Erinaceus_europaeus Locus RPS3
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus RPS3
Erinaceus_europaeus
RPS3
scaffold_340652
SNORD15, SNORD15
1917..2064, 5569..5713
6991
GAGACTCACATGCCTAAGACTCCCCACACCACCATAAACCAGAGCTGAGCAGTGCTCTG
GTAAAAATTAATTAAGAAATTTGTCTATTGGGCAAGAAGGAGAAAGAACCAGAGTAACAT
CTTGGCATCTGTAATGCCAAGGATCAAATTCATGACCTCACACTTAAGGGTTCAACACCT
CCTGGGCTGGATGTTTATATTGGGTGTGTGTGTCACTGCAGCTCTGTTGCTTAAGTCCCC
CCCTTTTCCCCCCCCCAACTCCTCAAGATAGAATTAGACCGAAAAGACAACATAGCACAG
AATCTTCCTTCAGTGCTGTGGGACTTAAACTCAAATCTGGGTCTGAACTTTCATTCAGAG
TATCTTATCTTATCTTATCTTATCTTATCTTATCTTATCCTATTCTATCCTATCATCTTT
ACCAGAGCTCTATTTTGTTCTGGATTATAATGGTACAGGGGCTTGAACCTGGGAGTTTTA
GACATGAATCTTTATTTTATTTTATTTTATTTATTTATTTATTTATTTATTTATTTTTGA
ATCTTTATTTTATTTTATAATTTTTTTTTTATTAGCATGAGGGTAAATGGAATCAGAGCA
TTATTCTGACACATGTAGTGCCAGGGATCTAACTCAGGACCTCATGCTTAAAGAATACAC
TGCTTTATATACACTACTGCCACCTGCCCAGTACATTTTTTTTTCTTTTTAACTAATGAG
GCTAGGGCTCTGACTTCTCACAGGCAGTTTGGAAATTCGGTCTTCTTCCTTCTTCCCTTC
CTCCCTTTCTTTCTCTCTCTTTTTGAAATTTAGAACTATGTGCATCTAAGGTTTTCTCCA
GGCCTTCGTTTCCCTTAGCGCCTCAATCAAGTAAAAACTACATTTCCCATGAGCGCTAAA
AAGTGTCGACGTCGCGCAGTTCTTTACCGTAGTTCCGCGCCTTTATACTCACTTCCGCCG
CCGACAGACTTCCTTTCTTTCGTGGGCTGCATGGGCGCAAGATGGCGGTACAGATTTCCA
AGAAGAGGAAGGTGAGTCGGTGGGGTTCAGATCCTGGTGTCTGCGTGGCCACGGGGGCTT
GGGGCTTCTTGAGTTGCTCTGCTCAGATTTCCAGCTCTGTACCTTGTCTCGGGGAGTGGC
GGGAACACACCCACAGCTTGCGGATGGCGGTGGATTGAGTGTGAGGCCCGAGTCCGGCTT
CATACACACAGCGGTTCTGGGCTAAAGAGTAGACTGGAGATTTAGTTCCTCTTGGCTTAG
AGGAGACGCTTATGAGGGTTTCCTGGTCAACAAAATTAATGTCATATTGAGGACCTTCTC
TCTGATCTTATAATGGTGGCTTGGGGAGCAGGGTGGTTTCTGTTTATTATATTTATGACA
GGGTGTTTTCGCCCCCCCACCTCAGTTGGAAAGTCTACTGGCAACTTTTTGTTCCATCGG
AACCGAGGAAAAAGTAGAATTGGGGCCTAGGAAGTGCATTCCCTTGAGTTTTAACTTTTT
CTATGGGCAGGATCTATAAAGGCCATTTACAGTTTGCCGCTTTGTGTGTACACACACCCA
AGTTAAAATTAAACACACAGACGGGTCCGCACAATTTGCTGCTTGGCCATGCGGGCGACC
CGGGTTCTGCGGCGTCCTTAGCGCATTGGGGGAGCTTTTGTGATACGGTGTCTATCGGAA
AAGGTGGTATCAAAAGGTTAAGCCCGCACATTTTTGTGTTGGGCTTTGTCAGCTTTGTTA
GTGGGTAAGGCCTGTGTTAACTCAAGCTAAGGTGACAGATTCTTCTGATACGGAAAACTA
CTTAAAATTCAGTTGCTGGTTATCCGTTCTTTTCCAATAGTTTAAAGCTTAGCACCTCCA
CTGTGCTCAGTGAAAGAGTTATTTATAGTAATTTAGAGCAGTTTGTAAATGGTAACCCTT
CGATGAAGAGAAGATGACGAGTCTGACTGGAGGTGTTCTTTGTCCAGGTGACTCCTACTC
TGTGCTGCGTTCTGTGGCATAGTTTTAAGGGCTCTGGGTCAAGCTATCTTCCAAAAGACG
ACATAGAGGCATTTGTCTGAGAAGGGTTGCTACATTCCTTTTTGGAAAAACGGATAATGA
ATTGATAGTGGGTAGTTTGTTGGAGAGGTTAATTTTCTTTATTTGATAGGACGGAGAAAT
TGAGGGGAGGGATGGGCAGTGGTGCACACTTTTATGTGCGCAAAGACGTAAAAAGAGTGT
GAGAAAGATAGCGCCTGCAGGCTTGCTTCATAGTGGTTAAGTGTTTGCTCCCCCCAAGGT
GGGTTGCAGGGGCTAGACCATGAGTCCTTGGAGTTGGTGATGTGTATGTTTATCTGGTGC
ATCACTCACTGCCTGGCCCAGAGGGGTTAAATTTTGGTCAGAGTTGTATTGGCTGAAAGG
CTGGGCTGGAGCAAGTAATTCTGTTCTAATTTGATCAGTTTGTTGCTGATGGCATCTTCA
AAGCTGAACTGAATGAGTTTCTTACTCCGGGAGCTGGCCTGAAGAATGATTACTCCTGAA
GTTGAGGTCGTTGTTACACAAACCAGACACAGAAATCCATCATCTTAGCCACCAAGTTAA
AAACTTATAGTTTCAGGAGATGGGACCGGTGGATAAAACCCTGGACTGTCAGTACTGTGT
TCAATCCTTGGCAGTACATGACCTAGAAAGATAATCTGATTTCTTTTAAGTCTAGGAGGA
AAAACAATCAGATTATCTTTTTAGGGTTAGTGTATTTGATGGTACTGAATTGTGATTTTT
CTCTCTAGGACACAGAATGTTCTTGGTGAGAAAGGCAGGCGGATCCGGGAATTGACTGCT
GTGGTTCAGAAGAGGTTTGGCTTCCCTGAGGGTAGTGTAGAGGTGAGTGGTCGTAACTTG
TTTGTGCAGGCATGTTGCTGTGGTCTAGAAGTGGCATTTTGGGGTATCCTTAGTATCACC
CTAAAGACTGCTTACTTGCTTAGGGGGATAGTAATGAAAGTTGGATTAACTACCTCTTCA
GTCTCCTTTGTCAATCTGTAAGAAGCCTATATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAATGTGTGCTTCTCGTACTTTGGGATTATTATAAGAGGTACATTTCTATG
GTGGTTGTGCTAGTTCATAGTCTAAAACATTAAAGAGTTAAAAAATTTGCCTTGTTTTCC
TTTTTTAAAGCTTTATGCTGAAAAGGTGGCCACAAGAGGTCTGTGTGCCATTGCCCAGGC
AGAGTCTCTGCGTTACAAACTCCTTGGTGGTCTTGCTGTGCGGAGGTAAGTAACAATGGC
TTTATCTCACCCCTCCTTTTTATTTTAATCAGTACTATAATAGAAAACTTTCTGGAATCA
CTCTGAAGGCTCTACTTGTGATAAACTGCTATGAATTACTAGAAACCTTAACCGGCCATA
TGCTGGCATGAATATACCAGCTGGCCTGAGCTGGCTTCTCCAACTCTTGGCTTAGATACC
AGTAGCTTCAAACAACAGGAATTACTGTATGATTTGGTGGCCACTGAGCTGTGAATGTGG
TTTTATAGGTCCAAAGGCAGGCATGGCCACTCATTGGTTGATGTCTCAAGCCATTTTTAA
AGCCAGAGCTCTGGCTCATGGCCTGCAAGGGTATTAAGTCTGGAACTTTGGAGCCTAGGG
CAAGAGAGTCTCTTTGCATAACTATTGTGCTATCTACCCCTGCTTCTCAAAGCCAGTCTT
TTTTTTTTACAGCTTATAAAAACCAATATAATATAGTCAAATTACTAATCATGAGAAAGT
ACTCTTGGTAAAAGGAATACTGCTGTAGTATGTGCAATATAAAAATAATTCTTACCATTT
ATTATTGGTTAGATACCATACTAAGCACTTTATGATCATGATTATTAATTTTTTTAATTA
TTTTGTTGGGTAGACAGCCAGAAATTGAGAGGGAAGGGTGGGATAAAAGCCAGTCTTTTA
AGGTTAGAAGAGACTTGTTTCTTGAACCAGGGTCTGCTTATATTTTCACTTAATGAAAAA
AGGGCCATTGGAACCATGAGTAAGTGTTTGGTTTTTAACTTGTGGTATGGCTGGCCAATA
CAGTGTAAATAGTTCTCTGACTTTCTTCCAAGGGCATGCTATGGTGTGCTACGGTTCATC
ATGGAGAGTGGAGCCAAAGGCTGTGAGGTTGTGGTGTCTGGCAAACTCCGAGGACAGAGG
GCTAAGTCTATGAAGTTTGTGGACGGTTTGATGATTCACAGTGGGGACCCTGTCAACTAT
TATGTTGACACTGCTGTGCGCCATGTGCTTCTCAGACAAGGTGAGCATTTGGGAAAGCTT
GAGGCAAAGGGCATGGGTAGATAAAAGCTGCTTTCTGTCTGTACCTTTGGGTGATTAATC
TTGGGAGTGCTGGTACATTTTTGTACTCAGTGAGTGTACTAATTCACTGTGTTACAAAGA
TTGGCTTAGGTCAGAGTTGATTTGGCTATGTCACAGTAACCTGTCTGCCCTTCAGTGATG
ACACGATGACGAGTCAGAATGGTCACATCCTGCTCTTGGTCCTTGCCAGTGCCATGTTCT
GTGGTGCTATGCATGGGTTCCATTTGCAAAAGTGTCCTGTGCATTGATTGATTAGAGGCA
TTTGTCTGAGAAGGGACCACACACACAGGTGCTTCTGCCTTGTACTGTGTGCAGTGGATG
TGTGAAGCAAGTTGGGTCCCAACTATGGCATCTTACAGGTGTGCTGGGCATCAAAGTGAA
GATCATGTTGCCTTGGGACCCAAGTGGTAAGATTGGTCCTAAGAAGCCCCTGCCTGACCA
CGTGAGCATTGTGGAACCCAAAGATGAGATACTGCCCACCACTCCAATCTCCGAGCAAAA
GGGTGGAAAGCCAGAGCCGCCTGCCATGCCCCAGCCAGTACCCACAGCATAATCGGTATG
TCTGTAGAACCATTGGGACAGAATTAGAACTTCANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 2438..2485, 2487..2496, 2498..2503, 2505..2513, 2515..2546, 2548..2555, 2557..2574, 2768..2861, 4270..4364, 5192..5379, 5798..5991
1001..1030, 2438..2485, 2487..2496, 2498..2503, 2505..2513, 2515..2546, 2548..2555, 2557..2574, 2768..2861, 4270..4364, 5192..5379, 5798..5988
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved