Erinaceus_europaeus Locus Mono:125:SNORD78
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:125:SNORD78
Erinaceus_europaeus
Mono:125:SNORD78
scaffold_238927
SNORD78
1001..1064
1842
TAAACATTTCTAGCGACTCAAAAGGATGTGTCCAATCAGTTTCAACTAAGTCTTTGGCT
CAAGTTGTTACATTGTGTGCTTTGTGGCTACCAGGAAAGAAAGTTGACTAAATATAAGTA
CTTATTTCCTCCGAGTCTGTGTAAAAATGGTGGAAAGTTTCCTTTTTTTCTTTCTTACTA
GAACCGGGAAAGGTGCAATTGTAAATGTGCAAGGCCTGGGTTTGTGAAGTAAAGTAAAGC
TTCTAGGGTTGGCAAAATGCTCAGTTGGACAGTGCACCTGCTTTTCCATGTATGTGGCCG
TTTCTAGTCTGTCTCCCACTGCACGGGAGCAAGCTTTGGTGTCGTGCTGTTTTATCCTCT
CCCTCTCGCCTTCAGGGTTATCGCTGGGGCTTGGTGCCTGCACCATGAATTTACTGCTCC
TGGAGGCCATTTTCCCCCCGCTTTGTTGCCCTTGTTGTTGTTGGACAGGACAGAGAGAAA
TCAAGAGAGGAGAGGAAGACAGAGAGAGGGAGAGAAAGATAGACACCTGCAGACCTGCTT
CACCACCTGTGAAATGCTCCCCCCCGCAGGTGGGGAGTCAGGGGCTCTAACCGGGATCCT
TGAGCTTTGTGCCATGCACTTAACCCATTGCGATACCCCCCCCCCCCCAATCTCCTTTAA
AGAAGGAAAGATTTGTTTATTTACAAGTGAGGCAGGACAAGGAGGAGGAGGGGGAGGAAG
AGGAGAGAGAACCAGAGCATCGCCCTGGCACATGATGCTCGGGTTTGAATTTGGAATCTC
ATGCTTGAGAGTCCAACATTTTATCCACTGTGCCACCTCCCAGTTTGTGGTCTCATTATC
TGAAAAAGTCATTCTGGAGTGATTATGCTCTAGTGATGACCAAAACAAATCATCATACTT
AAAAAAGAAAAAAACAAATTCCAAAAGGTTCAGAAATAGGCAAAAAAGCTGTATTTGGAA
TAAGCGTATATAGAATGAAGCCAAGATTAAAAATAGGAGGGTTGGAATGATGTTGATCAA
ATGTCTGACCTAAAATAAATATGTAGACAAGTTAACACTGAAGGAAAAAAAAAAAAAAAA
AAAAAACAGGAGAGTTGGTTCAGAATATATTTATCAAGCAGTTAGTAATTCAGATTTCTA
TAATTCTGCAGATTTAAGTGACTGTGCTTGCATTTCTCTGGTATATGTGCTGCTGGGGAT
TGAACTCAGGACCTCATGCTTGAGCAATGCTTTAACCACTATGACACCTCCCAGACATGT
GCTTGCATTTCTCTGGCCAAGGCATCTGAATTATTATCTGGAGAGCCAAGAAAAGTAGTT
CTTGACTAGGGAGATAACAGGCACAGTATAGAAATTTATAATACAGGGCTAGGAAGACAG
CATAATGGTTATGACAAAGTTTAGATCTGAGACTCTTAGGTCTCAGGTTCAGTCCCTATC
ACCACCATAAGCCAGTGCTTTTGGTCTTTCTCTGTATCTCATTAAAATAAAGTAAATTAA
AAAAATATATATTTAAAGTAGTTCTTTAAAAATTTTTTAATATTTACTTATTTATTTCCT
TTTTGTTGCCCTTGTTGTTTTTTATTGTTGTTGATGTCATCGTTGTTGGATAGGACAGAG
AGAAATGGAGAGAGGTGGGGAAGATAGAGATGGGGAGAGGGGAGGGGAAGACAGAGATGG
GGAGGGAAAGACAGACACCTGCAGACCTGCTTCACCACTTGTGAAGTGACCCCAACCCCG
CAGGTGGGGAGGCGGGGGCTCGAACCAAGATCCTTAACCCGCTGCGCTACCGCCCAACTC
CCAAAATATTTTTTAAAAGAAACTTATATTAGGGGCTAGTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved