Erinaceus_europaeus Locus BZW1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus BZW1
Erinaceus_europaeus
BZW1
scaffold_233155
SNORA42
11935..12070
14043
GTGATTAAAAGCCATAGAAAGTGTTGGAGGCATTTATTTAAAGAGTCAAGAGCTTTAGC
TTTTTGACAAAATTCCACCAAGGAATAAAATTTACCTGAGATTTAGAAAATACTAAATTT
CGGGAGTCCGTGGTAGTGCAGCAGGTTAAGCACACGTGGCACAAAGCACAAGGACCAGCA
TAAGGATCAAGGTTCGAGCCCCCAGCTCCCCATCTACAGGGAAGTTGCTTTACAGGAGGT
GAAGCAGATCTGCAGGTGTCTGTCTTTCTCTCCCCCCTCTGTCTTCCCCTCCTCTCTCCA
TTTCTCTCTGTCCTATCTAACAACAACAACATCAGTAACTACAACAATAAAACAAGGGCA
ACAAAAGAAAAAAATATTAAAGAAAATACACTCAGGCAGAAGTTGAAAAATAAGATCAGA
AATGAAAACACAAGTAGAACCTGAAATGGAATTGGCATATTGCACCAAAGTAAAAGACTC
TGGGGTGGGTGGGTGGGGAGAATCTACAGGTCCATGAAGGATGGTAGATGACATAGTGGG
GGTTGTATTGTTAAATGGGAAACTGGGGAATGTTGTGCATGCACAAACTATTGTATTTAC
TGTTGAATGTAAAACATTAATTCCCCAATAAAAAAATAAATTAAAAAGAAAATACTAAAT
TTCATAAAAGCCCTGAGGTGGTGGAAGAGCATTCTGGGTAGAGATTGTCTCCTGGAAATA
GTAATACACTGTTTCAGTAATGAGACTTAGGCCTGAAATTATCTGGGAGAAAAGCCACAA
GGTTTCTGTGATTAGGAGTCCTGCCTTGGACTTACACAGACATTTGGAAAAAGAGGTATA
TTTAGTCCCCTACCATGTTTGCTTATGTTGCAGGTCTTGGTGATCTGGTGTTTTGTTTTT
TCATCTGATAAAATTGTGATTAACTAACTGAAATTACAGTTACAGTGTCTTTTTGGTAAA
TCTTTTAAAACAAGGTGTTTTGGCTTGTTTTCCCCCCAGATGAAAAAGAGAGGTTTGACC
CTACTCAGTTTCAAGACTGCATTATTCAAGGCTTAACTGAAACTGGTACTGATTTGGAAG
CAGTAGCAAAGTTTCTTGATGCTTCTGGAGCAAAACTTGATTACCGCCGATATGCAGAAA
CACTCTTTGACATTCTGGTGGCTGGTGGAATGCTGGGTACGTGTATGGGCTTATGAGTGG
GGGGTATGTGGAGATCATATGGAATAGAAATAAAAGCCAGCATACTGGTTATCAAAGACT
CATGCCTGAGGCTCCAAAGTCCCAAGTTCAATCCACCACACCACCATAAGCCAGAGCTGA
GCCATGCTCTGGTTTAAAAAAGAGAACATGAATTAAACATCAAATTGGGTTGACTTTGGG
TTCTTTCACATAATGTGATGTATAGCAATTATGTGGAATACAGAATATGAACTGTGTAGT
GAACTTACAAATTGAAGGCAGTCAGGCTGTGGTGCTCCTGGTTGAGCAGATGTGTTATAG
CACACAAAGACCCAGGTTCAAGTTCCCAGTCCCCACCTGCAGGGGGAAAGTTGTTTTGAG
TGGAGACAGGCTAAAGGTAATTTAAAAAAAAAATTTTTTTTTTATGGGGCAGATGTGTGC
ACCTGTGGAACACATTAATGCCTCAGTACATTAGGGAACCAGGTTAATCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTGCAGGTGTCTCTGTCTCTCTCACTGTC
TCTTTTATTTTTTATTAACTTTATTTGGATAGAGACAGCCAGAAATCAGGAGGGAAGGGG
GTGATAAGGAGAGAGACACCTACAGCCATGTTTCACCACTAGCAAAACTTTTACCCTGCG
GGGGGGGCTGGGGGGGGCTCGAACCTGGGTCTTCACACACATTAACACACAAACGTGTTA
AACCAGGTGCACCACCACCTGGCCCCTGTCTCCCTGCCTCCCCATACCCTCTATTTCTGT
CTCTACCCAACTTATTTAAATTTTTTTTTTTTTAAATAAAGTTGAAGTGACTTTATAAAG
GGACGACAAAGCGCTTGTCTTTTTGCTTTAGACCCCCCCACCTGTGTTTGAATGTTCCCA
GTTGGAATTTTGTTTGTTTACCTCCAGAGTTATCCTTGGGGTTCAGTGCCTGTACTACTA
ATCCACTGCTCCTAGAGCCAGTTTTTTCCCTTTTTGTTGCCCTTGTTATTGTCAGTGATG
TGGTGGTTGTTGGATAGGACAGAGAACTGGGGAGAGAAAGATAGACACCTGCAGACCTGC
TTCACTGCTTGTGAAGCTACCCCCTCTGCATGTGAGGAGCCAGAGGCTCGAACCGGGATC
CTTACACCTGTCCTTGTGCTTTGCGCCATGTGTGCTTTACCTGCTGCACTATTGCCCAGC
CCCCTAGTTGGAGTTTTTTAAATAGAGAAAGAGAAGTACTATAAAAATGAGCCACTGCTT
AGCAGCTCCTCCCCCCACATGAGGGGACCAGGGGCTTGAAGCTGGGTCCTCACACTGGGT
GACCCACACCACCACCATCCCTCCCACCCCCAGGCTTCTCAGTTCTCTCTCTGCCCCCAA
AGCTCTACCTCCTTGTCTGTCGGGGGATACACTTGGTGCCTGAGGACTCCTGCACTCTTC
AGTGTATTAGCCAATAGCTCCATCCATCACTTGGAACTTGGCTGTTATAAACTACGGTGC
AGGGGCTGGGCAACAGCACGCCTGGTTGACTGCTTGTGTTACCATGTGCAAGGATCCAGG
TTCGAGACCCGTCTCCCCATCTGCTGGGTTGGGGGAAAGCTTCACAAGCAGGAGGACCAG
GTGGTGGCGCACCTCGTTGAGTGCACATGTGACAGTGCGCAAGGATCCGGGATCGAGCCC
CCCAGTCCCCACCTGCAGGAGGAAAGCTTTGTGAGTGGTAAAGCAATGTTGCAGGTGTCT
CTGTCTCTCCCTGTCACCCCGTTCCTTCCCTTTAGATTTCTGGCTGTCTATCCAATAAAT
AAAATTAAGATAGTTTTTTTTTTTTACAGTGAAGCAGGTCTGCAGATGACTTTCTTTGAC
CTTCACAGCTAAACTGATGCAATCAAAATTCTGTTTGTAAGCATACAGGTGGAGGCGTTA
GTGATTTACATGCAAAAGCAGTGCTCAGTGGCAGGATTTTACATTCGTGGTTAATGTGAG
AACCAGAGCACTGTGCTGGCATTGTGATGCCAGGGATATTCTCATAAAGAAAATTGAGTC
ACTTAGTAAGGAACTGTTGACATTTCTACTGAAAAGTTGACTTAAGACAGTTTTTTGCAG
ATACTGAGGTTGGAATGGTTGCTGGTTTTAATGGCAAACTTTTCTTTAATGAAATATACC
TTAGCCCCAGGTGGTACACTGGCAGATGACATGATGCGCACAGATGTCTGTGTGTTCGCA
GCACAAGAAGACTTGGAGACCATGCAGGCATTTGCTCAGGTAATAAGAGTTTATTTATTT
GATTTGAACTAGCTACTCAAATAAATCTCTAACATATCTAAAGAACAGTTTACTTTTAAA
AGATTGCAGGAGAGGGAGTTGGGCGGTGGCACAGCAGGTTAAGTGCACGTGGCACAAAGC
ACAAGGACCAGAGTAAGGATCCCAGTTTGAGCCCCTGGCCCCCCACCTGCAGGGGAGTCT
CTTCACAGGCTGCAGGAGAAATATTCATAAGCAGTGAAGCAGGTCTGCAGGTGTCTATCC
CTCTGTATTTCTGCCTCCCCTCTCAATTTCACTATCCTATGAAACAAAAGAAATAGTTCT
TACAGGGATACTGTTCTTTTTGCTGCTGCTGGAACCTCCCTACAGCAGGCTGGCTTTCAG
ATAACAGCACAGAGAGCGATAGATAGTACTGACACTTCTGCCAATGCAGTGGGGGCTGCA
GCACTTAAGCCTGGGTGCAGTTAGCAAAAGAGGCACACTAGCCAAGCGGGCTGTTTTGCT
GTCCCAGTACTGTCTCACCAAGAGCTAGAAAACTTCACTGGGCGTTGAAGAAAAGCCCAA
AGTTAATTTTTCCCTTCTGAATTGATTTAAGAAAATCATTAAGCTGGAGAATGTGGAACC
TGGTTTCCTATAGTGATCCCTACCATTGAATGTGGCTTTTCCCATGCACATAGCTTTTTC
ATGTAGTTGTTGTTTGTTTGTTCTGTCATGAGAGGCCAGACCGCTGCTCCCTCATGTGGG
ACCCAACATGCAGGTTCTGTGTTGTCACACTCTGCTGCTTGAGTGGGCTACTTGATTTGA
CAATAAGCCAATTACAGCATGGCTGGTAGTGACCTCAGCCTGGTGTGTCAGTAGAGTTTG
GGAGTTTGTAGATTCTTCTCAAGATGGTTATACAATTTATAAAACAGGTGTATCCAGCCA
AAGAAGTTTTGCTGTTACAAGATTCTGGGAAGCTCAGTGGCCCTGACCTACACCTATTAG
GAACCTGATGTTGATGTATATAAAGTTGTCATTATAGGGGCCGGGTGGTGGTGCATCTGG
TTGAGCACATGTGTTACAGTGTGCAAGGACCAAGGTTCAAGCCACCCCCCATCCCCATCT
GCAGGGGAAAGCTTTACAAGTTGTGAGGCAAGGCTGCAGGTGTTTCTCTTTCTCTCCCTC
TCTCTATCCCCTTCATTCTCAATTTCTAGCTATTCAGTAAAGATAATTTAAAAAAAAAAA
TTTAAGGGGTTATATTCCTTCATTGTTTTTCATAGGTTTTTAACAAGTTAATCAGGCGCT
ACAAGTACTTGGAGAAAGGTTTTGAAGATGAAGTGAAAAAGGTATGAGGGGCAATGTGTT
AAATTGTGAACTGGGGTCCATGCTCCCAGAGGGATAGAGAATGGGAAAGCTATCGGGGGA
GGGGTGGGATATGGAGATTGGGCAGTGGGAATTGTGTGGAGTTGTACCCCTCCTACCCTA
TGGTTTTGTTAATCCTTTCTTAAATAAAAAAAATAAATAAAAATTGTGAACTGAAGTAGG
GGGTTGTTAAACTGCCACAGGTTAAAGATGATTGTAGGTGTGTGGCTGTCTGACATGTGA
TTTGGGGTATAGCATTTGAGTTTATTTGCATAGTGTCTCTTTGTCCAAACACAAGTGTGG
TATGTTCCCCAAACAGAAGATAGAGAATCAAAATTAAATTAAAACACTGAGAAAGAAAAA
TTGAGTGTACTTGCTGTTAAATGTCAGTCTATTTTTTGTGATGAGAACTAGAGTGATTAT
CTTTGGGAGGGTGGGAACACTGGGCTTTGGGTATGGTGTGGAACTAACTATACATTGTAA
TTTTACAATCTAAGAATTTAAAATGTTAGTCTTTGAAATTTTATGTTTATACACAGAAAA
TAATGGTGGCGTTAGTGTTAACGTTTATGAAATACCAGACACTGTTCTGGTATCTTAACT
ATTTAAAAATTCACATGAATTAAGTTTTCATTTTCCAGTGAGGAAGCAGCACAAGAGTCA
CTTGCACAGGATCACTCAACAGGAGTTAAAACTGAAACAGGCTAGGGTGTTCTGGGCTCC
GGGTCCTGTAGCTTTTAGCTGGTATGCTTTACTGTTTCTCTTATATAATGCAACTGCTCA
TTTAACCCGGAACTATTTACTTTTGTAGTTGCTCCTGTTCTTGAAGGGGTTTTCAGAGTC
CGAGAGGAACAAGTTGGCTATGTTGACTGGTGTTCTTCTAGCTAATGGGACACTCAACGC
ATCCATTCTCAATAGCCTTTATAATGAGAATTTGGTTAAAGAAGGTAATTTTAGTTGACT
GCAGGTGGAATTGATTACATCATGAAACATAGGGTTAATATGAAAGGATATATATGGCCT
GTTTGTGTGTGACTTGTACTTTAGTCTTGGGTTCTTGATTACTAATTTACTAGGTTTGTT
CAAATTCATTAGACTTACGCATCCGGGACTTTGTTTTGTCATACCTATCCAGGGGCTAGA
CAACATCTTACCTTGAATAAGAGAAACACCATGGAAATAAAAAGTTTATTCCAATTCCAA
TTAATGAATTTTTAAAAAGATTATTTGCAATGACCTAGGTAACCTAGTACCCAATAGAGA
CATTGGGGAAGAGGTGCGCCTGCTTGAGCATGTTAAACACATGTTACAATGCACAGGGAC
CCAGCTTCAAGCCCCTGGTCCCCACCTGCAGGGGGAAAGCTTTACGGTTGGTGAAGCTAG
ACTGCAGGTGTCTCTCTTCCTTTTTATCTTTATTTTGTTTCATAGAAACAGCCAGAAATC
AGGTGGGAAGGGTTGATAGAGGGGCAGAGAGATACCTGCAGCACTACTTCACTTGCAAAG
CTTTCCCCCTTTAGGTGGGGTCTGGGGACTTGAACCAGCTGCACCACCACCTGGTTCCCA
GTCTCTTCCTTTCCTTTTTTTTTTTTTTTTCTTCCTTCTCCAGGGTTATTGCTGGGCTTG
GTGCCTGCACCATGAATCCACCGCTCCTGGAGGCCATTTTCCCCCCTTTGTTGCCCTTGT
TGTAGCCTCGTTGTGGTTATTATCATTACCATTGTTGATGTTGTTGGATAGGACAGAGAA
ATGGAGAGAGGGAGAGAAAGATAGATACCTGCAGACCTGCTTCACCGCCTGTGAAGTGAC
TCCCCTGCAGGTGGGGAGCCGGAGGCTTGAACCAGGATCCTTATGCCGGTCCTTGTGCTT
TGCACCACATGCGCTTAACCCACTGCGCCACTGCCCGACCCCCGAGTCTCTTCCTTTCTA
TCACCCTTTCCCTTTCAATTTCTGGCTGGTGCTATCCAATAGATATAGTATAAAGAATGA
TAATGAGCCAGGCAGTAGCACAGCGGGTTAAGCTCAGGTGATGCAACGCACATGGATGGG
CATAAGGATCCCAGTTCGCTGAGCAAGCGGTGAAGTAGGTCTGCAGGTGTCTATCTCTTC
TCCATTTTTATCTGTCGTATCCAACAACAGCATCAATAACAATAATAATAACTACAACAA
TAAAAATAAGAGCATCAAAAGGGAATAAATACTTTTTAAAAATATTTTATTCATTTTTTA
ATATTTATTTTATTTTTTTATTCCCTTTTGTTGCCCTTGTTGTTTTATTGTTGTAGTTAT
TATTGTTCTTGTCCTTGTTGGATAGGACAGAGAGAAATGGAGAGAGAAGGGGAAGACAGA
GGAAGAGAGAAAGATAGACACCTGCAGACCTGCTTCACCGCCTGTGAAGCGACTCCCCTG
GAGGTGGGGAGCCAGGGTTCGAACCGGGATCCTTATGCCGGTCCTTGTGCTTTGCACCAC
CTGCGCTTAACCCGCTGCGCTACAGCCCGACTCCCATAAATACTTTTTTAATAAAAANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAATGAATAAATATTTAAAAA
AAAAAAACTAAAGAGATGGGAGTCGGGCAGTAGCGCAGCAGGTTAAGCACAGGTGGCATA
AAGCGCAAGGACTGGTGTAAGGATCCCGGTTTGAGCTCCCAGCTCCCCACCTGCTGGGAA
GTCAATTCACAAGTGGTGAAGCAGATCTGCAGGTGTCTTACCTTTCTCTCTCCCTCTCTT
CTTTCTCCATTTCTGTCTGTCCTATCTAACAACAACATCAATAACAACAATAACTTAAAC
AACAATTTAAAAAAAGGGGCAGCAAAAGGGAAAATAAATTTTAAAATAACTAGAGATTGG
AGTAAGAGAGTAAGCAGTAAGAGAGGAGAGTTTGGGGATGGATTTGGAGGTTAAAGTGGC
TGAATTCCCAGAAGGTTCTTTACCTTATGTTATTCTACAGGGGTTTCAGCAGCTTTTGCT
GTGAAGCTCTTTAAATCATGGATAAATGAGAAAGATATCAATGCAGTAGCTGCGAGTCTT
CGAAAAGTCAGCATGGATAACAGACTGATGGTTTGTAGATGTTCTCATTCTTTTGTTTAA
AGCAAGTGTAATTTAAGAGAACTTTTCTCATCTTTGATGAGTGAAAAGGGTATTTTTCTA
AATCTACATCTTAATCTAATCAAATTAAATTCTCCTTTCAGGAACTTTTTCCTGCCAATA
AACAAAGCGTTGAGCACTTCACTAAGTATTTCACTGAGGCTGGTTTAAAAGAACTCTCAG
AATATGTTCGAAATCAGCAAACCATAGGAGCCCGGAAGGAACTTCAAAAAGAACTTCAAG
AACAGATGTCCCGTGGTGATCCATTTAAGGATGTAAGATATACTTTTTTTTTTAACTATT
TGTTTGAGAGAGTACCAGAGTACCTTTAGTCAGTGCAGCACCTCCTAGGTAACATGGCTA
AAAGATTTTATTTATTTATTAATGAGAAAGATAGATAGAAGAAGAGCGAGGGGTCAGGTG
GTAGCGCGGCGGGTTAAGCTCAGGAGGCGCAAAGTGTGGGGATTGACAGAAAGATCCTGG
TTCAAGCCCCTGGCTCCCTACTTGCAGGGGAGTCGCTTCACAGGTGGTGAAGCAGGTCTG
CAGGTGTCTTTCTTTCTCTCCCCCTGTCTCCCCTCTCTCCATTTCTCTCTGTCCTATCCA
ATAATAACCACATCAACAACGATAATAACCACAACAATGGTAAAACAACCAGGGTAACAA
AAGGGAAAAAATGGCCTCCAGGAGCAGTGGATCTGTGGTGCAGGCACTGAGCCCCAGCAA
TAACCCTGAAGGCAAAAAAAAAAAAAAAAAAAAAAAACAAGAAAGAACCAGACATCACTC
TGGTACATGTGCTGCTGGGGATTGAACTCAGGACCTCATGCTTGAGAGTCCGATGCTTTA
TCCACTGCACCACCTCCGGGACCACAGATAAAGAAAATTTAAATACTATGTTAATGCTGA
GACTTTCACACTCAGTGCCTTACTGATGCCCAGAAATTATCTAACATGTTCATAACATAG
AAGCTAATAGTCCTTTTCTCATTGGTCTTCCTAAAACTAGAGACTATCCTCTCCGTCCCT
TTTTTTCTTTTTAAGATTTAGAAGGAATGGGCACAGAGCCTGAACATCACTCTAGCACCG
TGGGTCAAACTCAGGACCTTGCACTTGAGAGTTCAGTGCTTTCTGCACGCTGACACCTTC
CCGGCCACTCAGTTTTAAACATTCTGATTATATGTGGCACACATGTGACTGTTGAATTAC
ACAGAAAGATTTTTGTGCTTTTATAAAGGATCTAACCTTGATGTGTGGAGTGTGTGTGTG
TGTATAGAGTGACTTGTGGAGAGCCTGGCCTAGTAGAGTGCACGAGTTACCAAGTTTCAA
CCTCTGGTTCCAGGCAGAGCACCGTGCACAAAGGAAGCTACATAAGTGGCACTTCTCTCT
GACCTTGAAAGAAGGGGATTAATGACCAAATTATGGTAGAACAAAACTCCTGGGAAAAAA
CAAGTCATAGCACTGAAAGTGTTGCTGAGCTGTTTTCAGATTGATTTCATGAGTGGGAGA
GACCAGAGCACTGCTCGGCTCTGGCCTATGGTGGTGTGGGGATGCAAGACTGGTATGCTC
CTTATGACGTGTCACCCCAACTCCTAAACTTGCATTCTTTTGCAGATAATCTTGTATGTC
AAGGAGGAGATGAAGAAAAACAATATCCCAGAACCTGTTGTCATTGGAATAGTCTGGTCC
AGTGTAATGAGCACAGTCGAATGGAACAAAAAAGAGGAGCTTGTAGCAGAGCAAGCCATC
AAGCACTTGAAGGTAAGGTATGGCTGTGCCTTGAAGCAGCCTGCTATTGGGAACAGTCAG
AAGAATAAATGCATAATGCACAGTGATCAGGGTGGCTATCTATCCCTGTGTTGGGTATTT
GACCAAAGCTTCTTTTTTTTTTCCTTTAAAAGCAATACAGCCCTCTACTTGCTGCCTTTA
CTACTCAAGGTCAGTCTGAGCTGACTCTGTTGTTGAAGATTCAGGAGTATTGCTATGACA
ACATCCATTTCATGAAGGCCTTCCAGAAAATAGTGGTGCTTTTTTATAAAGGTAATTTTA
TTATTTTCATTTGGCGAGTGCACTTAAACTAAAAATAATTTCAGTGAGTAGTTGTCTGAA
CATCGGCCCCCTAAAATATTTTGCTGTAGTTGCAAATATCAGACAATTGTAAGTTAAAAA
TCAAAGTCCTGGGAGTGGGGCAGTAGCTCGGTGGGTTGAGCACATGTGGTGCGAAGTGCA
AAGACCAGAGTAAGGATCCGGGTTCTAGCCCCCAGCTCCCCACCTGCAGGGGAGTCACTT
CACAGGCAATGAAGCAGGTTTGCAGGTGTCTTAACTTTCTCTCCTGTCATCTCCACCTCT
TTCCATTTCTGTCTGTCCTGTCTAACAACGACGACATCAGTAACAATAATGACTACAACA
ACAAAAAAATCAAAATCCTTGGTGCAAAGCCAAGGACCAGCGTAAGGATCCCGGTTCAAG
CCCCCGGCTCCCCACTTGCGGCAGGGGAGTTGCTTCTCAACTGGTAAAGCAGGTCTGCGG
GTGTCTGTCTTTCTCTCCCCCTCTCTGTCTTCCCCTCCCCTCTCCATTTCTCTCTGTCCT
ATCCAACAACGATAATAATAACCACAACAGTGATAAAACAATCAGGCTAACAAAAGGGGG
AAAATGGCCTCCAGGAACAGTGGATTTGTGGTGGTGCAGGCACTGAGCCCCGGCAATAAC
CCTGGAGGCAAAAAAAAAAACTAGTCTAAAACTAGTCTAATTAACGTAAGGTCTCTTGAG
AGGGAGACCATTGTGGTATTTGTTTAAGTAATTTATTTTTTGCACCAGGGTTATTGTTGG
GGCTTGGTGCCTGCGCTACAAATCCACTGCCCCTAGAGGCCATTTTTTCCATTTTTGTTG
CCCTTGTTTTCCATTTTTGTTGTCCTTGTTTTCCATTTTTGTTGCCCTAGCTGTTGTTGT
ATAGGACAGAGAAAGACACCTGCAGACCTGCTTCACTGCTTGTGAAGCAACCCCCCTGCA
GGTGGGGAGCTGGGGGCTTGAACCAGGATCCTTATGTCAGTCCTTGGACTTTGCACCATG
TGGGCTTAACCCACTGCGCTACCACTCGGCCCCCTATTTTATTTTTATATATTGGATTAA
TAATTGGGGTTTACAGTTGACAGTAAAATACAATAGTTTGTACTTGTGTAACATTTCTCG
GTTTTCCACATAATAATTCAACCCTCACTAGGTCTTTTGCCATCATGTTTCAGGACCTGA
ACGCTCCCCACACACACAAACACACCCACCTGCCCCCAGAGTCTTTTACTTTGGTGTGCA
GTACACCAACTCCAGTCCAAGGTGGTATTTATTTTTATGGTTGGTGAAAAAACACTTGAA
ATTCTGTATTAAGTCATACTAGTAAAAATTTATGCACGTATATTACTTCTGTCAGCTAGT
TTTCATAAATGATTTTTTTTTTTTTGGTGACTATTTTAAACTTAAAACAAAGGGCTTTCC
CCTCTCCAGTTTATTTATTCTCTCATTTTTATTTAAAGACTAGGGTAATGAGGCCAGGCA
GTGGTGTACCTAGTTTACATGTTAGAGTTCACAGAGACCCAAGGTCAGCCCCTGCTCCCC
GCCTGTAGAGAGCAAGCAAGTTTCATGAGCAGTGGATCAGTGTTTCTGGTGTCTCTTCCA
CTGTCTGTCTCCTTTCCCTCTGTTTCTATCCTAAAATATGAATAAATAAAATATTTTTAA
ATAGGGTAATGAACCCTGTGCTGCTTCAGTGACAACTTGTGTTTAAGCTTCTCAAAAGTT
TTCATATAGTTAACACTGATTTTTTTTTTTAATAAGTATCCTTTTCACATCATAAAAATT
TATCAGTTTAGCAACTGTCTCACCATTCAACAAACATCCCTCAACCTGACTGTGAGCATG
GTGATGGATTTATGGCGGGTCCTTTTTTGTGGGCCTCTCATAGTGTGCCCATGCCAGAGT
GAACTGCGGCCTCGAACCATTGCCCAGCTCCCTCACAGTGAGCTGTGAGCACTGAGTGAG
GTCGTACAGTCAAAATTGAAAATTTTAAATATGTGCATAAAAAAATTGGAAAGGCTCAGT
AAATAAAGGCATTGTTCTGTTAACCTTCCAGTAGCATGTTTTGCCTTGCAAGCATTTACA
GTTTAGGTGGCTTCCAGCGCTGCCTGAGACTGCACCTCACATGAGGACTCCCTAACTGGT
GACCCCTCTCTCTAGCTGAAGTCCTGAGCGAAGAACCCATTCTGAAGTGGTATAAAGACG
CACATGTTGCAAAGGGGAAAAGCGTCTTCCTTGAACAAATGAAGAAGTTTGTAGAGTGGC
TCAAAAATGCTGAAGAAGGTGAGTCTCTTCATCTCTACAGCCTTGATACCGTTACGTGAT
GTGTTCACACAGACCGCCTTGCATTCTGATGCCTCCCCCTCCCCCTTTTACTAGATAGGA
CAGAGAGCATGAGAGAGAAAGACAGCTACAGCCCTGCTTCCCCATTTGTGAGGCTTTCCC
CCTGCAGATGGGGACCAGGGGCTTGAACCTGGTTCCTTAAGCACTGTGATGTGAGTGATG
TTTAACCAGGTGTACCACTGCCTGCCCTCCTATTTTATATGTTCAGTACAGGTTTTTGTT
CATTTGTTTTAAAAATATACTGATTTATTGAGGCAAGAGAGTGAACCAGAGCATCATCTG
GTACTTACACTTAGGCATTAAGCTTAAGGCCTAGTGCTTGAGAGTCCAGCATAAGTAAGC
TGTTATTAATATCTGGATTTTTTTTAACCAGAGCACTGTTTGACTCTGGCTTGGCGGGGG
GGGGGTGGGGGGTGGGGGGGGTCTTGAATCTGAGATGTTGGAGCCTCAGGCAGGAGAGTC
TACAGAACCATTACCCCTGCATTATAACAAATAGCTTCAGAGTTACTGATGAGGGTTCTG
CTTTCTGATAGATAACAGTGTAATGCCTGACTGCATTTTCCCCTTCTTCTAGAATCTGAG
TCTGAAGCTGAAGAAGGTGACTGAATTTTGAAACTACACCGGCAGTAAAGCAAACGGGAG
TTGTAGATAAAATGTCATGTCTCGTGTCCTGGTTCTTAACATCTTCCTACCTCCCTATAT
CTAGCATGATATAAGGGCTTTCATGGCAAATTTTATTTTAATTGTTTCTATGGTTACTGG
AAATGTTGGGTTTAGTTTCTAAGAACCATGTTTTAAGTAGCTGCAGGAGCTGTAGGTTTG
AGGCTAATGTCGCGTCAGTCTTTTCAGTCACCTCCGACCTCCTGTATTTTCTACTATGAC
GATGTACTTTAAGGCCTTCCACAATGAACAGTTCACTTTATCCCCTGGGTTTTCTATATA
AAGTTTTCAAAATATGATTTGGTTAAAAATAATTTGTTATACAAATTCTGTTTGCAAATT
AAAATGTACAAGTATCCAAAGTCTCAAAAGGCAATGATTTCTGTGTGATGATTCGGTATG
CCCAAAAATCCCCTCATCAGTGATAACAGTAGTTGAATTTGTTTAACCCAATTCTTCAAC
ATTTCGACCTTACTTGCAAATTAATATTTTCTTGCATTATTTTAACCCCATTATCTTCTG
ACCTCAGTTCTCTGGTTCTCATTTCTTAAAGCCATGGAGAGCAAGCTTGAAAACAAGGTC
TTAGTGGTGAACTCCTTTGTGACAGAGCTGGTAGGAAGAAGAAAGTTTTTCCCATTGACA
AACTTACTCAATTTTTATCTTTGCAGGCAAAATAAATATATCAATTCCTTTCATACAGCC
ATTATCAAAAAGTCTTACCATTGGAAGTATCTTATACTTGCCAGACATTTTGATAAAAGA
TTCAAAAGTAGTGAGTAAGATTAAATGGTTATTACCATGTTCTAATTGAAACTCTAAATG
TATTGTAGAGTGAAGTATGGTATAGTACATCCCTCCTTGGTCATAACAGAGCAGCTTCAT
TCTCTACATCTTCAGTGATGACTTGAGCATCAACATCAGGCTGTTAGCACACTAGCTGCC
ATAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1175, 3424..3518, 4775..4840, 5668..5803, 7900..8009, 8141..8311, 9645..9791, 9932..10070, 12255..12377, 13012..13043
1001..1175, 3424..3518, 4775..4840, 5668..5803, 7900..8009, 8141..8311, 9645..9791, 9932..10070, 12255..12377, 13012..13040
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved