Erinaceus_europaeus Locus Mono:377:SNORA44
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:377:SNORA44
Erinaceus_europaeus
Mono:377:SNORA44
scaffold_37004
SNORA44
1001..1131
1930
GTTTCTGAGAGATACTGATCAAGTCAGGAGTGTAGGCTAGTGGCAAAATAACAAAACAT
TACCATTCACATATACTATGCGTATGGTTTAAATGCATGTCCTTGACTTAATTAGCACAA
TTTGTAATCATCAACAAGCCCATCTGATGAATCATCTAATGCAAACATAATACATGTAAC
ATTTTTGTAGAGAAGAATGATATCCCCAAGGAGAAAACTAAGTTGAATAGGTTATCTCTA
AAGAAAATGAGTTTGACCAATTTTGAAAATCAACTGATAGTAAAGGAAACATTGGGAGAG
AACTTTGGAACTGAGAAAGTGATTCATTTTACTCTAATCCTCAACTAAGAAAAAAACAAC
TCTCACAATTAGTGTTTTCATCAATAAAGCCCAATTAATATATTTAAATGACAGTCATGT
CATGAGGCCTAAAATACATATACAAACTAGTTCACCAATAGAAAGCATTCCCTTTCAAAT
TCTCAGGGTTTGATCTTTCTGTTCTTTGGTGACATTCTCTTCCCTAAAGTCCTCACTTGG
GACAACAGTTTTAAATACCATCTATATACCAATCGTTCTCAAATTTATTTCTCCAGTCCC
TATTTCCCTCCAGATCTTTAAACTTAACTGCAAATTTGCTGCAATCCCACAGGTGACCAA
GAAGAAAATAGCTAAAATGCATACAGAAAGGGAAATGAGGAGGGAATGAAAATGGTACAA
TAGAAAAAAATCAAAACAGAAGGTAGTATTAGAGGAATTGTAAAAATGAATTACATAAGT
ACTATAGAAAATAAAATAGCAAGCATGTTTCCAAGGTTTATGGATATTCATAGCCATGGG
ATCTCCAACTGCATGCAAGAATAACCTAAAAAGACTTTGACAGCACAGGTCAACATAATA
CCTGTAGCTGTCACTCAACTTTCCTATATTTCAGAACATGGGCTTTGATGCCTTTCTCTT
GGATTTTCACCAGTTCCAGTTATAGTGAGTATAAGGAATTTTAGCTTATTCAGCAGGTTT
CCTGGCAGCATCAATACTGAAGATTGTGACAGAGACCAATTGCTGGAGTTTTGCTTTTTA
GTAAGATATGTTACCAGTAAAAAAATCTTCATCTGCTCCTAGGATGCACTGCAATACAGA
GAAGAAGAATCAAAAGGAACCAAACCGATACAAGAAAAAGTGGCAGGGGCTACAATGGCC
ATAGTCCTGAGGTTTGAAGATTGATCCCAAGCTTCCCATCTTTCTCTGGTGTTGATAAAA
ATAAAAAATAAGGTGGACTCATTGTTCTTAATAGCTGCATAATATTCCATTGAGTATATG
TACCACAGGTTTCTCAGGCACTCATCTGCTGTTAGTAACCTGGGTGCCTTCCAGGTTTTA
GCTATTATGAATTGTGCTGCTATGAACATAGATGTACACACATCTTTTTGGTTGGGCATT
ATGAAATCCTTGGGGTATATCCCCAGGAGAGGAATTACTGGGTCATATGGAAGGTCTATG
TCTAGCCTTATGAGAGTTCTCCAGACTGCTTTGCAGAGAGGCTGAACCAATTTACATTCC
CGCCAGCAGTGCAGAAGGGTTCCTCTGTCCCCACAGCCTCTCCAACATTTGTTGCTGCTG
TCCTTTTTGATGTATGCCATTCTCACAGGGGTGAGGTGGTATCTCAATGTTGTCTTTATT
TGCATCTCTCTGACAATCAGTGACCTGGAACAATTTTTCATATGTTTGTTAGCCTTTTGG
ATCTCCTCTGAAGTGAATGTCTTGTTCATATCCTCTGCCCATTTTTGGATGGGGTCATTT
GCTTTTTTGGTGCTAAGTTTGCTGAGCTCTCTGTATATTTTGGTGATTAGTCTCTTTTCT
GATGTTTGGCATGTGAAGATCTTCTCCCATTCTGTGAGGGGTCTCTTTGTTTGTGTGATA
GTTTCTTTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved