Erinaceus_europaeus Locus Mono:400:SNORD100
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:400:SNORD100
Erinaceus_europaeus
Mono:400:SNORD100
GeneScaffold_7024
SNORD100
1001..1087
2087
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGTTCTGATGTCA
GTTCCCTGCTGAGGCTGAGAAGTATGCTAGTTCTTGGCCACTGCTTAGCCTCTGAACTCT
AAACTTCTCCACAACATTACAAATAACAACTCAATTTTGTTTTCACTATGGAGACAGATC
ACTCAGTAGATAGCTTATGGTTCTCATGATAGACAGGGCCCTGGGTTTGAACTCAAGGAC
CATATGGAAGCATCATGGATAGATCTAAGGATGGTGGAGCCATGCTGGAGTGTCTCTTCC
TCTCCTTTCTGTCACTCAATTAAAAAAAGAAAAAAAGAAAAAGAAACTGGACCCAGGTAA
CTGCTAAATGGTACTAAGCATTTATACAAGACCAAGTTCATACAAGACCAACTTCATCCA
GCAGTTGGTTCCTTGACTGAAGCTGGCCATTTAGAAGGAAGGTATCTTAGCCCCTTTGGG
ATGTTATAACAGAATGGGGTAGCTTATAAATAATAGAAATGTACGTACATGATGACAACT
GGCTCCCTCTACCAGACTATCATGAGGAAAATTCCATGAGAAAAAGAAAGAAAGAAAGAA
AGAACGAACGAAAGAAACAAAGAAAGAAAGGAAGAAAGAAAGAAAAGAGAGAATTGTATT
TCTCATAGTTCTGGAGACTGAGAAACACAAGATAAAGGCACCAGCAAATCAAGGTCTGGT
GAGGAGCCTCCTCATGGCCTATGGTTGGCATTTATAGCTATATTCTCACAAGGGAGTTCT
ACAGGAGTTTTATCTAAAATGCTCATTTACTCAGTGACTGAAGAGGATCCACCCTCAACC
CAAGCACTCCCAAAATCCCACCCCCTCATTTATACACTGTGGGGGAAGTCCCCCATGATT
TGAGATTAGGACGACAAAACATTTATTCCATTAGCAGAAAGGAAGAATCTGGATTCAATT
TTTTTTTAATTTCTCTTTTTTTAAATATATTTTTATTTATGATTGGATAGAGACAGAGAG
AAATTGAGGGAGTAAGAGGAGAGATAGAGAGATACTTTCAGCCCTGCTTCATTACTGGTG
ATTCTTTCCCTTTGTAAGTGGGGACCAGAGACTGGAACCTGAGTCCTTTTGTACTGTAAT
GTGTGCACTTAACCAGGTGTGCTATCACCTGACCCCCTTTTTTATCAGTCATAAGATCCT
GATCTGTTAAACTTATCAATCACCGTGGTATCCTTTCTTTTAAAAAATATAATAAACACT
TATAAGACAGATAAGGAAGATAAGATATCAAATAAATATAAAGTTGCAATGGAATTTTCC
ATTTTTCTTCATTGTTTCTTCTTTACTTATAAGCTTGAATATTTTCATTTTACCTAAGGC
CAAATCTACACTCTTGGAAATTTCAGGTCCTGGTTGTCAACAGTAAACAAGGTGGGGAGG
GAATGGGAGGTACAAATAGAGGAAAAAATAAAACTTTGACTATTATGTTTGACTAATGGC
TCCTAGAGGGAGACTCTTCTCAACTACTGTTGCAGGTTTAACTTCAGACAATTAAGTTGG
AATCTCGCGATTGTCTTTTTTTTTTCTTTTGTCTCATATTATTAGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved