Erinaceus_europaeus Locus ENSEEUG00000004994
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ENSEEUG00000004994
Erinaceus_europaeus
ENSEEUG00000004994
scaffold_282536
SNORD73, SNORD73
2782..2854, 4354..4421
5938
TAGGGAAACCCTCAGACCAATCTGCTCTTCCTACAGAAACAAAACCTCTGGTGGTGGGA
AGCTGTGGAATTAAACATATTCTAGACGTTTTGTAGATCAATAATTAAATCACGAAATCT
TAATAAAGCTACCAGGGGGCGGGGGCAGATAGCACAATGGTTATGCAAAGAGACTCTCGT
GCCTCAGGCTCCAAAGTCCCGGTTCAATCCCTGCACCACAAACCAGAGCTGAGCAGTGCT
CTGGTAAAAAAAAAAAAAAGTAAATAAATAGAAAATATTTTTGTGGTCCGGGAGGTGATA
CAGTGGATAAAGCACTGGACTCTCAAGCATGAAGTCTTGAGTTCAATCCCCGGCAGCACA
TGTGTGATGTCTGATTCTCTCCTCCTATCTTTCTCATTAATAAATAATAAATAAAATCTT
TTTTTAAAAAAGCTACCAGAAAGCCTTTTGGCGAGCGCTGTCGCCGGGGCCGCCTCACCC
TCCCCAGCGGGGCCAGGACACTGCGGGAGGCAGCGTCTAAACCCGCACCTGCTGTGCGAC
TTCAGGAGACAAGATGGCAAGCGCGGCGGAGTGGGCGGCTCCACTCCCGGAACAAACTTC
CTGCGACCGAAGAGCCACCGGAAGTCAGAGGTCAGTACCTCCGCTGCCCGATTCTGTGGT
GAAGCGATCCCGGCATGCCACACGCCCTCCCCCCACCAGAGGTCGCTGTCACCGTGAGCG
TCGAAGGCGTGGCCTTCAGTTGTCGCGATATTCTTGCGACAGGAAGTGGGTCTGGCCGCA
AGTCACGTAGTCGGTGCGCCCCGCCCCACTCCATACGCCTAAGTTCTCGCGCGAGTTACA
CTTCCGCCCTTTTGGCTCTTTGAGCAGCACCATGGCGGTCGGCAAAAACAAGCGCCTTAC
GAAAGGTGGCAAAAAGGGAGCCAAGAAGAAAGTGTAAGTGCTAACTGTGGTTGCTTGTCG
CTTTAGGGGGCCTCCTGGAGTCGGCTGGCGGGTTTTGGATGGTGGAGTAAGCCGGATGGT
TAGGATGTCAGGCAGATTGCGAGGGCCGTGACTGGCGGGTCCGGAGTTATGCCGCCGCGC
GCCTGCTGCCTGTCCACGGGTTGCAGCTACCAGGCGGCGTGTGTGTGCCCAGTGTTGTGC
GCTGACGATCCCTGTAAAGTCGTTGCAGCGCCCAGAGGTGGAAGAAGCCCCTTTGCACTC
CAGGCTCCTGCTCCCTCCGTGCTGGGCGGGTAGAACCTGGGAGTTAGAGCCCCTCACTAA
CCGGGTCGGCTGGGCTGGGATGATGTTTCAGGCAGACATGCTCGTTAGCCAGCGATACTG
GGGTAATCGAAGGACCCGACGTGGGTGAGGGTTCGTTGGGTGTGACTGCAGCATGATGTC
AGATGTGGTACGTGGGGAATTTAGCACCCGGATGAGCCAAGTTGATGCTTTTTAATTTCT
AGGGTTGATCCATTTTCGAAGAAGGACTGGTACGATGTGAAAGCGCCAGCAATGTTCAAC
ATAAGGAATATTGGGAAGACACTAGTCACAAGAACTCAAGGAACCAGTGAGTACCTTGTC
TCTGCTCTCTATGGCCCTTGAGATTTTTCTCGGTCTGCTACTTCGTCCCTTTCTGGGAGA
CTTCAAGGAAGTATTGCTGGTTGCACTGTCTGAACGCCTGTGGTGCATGTTTGCTGCAAG
ACTTGTGAAAAAGCAAGGTGTGTCACTTTACTGTCAAGAAAACGTGCATGTGTGTCTCGG
TTTCTAATGGACACTTGTCAGGGAGTTATTGGGCCCAAGTGCATTTGGTTACAAATGTGT
TTTTTTTTTTTTTAATCACTATGAATGGAGGTTAACTTTTAGACTTGGCTTTATGTGACT
CCTTACGTTAATCAGACACTTGGTCTTTATTTCCTAGAGATCGCATCTGATGGCCTGAAG
GGTCGTGTGTTTGAAGTGAGCCTTGCTGATCTGCAGAATGATGAAGTCGCATTTAGAAAA
TTCAAGCTCATTACTGAGGATGATCAAGGCAAAAACTGCCTGACTAACTTCCATGGCATG
GACCTCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCACCCGCGA
TAAAATGTGCTCCATGGTCAAAAATGCAGTGGGTGAGAAATCATTTTCCTCAGTGTGCGT
GGTTGGGATATCCAACCCATGGGCGCCATGAGGGAGCCCATCGAGTGCTGTGGGGAGGGG
ACGCTTGCCTGCAGGCGCTAGTTTCTGGTTGAGGAATGTCTAGGTGGGTACCCAGGCTGT
TTGCCTGCATCCCCAGATCTTGGGAATCTGAATAGTTTTGATCACCTCTTGACAGCAGAG
TAGGAGTTGTGACGTCTGTTTGGTTGAAATCTTGGTTCTACAACTTTGGGAAATAACTTT
TAAGTTTTGGCTTCTTTATCTGTAAATATAAGTTAAAAAAACCTCAACTTGTTGGAATTA
TAGGGATGAAATAGGTACATGTAAACAGGACTTTGCAAATACTGATAATTCTTAGAGGGG
ATGGTTAGAATTAAGAGGTTTCAGAGGTGGGTTCCCCCCAATAGTCTATGGTTGGTTGGT
TTTTGTAGTGGGAATGAATGATGACAAAATGTTTCGGTCCCATATGATTGACACTGATTA
TACCGTTACATTAATTTCTGACATTCCCTTTAGGTCTTAACAGTTTATTTCTGGTTCTAT
CTTGAGGTCTGATTGCTGTTTATAAAGTATAAAATTTGTAAAGCAAAAAGCCATTAAATT
TTTGGTACTAGTTACAGCTTTTGATATTTGGGCTGGAATGTGATTAATGATAACATTTCT
TAGGCTGGAGGGGATAGCATAGTGATTATGCTATCCTCCCAGCCTTCAAAACTGATTCTC
AATCCTTTGCATGTCTTTTGCTTGACATATGAGACTTTTAAATAATGTTCATTTAGCTTT
ACTCTCCAGCACCTCACTTTTGAGGGAATTTTTTTTTTTTTTTTCGTGAATAGGGAATGC
CAAAACACATACGAGTGAGTCCTTTTTCTAAGACAGTGGGACAACTTATTTGCAGAACAC
TTGATAAATGGACAAAGAGTTAATGTCCATGTTGTAGAATCTCAATTTTTCTTGCCTGAG
GGATGGGCTATTAGAGGCTATTTACTATAAAAGATGGGGTGGGTATGTCAGTGTTTGTGG
AGATAAAAGGTAGTTTAAATATGACATACTAACAATGGGGTAACTCAGCAAAGTCACTTT
CAAAACAGTTAAAATTCTGGGCTGGGAGACAATGATTATGCAAAATGACTTAATGCCTAG
GCCAAGTTCAATCCTATAAGCAGCTTCAGAAGTGAGCAGTTTTTTTAAAAAAGTAATTCT
GTAGATTAGTTTTTTCCTTGTTTCTGTCCCCTACTCCCCCAGATAGAAGGGAGATGACAC
AACATTGCTTCACTGCTTATGAAGCTTCACCTTTGCACGGTGCTCCCATGGGATGGCCCA
GGGATCAAACCTGGGTCTTTGTCCATGGTAATGATACTCTTTTTCAAAAATTTTTTACTT
ATTCCCTTTCGTTGTCCTTTATTGATGTCATCATCTTTGGATAGGACAGAGAGAAATGGA
CAGAGGAAAGGAAGACAGAGGGGGAGAGATAGACATCTGCAGACCTGCTTCACAGCCTGT
GAAGCAACTTCCCTGCAGGTGGGGAGCCCGGGGTTCGAACTGGGATCCTTCTGTGGGTCC
GTGTGCTTAACCTGCTGCGCTACCACCTGACTCCTGGTAATGATATTCTTCTGGGTGAAC
TCTCTTCTACCTCCAGATTACTTTATATTTTACAAATACTGTTATTATAAAGCTGGTGTA
TCTGACAGTACCTTCCCCTCCCCCCCCCAAAGACCATGATTGAAGCTCATGTTGATGTAA
AGACTACCGATGGCTATTTGCTTCGTCTATTCTGTGTGGGGTTTACTAAAAAACGCAACA
ACCAGATTCGAAAAACCTCTTATGCTCAACACCAACAAGTTCGACAGATTCGGAAAAAGA
TGATGGAAATCATGACCCGAGAGGTGCAGACAAATGACTTAAAAGAGGTGGTCAATAAGT
TGTAAGTATTTCTCTCCCTCGTAAAAGAAATTCCAAGAACCATGGTGATCTAAGTTAAGG
GAAAGCATGAGAACACTGTATGGGGATAAATGATGACAACATGTTTCGGTCCCAAATGAT
GTCCAGTGATATAACTACATTTTTCTGATGTTCCCATACAGTTAAGATTGTGTAATAGAA
AAAACTTAATGGGCCTGAGAGCCTTGCCATGCCATGACTGTGATCAGGGTTTGATCCCTG
GAAGGAACCATACGGGGAGCTCCTGTGCTATGGTGTGTGTGTGTTTCCTAAGTAAAAAAA
AAAAAAAAAAAAGCCTACAATGTAAATTGTGCATGTTTGTTGAGTCTTTGCTCAGTCGTG
CATGGGGGAACAATAATTATTTCTCTGTGTTTATTCTAATTTATTATTGGCTTGCAGGAT
TCCCGATAGCATTGGGAAAGACATAGAAAAAGCTTGCCAGTCTATTTACCCACTTCATGA
TGTCTTTGTTAGAAAAGTGAAAATGCTGAAGAAGCCCAAGTTTGAATGTAAGTGAGAAAT
CAGGGAAAAAATGATCACAAATATTTTTTGAAGTCACACAGATGGCCTTTTTTTTTTTTT
TTTAAGTTTTAGAGTTATGTTTCAAGTTAATGGTATTATCTAACAGAACCCCCTCCCATT
TTTTTTTTTTTTTTTAGTGGGAAAACTCATGGAGCTTCATGGAGAAGGTGGTAGTTCTGG
GAAAACTACTGGAGATGAGACTGGTGCTAAAGTTGAGCGGGCCGATGGATATGAACCACC
AGTCCAAGAATCTGTCTAAACTCAGACTTTTAATGACAAATAAAAAGTTTTATTTGTGAT
GTTTTATTTATGATGGGTTTTGTTTTTTAATCTCAGCTGGTGAGTAAAATGTTCTGACTT
AACTAGTGTGAGCTTTTCTTATGGTTACTAAAGTAGTTGAGAAAATGATCTGGGTCGTCA
AAGAGGTGCCAGAATGGCTAAAGCATTGGACTCAAGGTCATCACCAGTGATGTCTGCTTC
TTTCTCTCCGCCTATCATTCTTGATGAATAAATCTAAAATTGCCTCAGGTAGCAAAGTCT
TAAAAGTGATATGGAAGGGATTTGTAAAAGGAAGTGCTTTTCTCAGAATAGTTGAGCACT
TCAGGTGGTTCTTAAGTCACCTGATAGACTTGTTAACATTGCCCTTAAATTTCTGATTCA
GGAGTTTGGTTTTTTTTACCAGAGCACTGCTCTGCTCTGGCTTATGGGCACTATGCTTTG
CCACTTTGAACCATGTGCCTTATTTCTTACTGTAATTAACTTGTCTTTGAATAAGTAAGG
GGAGTGGGTTAAGCGCAGGTGGTGCAAAGCTCAAGGAGCCTGGTTGGAGTGCTCCCCACC
TGCAGGGGAGTTGCTTCACAAGCAGTGAAGCGGGTGTCTTTCTCCCTCCTCTCTCCATTT
CTCTTTCCTATCTAACAACTACAGCAATAAAAACAAGGGCAACAAAAGGGAATAAATACT
AAAAGAAAAATAAGGTTTCTTCTGGAAGGTATACCAGGCTACTTTGCAGTTTATCCCAGA
CCTTGTGTTGGGAACCCAGGGCTTTAAGTCTTTGAACATGTCTTCAGAGGGTGGGGGTAG
AGACAACATAATGGTTATACAAAGCCTGAGGCTTCAAAGTCCCAGGTTCAATCCCCCAGA
CCATGATAAGCCAAAGTTGAGCAGTGTTGGAGTAAAAAATGATTAAAAAAAAAAAATGGT
AGGGAGGGGCATGTTACAATGTGCAAGGACCTAGGTTCAAGCCCTTCCCTGGTCCCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 1572..1675, 2027..2178, 2285..2313, 2315..2321, 4062..4270, 4687..4796, 4947..5068
1001..1062, 1572..1675, 2027..2178, 2285..2313, 2315..2321, 4062..4270, 4687..4796, 4947..5065
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved