Erinaceus_europaeus Locus ATXN2L
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ATXN2L
Erinaceus_europaeus
ATXN2L
scaffold_313960
SNORA66
5246..5370
11699
CATAAAGGTTACGCAAAAGACTTTCATGCCTGAGGCTCTAAGGTCCCAGGTACAGTTCC
CAGCACCACCATAAGCCAGAGCTGAGCAGTGCTCTGGTGTCTTTCTTTTGTTTAAAAATA
AATTTAAAAAATTTTTTAAAAGTTTCTAAATTCTCTGGCTCATTCTGAGAAGGGCATGCA
CACGAGCACGTGGGGGGGGGGCGGACAGACAGTCATTTCTTCTGACTTCGGGTGTTGGGA
AATGGGCCTTTTGCAGTTTGAACTAGCGGTGGACGCTGTGCACCGGAAGGCGCTTGAGCC
GGCGGCTGGCCCTCGTCGCGAAGACATTGTGGATACCATGGTGTTTAAGCCAAATGATGT
TTTGCTTGTCCACTTCCGAAATGTTGACTTCAATTATGCCACGAAAGGTATTGTGCCAAC
CTGGTGTTTGATTTGTGTGAGTAAAGATCGAAGAGCAATTAGTTATGTGATGGCTTGATC
CCCACCTTCAGCCTTTTTGAGAAGGTGACTGGATTTTTCTTTTTTAAGACTTTACTTATT
TATCCTTGAGAAAGAAAGGGAGAAAGAGTTAGACATCACTCTGGTACATGTGCTGCCAGG
GATTGAACTTAGGACCTTATGCTTGAGAGTCCAACGCTTTATCCACTGCACCATCTCCTG
GACCATTGGACTTCTCTTAAATAGATCATCATGTCTAAGATACAGTGGAGTGAATTCAAG
CCTGTTGTGGTCTTTGTGATTTGTTTGCTTCGTTTTCAGCTTATTCTTTTGTTAAACTGT
TGAAGGTGTGTGCTTTTTTTTTACGTTGCATCTCCCTCAAAGATGACATACACATGTACT
TACTCTGGTTCTGAGGCTGTGAGTAATGAGTAATGTGAGGTGCTGAAAGGCCACAGAGCG
TGGACTAGATTCCTGATCTTCCGCTCTGTCTCCGTAGACAAGTTCACTGATTCAGCCATT
GCCATGAACTCAAAGGTGAATGGCGAGCACAAAGAGAAGGTGCTTCAGCGCTGGGAAGGA
GGCGACAGTAACAGCGATGACTATGACCTGGAGTCTGACATGGTATGTGCAGTAGAGTCC
TTCTCCCCAGCACGAGTCTGCTCGGGTGCCAGCATTGAGTGACATCACTCTTGGAACTGA
GAGTTGCTTCTGGGGAGCAGGAAACTATTATCCCCTCCCCCAATTTTATATTTTATTAGC
GGCAGGGTTATCGCTGAGGTTTGGTGTCTGCACAGTGAATCCACCACCCTCAGTGGCCAT
CCACCCCCTCCCTTTTTCATTTAGTAGGACAGGAAAATTGAGGGGGCTAAGATAAGAGAC
ACTTGGAGCATTGCTCCCTGCATGTGGGGAGATCTGGGGCTGAGCCTGGGTCCTTGTGTG
TTCTATCGGGCCCCACCACCTGACCCTCCTATCGATTACTTGTTGATGGCAATAAAGTTT
CCCCAATGTAGGGTTGCAGAAAATAACCAATTACCTCTTAAGCCACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGACCCCCTGCAGGTGGGGAGCCGTGGGC
TGGAACCGAGATCCTCAGGCCGGCCCTTGAGCTTTGCGCCATGTGCACTTAACACACTGG
GCTACTGCCCGACCCCCTGAAAGTTTTTACGTAACCCATAGTCATTATGTTGTTTCCCCA
CCCTGCCTGTTTTTTTACTTTTAACTATTGTATGCTATTCTATTTTTCTACACACACATG
TGGCATACATAACAAAACGAGTCCCTTTCTTACTATCCGCTATTAAAAATAGTCTTGTAA
TGAATTTTGGAGCATGTATCTCCATGGACATGAGCCAGAATTTCTTTGGGATGTAAACCT
GAGATCACTTTTTAGATTCTAAGACTTGAACTTTGCCAGCTCAGGAGGTGGTGCAGTGGA
TAAGGTGTTGGACTGTGAAGCTTGAGGTCCTGACTTCCAGTAACTGGCACACCTGTGCTA
GTGATGCTCTGGTTCACTCACATTGATAAGTTAAATCCTTATTTTTATTTATTGATTTTT
TTTTTTTGCCTTCAGGGTTATTGCTGGGGCTCGGTGCCTGCACTACGATTCCACTGCTCC
TAGAGGTCATTTTCCCCATTTTGTTGCCCTTGTTGTTGATGTTGTTACTGCCATTGCTGG
ATAGGACAGAGAAATTGAGAGAGGGGGGGGAGAGAAAGATAGATGCCTGCAGATCTGCTT
CACTACTTGTGAAGCGACCCCACTGCAGGTGGGGAGCCACAGGTTCAAACTGGGATTCAC
AGTCCTTGCGCTTTCCGCCATGTGTGCTTAACCTGCTTTACTACCGCCCAGCCCTCTAAA
TCTTTATTTACTTATTTTCCCTTTTGTTGCCCCCTTTTTTTTTTTTATTGTTGTAGTTAT
TGTTATTGAAGTCATCGTTGGGTAGGACAGAGAGAAATGGAGAGAGGAGGGGGAACCGGG
GAGAGAAAGATAAGACACCTGCAGACCTGCTTCACCGCCTCTGAAGTGACTCACCTGCAG
GTGGGGAGCCGGGGGCTCGAACCGGGATCCCTAAGCTGGTCCTTGCACTTTGCACCACAT
GTGGTTAACCCGCTCCTCTACCACCCGACTCTAAATCTTTTTTTGTTTAGACTTGCTAGC
TGTTGCTGAATATGGTGTAGTTTTCGTACTAGTTTAATGGTTCCTACTAGCCATGTTCCT
ATCTTCCACTTTTTAATTTGGTTATATTTTTAAGTATTTGTAAGGGAGGGAGGGCCAGGG
AGAGCATCACTTTTAACACACTGAGTGCTGGGGAATTATTCAGGGACCTCAGGCTGGCGA
GTTCAGCACTTAGCTATACTCTCCACCTCCCTGACCAAACACAAGGATAACATTGTTTTC
CTGATGGATTTTAAGATTTTTCCTTCTTACTCCCAGTCCAATGGATGGGACCCAATGAAA
TGTCAGTTCAACGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCTCCTTAT
CTCCTGACTACGATGGTCCTTGCAGGGTGCCGTTAGAGAAAGACAACTCAGAAGAGTTTC
GCCAGCGGGAGCTGCGTGCCGCCCAGTTGGCTCGAGAGATTGAGTCGAGCCCCCAGTACC
GCTTGCGCATCGCCATGGAGAACGATGACGGGCGCACGGAGGAAGAGAAGCACAGCGCGG
TCCAGCGCCAGGGGTCTGGGCGGGAGAGCCCCAGCCTGGCGTCCAGGTGACTGGGCCTGT
GCTGAGACCTCCTGATGCTCACGAGACAGGATATTAATGGAGTTGCTTGTAATTTTTACT
TTTATAAGATTGAAGCCTGCGTCTGTTTAATGCTTGTCTAAGATGACCAAGCTGAAATTT
TGGACTTGAAAAACATTCAGAATTTTGACATTTTTTTCCCCCTTCTCCTCTGACTATTCC
AGTTTCACCCCTCACTTTTATAAACCTGAAAGGCCACCCATGATCTGTCTTCTCATGAAA
ATTGCCCCTTAGACAGCCCCCTTGCCCAGACATAGCTCAGGAGCTGGAAGAATGGAACAT
TGAGCAGACTCGATCCCTAACTGCACGGTATTGCAGGAGTGAAGGGAACCAAGTTTGCTA
AGGTCATTGTGGTGGATAGGAATTCAGCCTCAGCAGCTGCTGAGGTGTCCGTTCTGTCCT
GCTGTGTTTGTTTTGTTTTTAAAGAGAACAGCTGGAGCATTGGTCGGACTGGTTGGGTCA
GGGGTAGTGGTAAAGCACAGACTCAGAAGGCCGGAGCCACGGTCCATTTAGCTAGGATGA
GAGTTTTGAGCTGTGTGATGCAAGACCTTGATGTTTGAGTAGAGTGTAGGGTGCGGCAGG
GAGTGGACTTTAAAAGGAAAGGTTTCATCTTCCCCAAAATGTGGGTTTTCTGACAACTTA
ACCTACCTAACCTACTTAAAACTCTCTTCCCTAGGGAGGGAAAGTATATTCCTCTACCCC
AGCGAGTTCGGGAAGGTCCCCGGGGAGGAGTTCGATGCAGTAGTTCTCGGGGCGGCCGGC
CTGGCCTTAGCTCTTTGCCACCTCGTGGCCCTCACCATCTTGACAACAGTAGCCCTGGCC
CAGGTTCTGAGGCACGTGGTATCAATGGAGGTGAGTCATGAGAGCTTCTTGTGGGGATAG
GAGGCTAGGAAGTGAGGGGTAACTGATGGGATTGGAGTGGCTTGGAGCATTTGATGGCAT
GGTTGGTAATGTACTAGCAGCTACTGCCTCTTGCTTATCTCCATCTCATCTTTATCATTT
GAACAGGCCCTTCCCGCATGTCCCCTAAGGCACAGCGGCCCCTGAGAGGTGCCAAGACTC
TGCCTTCACCCAGCACCAGGCCTTCTGGAGAAACCTCTGTTCCTCCATCGCCTGCAGGTA
AGATTTCGATGGTATTGCGTGAAGATGTTGAGCTTACTAAGCACTAGTGAGTGTTGCTTG
TTGAAAAGTTGGGGTGACGGTTCCAAGATCTGAAAGGGCTAGATGTATGTCATATAGGAA
AAGTTGATTTTTCTCAGGAAGTCCTAGTGTAATCCANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAATTCCTTTCTGTCCT
ATTCCACCAATGCAGCAATAAGATAATAATTAATAACTGCAATAAACACAAAGGCCAACA
AACGGGAAAAAATAGCCTCCCAGGAGCAGTGGATTCACCGAACCCCAGTGATAACCCTGG
AGGCAAAAAAGAAATAGTTAAGGAAGGACAGGAGTACATAGTATATAATGGTTACGCAAA
GAGAGACTTGTGCCTGAGGCTCCAAAGTCTCAGGTTCAATCCCCTGCACCACCATTAACC
AGAGCTGGGCAGCGCTTTGGCAAGAATAAATAAAAGGTGGAAGGATGGAGACACCACAAT
ATTGACCGCTTAAGAAGGCTCTCCCTGGCGAGGTATCTCCCATGTTGTGGCCAGGGTTTC
AAAACTGGGACCTCATGCATGAGGAAGTATGCGCTCTACCAGGCAAGCTAGCTGCTTTGT
TAAGTCTTGGTCATGGTGATGAACCTGGTACTTTGGAGCCTCAGGCATGAAAGGCTTTTT
GTACACCTGTTATGCTCTCTCTTCTGGCCCTTGAACTGTTCATTAATTTTATTTTTTTCT
TGGGTAGAGACAGAAAGGGAAGGGAGGGATAGAGAGGGAGACAGACACGTCTGCAGCCCT
GCTTCACCAATTGTGAAGTTTTTTCCCTGCTGGTGTTTTGTTAAAGCAAAAGAGATGAGA
GAAAGGTTTTTTTTTCCCCTTGAAATATGTAAAGTTAGGCCAGCACTGCATAGCTAGCTC
TGAGTGGCTCTAGCTGAATGCAGCTGCCCCCGTAAGCATTGCCAGTCTTTCTGGTGCCCA
TGAGGCTGTTTGACCTGCCATGGGTTGGTGGTGATGTCTATTAAGTGGTGTTTCTTCTAA
GTTCTCTTTTGTACCTATTAATTATTGACCAGCAGTAACCATTGTACAGCTTTCCCTTTT
CTTCCAGTGGGCCGGATGTACCCCCCACGTTCTCCCAAGTCTGCTGCCCCTGCCCCAATT
TCTGCTTCCTGCCCTGAGCCTCCCATCGGCTCTGCAGTACCAACCTCTTCATCTTCCATC
CCTGTGACGTCGTCGGTTGTGGATCCTGGAGTGGGCTCCCTCTCCCCAGCTTCTCCAAAG
ATCTCTCTGGCTCCCACAGATGGTAAGGACCACATAGTGGGTACTATACACAGTGGGGAG
GCATGATGATACGCGCAGAAGGACCTCAGGCCTCTTTTCTCTTGCTTAGTAAAAGAACTT
CCGACCAAGGAACCTGGGAGAACTCTGGAGTCCCAGGAGTTGTCCCGAATAGCTGGAAAA
GGTAAGGGTTGTCCACGTCCCCTGTTCCCCCCCCCCCCCATGAGATTTAATGCCCTTTCA
ATTAAAAGGAAAGTTGTTGAAACTCAGATGAAGTGCTCGTCCATTATCTAGTTTTTTTGT
TTGTTTTTTTCAAGAGTTTTTCATAGTCTTTTGGGCTACTAGTATGGTATTTGAGTTACC
TTTGAAAAACGTTTTTTCCGTCTTCCTGTTTCTGCTAGTTCCCGGTCTGCAGAACGAACA
GAAACGCTTTCAACTGGAAGAACTGAGGAAGTTCGGAGCTCAGTTTAAGGTAAGAGGTGT
GAGAATGAGTTGGAATGGTGGGGAAGGTGGCAGGGACTTGGGCTTTTTAAAGAGTCACAG
GACTGACGGGATAGAAGAAATGAGAGCAAGCATGGGAGAGGATGGGGGGGGGGGCTGGGG
GGGTTGCATCGACGTTGCTGTATGTGTGTTTCTCCTTCCAGCTTCAGCCCAGTAGCTCCC
CTGAGAGCAGCCTGGACCCCTTTCCTCCTCGGATCTTAAAGGAGGAGGCCAAAGGGAAGG
AGAAGGAGGTGGATGGTCTATTGACATCAGAGCCCATGGGCTCCCCAGTCTCCTCGAAGA
CAGAGTCCGTATCGGATAAGGAGGATAAACCTCCCCTGCCTCCAGCAGGAGGCACTGAGG
GGCCGGAGCAGCCCCCACCACCTTGCCCGAGCCAGACGGGCAGCCCTCCAGTGGGCCTCA
TCAAGGGAGATGACAAAGATGAGGGGCCTGTTGCAGAGTGAGTGGGATGAGGGGCCGGGT
GGGTGTCAGTCAGGCAGGTGAGAGATAGGCCGCGAGAGCTGACTTTTGTTGTTCTCTTGT
AGACAAGTGAAGAAGTCAACATTGAACCCCAACGCCAAGGAGTTCAATCCCACAAAGCCT
CTCCTCTCTGTGGTGAGACGGGTTGGGAGTGTGTAGTTTGGTTTTCATGCGGGAGACTTG
GGAGTGGGGTCATGGAGCAGCTGGCTGTCCTGTCAGACCACTTAACCTCTGCCTCGGTTT
TCTCACCTATAATTTGGGGAGTGTGGGAACTGGGTGTTGGCACCCATATTAATGAGTGCA
AAGGCCTGGATTCAAGCCCCCAGTGCCTACCAACGCCTCATTCGTTGATGGAGCAGTGCT
GCAGGTGTCTTATCTCTCATTCTTTATCAAGAAAAAGCAATAGAGGCGATAGCCAGGAGC
TGTGGAGGCACACAGGCACCAAGCCCCAGTGGTAGCTCTGGGTTGGATGGGGTTTACTGT
ATGGCATGTGTGAGCATCCCCAAAGGCTGCTGCTGTTGGCAGGCACAGGAGGTGGGGTGT
GAAAGTCGCAGAAGCAGCTCTTACATGTACTTCCCTTCTCTCTTACAGAATAAATCCACC
AGTACCCCAACTTCTCCAGGACCCCGAACTCACTCAACACCCTCCATCCCGGTGCTGACA
GCAGGCCAGAGTGGACTGTACAGTCCCCAGTACATCTCCTACATACCTCAGATTCACATG
GGACCGGCTGTTCAGGTGAGAGGGAGCTGGCTTGGGGCCAGGGGAAGAAGCCTGGTCGGG
CAGACTGGGCCAGCAGACAGCCTGTCCCTGAGTTATTCAGCCTCCCTGTGCTCTTGGCTC
TAGGCCCCTCAGATGTATCCATATCCTGTATCCAACTCAGTGCCTGGACAGCAGGGCAAG
TACCGGGGAGCAAAAGGTGAGGGGGCTTAAGATGGGGCAGTTGGTGGGGTCCCTTGCCTA
CAGGCAGACAGCTAGAACTGGCCCCCCTTTCTCCATCCTCAGGCTCCTTGCCTCCCCAGC
GCTCGGACCAACACCAGCCAGCCTCAGCCCCTCCTATGATGCAGGCCGCCGCCGCCGCTG
GCCCCCCTCTGGTGGCCGCCACCCCCTACTCCTCATACATCCCCTACAACCCGCAGCAGT
TCCCGGGCCAGCCCGCCATGATGCAGCCCATGGCCCATTATCTCTCGCAGGTGACTTGGG
GGGGGGGGGGGGCAGCACACAGGCTCCGTGGTCCCCCTTTACTTCTATGGTCGGGGAGTG
AAGGGAGGGCAGCTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA
GTTGTGACTAGGTCTGGTGACCGTGAGCAGAACGTGTCTCCCATGTCCTCGCTGTGCCAA
CCTCCCTGTCTCCCCGTCTCTGCAGCCGGTGTTTGCCCCCATGCTTCAAAGCAGCCCACG
CATGCTGACTTCGGGGAGCCACCCCCAGGCCATTGTGTCATCCTCTACCCCCCAGTATCC
TTCTGCAGAGCAGCCCACCCCCCAGGCCCTTTATGGTGAGTTCGGCACCTGCCCCTCCAG
GCTGCACAACTGCCTTCCCGCGTGTGCTCAGCCAGCTCTTTTCTTCCCGCCATAGCCACT
GTCCACCAGTCCTACCCACACCATGCCACGCAGCTCCATGCCCACCAGCCGCAGCCGGCC
ACCACGCCCACTGGAAGCCAGCCGCAGTCCCAGCATGCGGCCCCCAGTCCCGTCCAGGTG
CTTGCCATAGTAGGGAAGGATGGTTGGGCAGGGTGGGGTGAGCTCTCAATCTCGGGGTGG
GAGGTGATGGTGGTGTGTGGGGTGGGCCTGGGTTGCAGAGGCCTGGCTGGCACTCACCAC
CCTTCCACTTCCCCTGACAGCACCAGGCGGGGCAGGCCCCACACCTGGGCAGTGGACAGC
CCCAGCAGAATCTGTACCACCCAGGGGCCCTGACAGGCACGCCGCCTTCTCTGCCACCGG
GGCCTTCCGCCCAATCCCCTCAGAGCAGCTTTCCCCAGCCAGCCGCTGTGTATGCCATCC
ATGCCCATCAGCAGCTGCCTCACGGCTTCACCAACATGGCCCATGTCACCCAGGTAAGAG
CCCAGGGCATCCACTCAGCCGGGCCCTTGCAGAGCACCCGCACCACGGGGCTGTTGCACT
CTGCCACCTTTGCTTTGATTCCCTGAGTGTGCAGGTGCGTGTGGTGCTCCCGGGCTCTCT
CTCTCTCTGCAGGCCCATGTCCAAACTGGAATCACAGCAGCCCCGCCCCCTCACCCTGGG
GCTCCCCACCCGCCCCAGGTGATGCTGCTGCACCCACCCCAGAGCCATGGGGGCCCCCCC
CAAGGCGCAGTGCCCCAGAGTGGGGTGCCTGCACTCTCAGCTTCCACACCCTCACCCTAC
CCCTACATCGGACACCCCCAAGGTGAGCAGCCTGGCCAGGCGCCTGGATTTCCAGGAGGA
GCCGATGACAGGATTCGTGAGTTCTCGTTAGCTGGGGGAATTTGGCATGGACGAGCTGAC
GGGCTGCAGGTGGGGCAGGACGCGCGGGTTCTGGGCGGGGAGTGAGGGGTCTTGGAGGCA
GGGCTGGCCCACAGGGCGCCTGCCGACCTGCACCTGTCTGTGAAGTATGTAGGGTGGGCA
GAAGCCACAGTCGCCGCCGCCAGGGGCTTGCTCCTGGCTCTGTCCTTTGCTTCCCTCCGT
CCTCGCTCAGTTGTGATCCAGCAGCCCCCCTCCCCACTGCCTCCCCAGCTCTCAGTGACC
CCGACTGTCTCCTGACTTAGCCGAGGTAAGGTCAGCGCAGCAGGCAGGCCCAGGCTGGGA
TGTGGGGGGCTGAGCTGGGCACATGAGCAAGGGCACTGGCTCACTGGGAAACAGCGATTG
ATCTGTGCTTCTGACAGCCCCGAGACACCTCGAGGAGGCCGCTCCTACCCACCCCAGCGC
TCCCCCACACCCCACACTGGATGGCATTGGATGAAGGGACAGCTGCTTGGGTTCTAATGC
TCCTGCTCTCTTCTCTTTCCCCTCCAACCAGTTCAATCTCATCCCTCCCAGCAGCTCCCC
TTCCACCCCCCGGGGAACTGAAGATTGTCCTGGCCGCGACCTGAGACTTCCATGAGCGAG
GGAAGAGTGCCCTCTCTCTTCCCCCAGCAGCTCGGACCAGTCCCAGCCCCCAACCCCCCC
CCCCCCCCCACCCCCCTTCCCCAGGAGAGCTGGGGAATTCCTGCCAAGCACCTTGAATGG
GAGGGGCCTCGGAATGGGCAGGGGCCAGCGGGGGTGGGGGGTTCCTGCTCTGCCCTGCCC
GTCCTCCACGTCCTCCCTTCTTGCCTCTCGTCCATCCCCCGCTGGAGACGGAAGATCTTT
TATTTTCTATTATTTATAACTTCAGACTTGGGCCCCCTGTTCTTTCTTCCCCATTAACTT
GAGAGATCTGCGTGAGAGACAGACAGATGCCCCACAAAGATGGTTGGACAAGGACTTTTA
CTTTTTATTACATAAAAATATTAAAAAAAATAAAAAAAATAAAATTTTAAACTAACTTAA
CCTGCCTGTGCTTTCCTTGGAAGAATAAGTGTGATAGCCAGAGCTGGCGCGCGTGCGAGG
CCGGCCTTGGGGCTGTCTGTTTGTTGTCGAAAGGTCTCCAATCTGGGGCCAGTGAAGCAT
GTCTGATGTTATTGCCTAGACAGGTCACCTGCTCTCCCAGTGACTCTCAAGGGTGGGTGG
GTGGGTGTGTGCGCACACGCGCACACTTGTGCTGGGGGCTGAACTTGAGTCCCTTGCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1151, 1682..1806, 4381..4392, 4395..4406, 4411..4469, 4730..4930, 5639..5814, 5971..6081, 7472..7666, 7754..7825, 8043..8113, 8286..8581, 8667..8736, 9193..9339, 9448..9520, 9607..9794, 10070..10199, 10280..10401, 10545..10757, 10897..11140, 11290..11444
1001..1151, 1682..1806, 4381..4392, 4395..4406, 4411..4469, 4730..4930, 5639..5814, 5971..6081, 7472..7666, 7754..7825, 8043..8113, 8286..8581, 8667..8736, 9193..9339, 9448..9520, 9607..9794, 10070..10199, 10280..10401, 10545..10757, 10897..11140, 11290..11441
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved