGGAAAATCC
AAAGGCTTTGGCTTCGTGAGTTATGAAAAACATGAGGATGCCAGTAAGGTGAGAGCACCA
CAAGAGTTGATTTGACGACATGGCAGTAAATTATATGTGAAATTAACATGACTTGATACA
CATAAAGGAACTGAATGACAACCAGATTACCAACCAATGTTCATGTCCAATGTTGCATGG
AATTAAAGTTCAGAGCAAGGCCCTTGCTTCTGCATCTTAGTTCAAAAACGTGTTTTCTTT
TAGGCCGTGGAAGACATGAACGGAAAAGAAATTGGTGGAAAAGTTATATTTGTAGGCCGT
GCACAGAAGAAAGTAGAACGACAGGCTGAATTAAAAAGGAAATTTGAACAACTGAAACAA
GAGAGGATTAGTCGGTACCAGGTAAGAGGTCTTTTGCACAGCCTACCTACCAAGAGTTTT
ACTGTAGAGTATTTGCTTAGTTTAGAAAGAGATAAGTTGAGGGGGAGGCACCTACATTAC
TGTTTTCACAGCTTGTGAAGCTTTCAGCAAGTGGGGACCCCAAACTGTAACCTGAGTCTT
TGTGCACTGTAATGTGTACTCTCAAGCAGGTACACCACCCAGTCACTAGCATAACATTCT
CTAAGGATGTGATTATTAAAAAGAAAGATTAGTTTATTATTTAGAAACTCTTTGGGGAAT
CTGTTAGATCCTAGTAATTAAGTAACTTGAAAAAAGACTGGCCGAGAATGTGGTACAGCA
GTAAGAGCCCTCTCACAGGTGTGAATTGCTGATGTTGATTTCCTGGCACCACGTGTACCA
GAGTACTGCTCTGGCTTCTGTCTTTTTCTTTTTCTTTTTTATTTATTTACTTAATGGGTA
GTGACAGAAAGATCCCAAAAGGTAAGTGGGGAAATAGAGGAAGAAAGATACCTGTAGCAC
TGCTTCCCCCATTGCAAAGCTTTCACCCTGCAGGTGGGGACAAGAGGTTTATTTCAGAGA
TCATGGCAAGAAGGAACTCTGGTCAGCCAGAGCAGCTATGATATTACTATAGGACAGGCT
TTTTTTTTTTTTTTTTTGCCTCCAGGGTTATCACAGGGGCTCAGCCTGCACTACAAATTC
ACTGTTCTTGGAGTCTGTTTCTTCCATTTTGTTGCCCTTGTTGTTTATTGCTGGTATTGT
TATTAATGCTGTCATTATTGTTGGATAGGACAGAGAAATGTAGTGTAGGGGAAGAAAAAG
ACACCTGCAGACCTGCTTGTGAAACCACCCCCCTGCAGGTGGGGAGCCAGGGGCTTGAAC
CTGGATCCTTATGTTGGTCCTTGACTTTGTTCCATGTGCACTTAGCTTATCAGTCTTCAT
CAGAATTGCCTACAGGGTGGTCAGGGACGTGGCACAGTGGATAAGACATTGAACACTCAA
GCATGAGATCCTGCGTTCAATCCCCGGCAGCATATGTACCAAAGTGATGTCTGCTTCTTT
CTATCTTTCTCATGAATAAAATATTTTTTAAAAAAATTACCTACAGGGATTGCTAAAAGC
ACTTTATTGTCCCCTAGGGTTTCTGCTTCATTAAGTTTAGCATTTCTTTTTTTTAAATTT
TTTTTAATATTTATTTCATTTATTATTTTCCCTTTTGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTCCCCTGCAGGTGGGGAGCCGGGGTTCGAACCGGGTATCCTTA
TGCCGGTCCTTGTGCTTTGCGCCACCTGCGCTTAACCCGCTGCGCTACAGCCCGACTCCC
AAGTTTAGCGTTTCTAACAAGTACCTAAAGATGTTGATACTGCTGGTTTGAGACATAGAG
AACCATTATCTTACAGAGCATGTGAGGAGTGGAAGTAGAGTTATAGTGTGTGATTGTTCT
CCTTCAGGGTGTGAATCTCTATATTAAGAACTTGGATGACACCATTGATGATGAAAAGTT
GCGGAAAGAGTTTTCTCCTTTTGGATCAATCACCAGTGCGAAGGTATTTTATGTATTGAG
ATTTATTAGGTTCATATCGCTGTCTTCCAAATATCAGGGTATAGACACGAATCTGGGCAC
ATTCCCTCCATGCACCTGAATCTTTCCCACTCCTTGCTCCTGCATGTAGGAGTGGGGACA
GATGGTGCTATAACATAGCAGAGGAAATCCAGATGGGTTTCCATTGTCTTGAAACCTGTC
TCTACAACTCTCGCCACACTTTTTTTCTTGAACACGGAGGCTTATACTGAAGGTATACAA
GAGATTTGCTGAGGCTCTACAACTAATAGTGAGCTGGGGCTAGAATCCAGATGTTCCTCT
CCCAGCTTGGTTGTCTTGTTTCCATTGGATTAATGAGGACGGTCTTGGTTTGTTTTTTTA
ACTCCTGCCCACAACATGTGGTACTTAAAATATATCCTACCTAATTTCACTACAAGTTTT
ATTCACATAGTTGTCAGGCAGAGGCGTTCTACAAATTACTTTTGACTGTTGTCCTTGGGG
TACTTGGGTAACAGTGTTTCCAGGTAGTATCCTAGATCCTGGTGTAAGTATTACCCAAGT
CACTATGTTTGAGAACTTTGGAATCAGTGGGAATTTGAAAAAAAAAAAAACGTAGGGTCT
ACCTTTAGAGATTACTACTTGATTGGTTTATGGACACATCCTGGGATGAAACTGGCAACC
TCTGACCTAGATTTTGTAATTTACAGAATGAACATTTATTTACATATCTACACATTAGTT
TGGATTTATGGTTTATAGCTGACAGCAAAATACAGTAGTAGTTTTTTCCACGTGACAAAC
TAGCCTCCTCCCCCAGTCTTTAATTCTACTCAAATGTACCTTTTAATGTCTACTTGTTTT
ATAGGTAATGTTAGAGGATGGTAGAAGCAAAGGGTTTGGCTTTGTCTGCTTCTCCTCGCC
TGAAGAGGCAACCAAAGCAGTCACTGAGATGAATGGACGCATCGTGGGCTCCAAGCCATT
ATATGTTGCCCTGGCCCAGAGGAAGGAGGAAAGGAAGGCTCACCTAACCAATCAGTACTT
GCAGCGGGTGGCTGGAATGAGAGCACTTCCAGCTAATGCCATCCTAAATCAGTTCCAGCC
TGCAGCTGGTGGTTACTTTGTGCCAGCAGTTCCACAGGTTGGTTTGGTGCATATTCAGGG
CTCTTTGGAACTTGACCAGTGATGGGTGGGGTTGGTCAGGGACTTTTTAAACATTAGAGT
TACAGAATGTCCAAGTAAGAGTGTCAAGATAAAAGAACTTCCTCACGGTATTCCCATCTC
TGCCCACACAAATACAGTGGAAGTGGAAAAGTAAAAGAATCTCCCATTAACTAACATTCC
CCATACTTTTGAATAGAGAGAGAACTAATATCCTAAGGTTCTTAGCCTTAGTGACTAGTA
AAATGAGATTCTCTACTATGGTTTCAGGTCGTCAATGGAAAAGTGTTATTCTTTTCTTGC
AGGCTCAGGGAAGAACCTTAATACCCACCCTAAACCAAAATAGCACAAATGAGGCCTATT
CAACGCTGGCAGCAGTTGGGAGACTCAAAGTTAGGTGGTGGGGGTATAGTTGTTTGTGAT
AGGCCCAGGAAAATACCTTTTCCTTTCTGAGAAGAGTCTGGAATCTACAGTGATACACAA
TTGTCTTTTCATCAGGCTTCCAAGGAATTGCCAAGTGCTATACGCCAGTCCGGGCCTCGT
CCAACACTGCGCCATTTGGCTCCAACTGGTAATGCTCCGGCCTCTCGCGGCCTCCCTACT
ACCACTCAGAGAGTCGGTGAGCAACTAGCCTTGAAGACTGACCCAGGGAGGGGGTTCTTA
GTGAGGCCCTGCCCTGGGTTGGTCAGTTTGTTGGACTCATTAATTTTTTAAAGTTCTGGC
TATGTGAATCAATAAGCTTTGAATATTTGTTTCTTAAGATTCTTTGCTCATCAATGACTC
GTGTGAAAAATAATAGCTTTGAAAGTTCCTTACTTGGATGATGAGAGACATCTTTTGGAT
GAGGCTAGAGATAAGGGGAACTTGATGATTGTGCTGTGTTTTCTAAGAGGCTCCAAGGAG
ATTAGTTAGATAACTAACTGGAAAGTAGCGGTAGTGGTCTGTGTATGTCTTGGTTGCTTT
GGAATTTCTCCTTCCGTGGGACGTGGCCAGTTGGATAACTGCCAACACTGATGTGCATTT
GCTGGTCTGTTGTAGGGTCTGAGTGCCCGGACCGCTTGGCTATGGACTTTGGTGGGGCTG
GTGCCGCCCAGCAAGGGCTGACTGACAGCTGCCAGTCTGGAGGTGGTATTAGATGCACAC
AGAATGGGGACAAGGGATTTGACGGGTCTTTGCCCAGACTGATGGGACTTTAATTTTGTT
TGCTCTTTTCCTAAGGCGTTCCCACAGCTGTGCAGAATTTGGGACCTCGTGCTCCTGTAG
CTGCTGCTGCCCCTCGAGCTGTTGCACCTTACAAATATGCTTCCAGTGTCCGAAGTCCTC
ACCCCACCATGCAGCCTCTGCAGGTGAGCACAACCAACTATGATGAAAAGATCACCCTTG
AGTCTTACTGGGTCAGATGGTGGTACGCTGGGTCAAGTGCACATAGTACTATGTGCAAGG
ACTTGTTTTCAAGTCCCCACTCCCCACCTGCAGGGGGCAGGCAGGTCTACAAGTGTCTTA
AGTTTAATGCCTAACCACTATGCTATCTATGCCAAAGAAGGTTCATTTCAAGGAGGGAAA
TCATAGAAATGTACTTACTTGCGCATAGCAAGGCTTTGAATTATTGGGTCAGGTCATTAT
AACCTTGAGTAAGTTCCGAGTCATGTGATAAATGATTGCTTAGCACCAGATGTTTGTTTT
CCTGATCTTGCTTCCTAAATATCAGGTGATTTTATTTATTTGGAGTTAGTTGTGTTTTTA
TATCAGCATTGCTGTTTCTCCTCACTTCTTCAGTCCCAGTGTGAAGCTTTCCTTGACAGC
AAGGATCATATATTCCATCATCTTGTTTACCTAAAATTTCAGGTCATTCCTGGTTGTTAA
ACTGTCTCCCCTTGTTCCCAGGCACCCCAGCCTGCCGTGCATGTGCAGGGCCAGGAACCT
CTGACTGCTTCTATGTTGGCTTCAGCACCCCCCCAGGAACAGAAACAGATGCTGGGTGAG
TGGACTATATATACTTCTAGGAGATGGAGCCAGATCTGAACTGGTGTCCACAAGGTTCTA
ACAGGAGTTTTTTCCACAGGTGAACGTTTGTTCCCTTTGATCCAAACCATGCACTCAAAC
CTGGCTGGGAAGATTACAGGAATGCTCTTGGAAATTGATAACTCAGAGCTGTTGCACATG
CTGGAGTCGCCAGAATCTCTCCGCTCCAAGGTGAGCTAGTCCTCATGCTCTTGGTTTTGG
CTTGCTCAGCTTTGGACACACAGGTGTGGCAGAGAAAGTTCTGCTGTGGTGTGGAGTCAT
AGACACCAGGCAGTGAGTGGGTGGAGACTAGGGAGACCTCTCCTCAGATGTCTGAAATTT
TCTTACAGGTAGATGAAGCTGTGGCTGTTCTACAGGCTCATCACGCTAAGAAGGAAGCTG
CCCAGAAGGCGGGTGCTGTTGCTGCTGCTACCTCTTAGACAAAGAGAACATGTACGTTTG
ACTAACTCAATTTACTTAATTTGGCAAGAGTTTCTCATGAAAGGTTCTGGCTTCCCTAAT
AACTTGGGCATGCTGTCACCTAGTTAATTATTTGGATAAGTAAATGCCATGAGTTCAGGG
TGTGAGTTAAAAGGAACAGCATTGTTCTGGCTAAAGAGGAAATCTTGGGAATCTTTTTCA
CTGTTCATCTGGCATGACTAATCAGATCCACAGACTTGCTTCAATAGACAGCACCTTTGG
GTCAGGAAAGAATAAGACAATTGAGTGAAAAGGCTTTGGGTCAGATTTTGGACTTGGGCA
GTGTTGAGTAGCTAGAAGGAAGCTTGGTGAATAATCTAGTACACAGGATAGCTTCAACAG
AAATAGCCTGCCTAAACAGTACAACTGATGGTGAAAAACCCTGCTTTGTAATACCTTTCA
TTGGTGAGAAATGAATGGCGGTGAACCTTGGAAGTTTTGTTTATGTATTTTGTGTTTATT
GTCTTTGCAGAATTCAAAAGCCAAATAACCCCTTGTGGAATTCAACTCAATGTTTGAAGA
CTTTCTGCTTGTCCTATGGACTTCTTCAGCAAGAACCACAGTTACAAATTTTGTCATTTT
GTATCAAAAGGTTAATTATGAAACGCCTAGGATTTTTCAATTAAAGAGATATATTCTCTG
AACCCAGAGAATCTATATATAACCCAGATAGTGTTAACTTTTTTCTATTGTGGGTTTTAA
TTCCCCCCCACCTCTGGAATTGGTTTTATTTGATGTAACTAAGACTTAAGTTTCTCAATA
AAGGAAAAAAAATCCATAAAAGTGCTTGTCTTGATGTTTTGTTCTTATATAGTGCAGATT
TCTATATACCCCAATTATGACTAAAAGTAAATTTAGAGCAAATGAAATTCCAGTGTAACT
ACTTGTAATATTTTCATTTTAGATATGGATTGAGAAGTTGGGGAGGGAGGAAATGGGAGA
GATGCCTGCGGTGCTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1192, 1194..1194, 4224..4417, 4984..5035, 5037..5097, 6245..6384, 6853..6947, 7143..7280, 8827..8922, 9784..10056, 10382..10393, 10395..10397, 10401..10409, 10412..10415, 10417..10451, 10454..10469, 10575..10586, 10588..10695, 11115..11201, 11295..11422, 11961..12054, 12139..12269, 12428..12517
1001..1192, 1194..1194, 4224..4417, 4984..5035, 5037..5097, 6245..6384, 6853..6947, 7143..7280, 8827..8922, 9784..10056, 10382..10393, 10395..10397, 10401..10409, 10412..10415, 10417..10451, 10454..10469, 10575..10586, 10588..10695, 11115..11201, 11295..11422, 11961..12054, 12139..12269, 12428..12514
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved