Erinaceus_europaeus Locus Mono:117:SNORA68
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:117:SNORA68
Erinaceus_europaeus
Mono:117:SNORA68
scaffold_253868
SNORA68
1001..1123
2123
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAGGGGTGAGGAAGAATGGGAGGGAGAGAGACAGAGAGACACCTGCAGCCC
TGCTTTACCACTCATGAAGTTTCCCCCTGCATTTGGGGACCGGAAGCTTGAGCCTGTCTG
TCCTCATGCCTCGTTATGTGTGCGCTCAGCAAGGTGTGCTACCGCCTGGCCCCTGTTTTT
ATTTTATTTACTTATTTTTGGATAGAGACACAGAGAGTGAGAGTGACGGGCAGAGAGAAG
CAGCACCGCTCCACTGTGTGTGAGGCATCCAATTCCACAGGCAGGGCGGGGGGTCGCACA
CTGTAACATGTGTGCTCTACTGGGTGCACCCCCACCTGGCTCTCTCATCAATATCGAGAT
CAAGGCGTCAGCCAAGGTTGCAGTCACCTGGTGGCTTGACTGGCAGCAGGAGGATTCACT
TGAGTGGCCTGTGGATGGAAAGCTCTCCCTACAGGGCTCCTTGAGGGTCCTCACAGTAGG
GCGCTGACTTTCTCCAGAATAAAAGAAGGGGGCGGTGAGGGGATGAGACCCAAGAGGAAG
CTATGTCGTACATTAACTGGTCTTAGAGATCACATGACATCACTTCCATTACATCTGCTT
TATAAAAAGAGAGTCACTCAGTCTGCCACACATACAAGGGGAGAGGAACTAATTTCCATT
GTTTGAGAGAGAAAGTGCTGAAGGGATGCTAACAGCAAGGGGAACCTCGCCGCCTCTGGA
GGACTCTCTGTGCCCTTCAAAGTGAACTTGGAGGTTCTACACACCCCTGGGATTGGATTA
AGTAGATCAGCAGTGGGAAATTGAGGACTGTGGCCCACACTCTCCACCCACAGACCCCCA
CCTCTCATGAGGCCTTTGGAAGTAATCAACAGTAAATTATTTTTGCCAAAAGACAGGGTG
GTGTGGCATTTACAGTTCTAGAGGAGTTGAGGATAGCCGAGAGCCAAGGAATGATGAGAC
ACAGTGGTGTCTGAGTGTCATGCCCACAGTCAACACTGCCCACTGTCACCTCAGTATCTA
GAATAGGTGAGTGAGGACATAGCATAAAGAAGAAAGGAAGAAAGAAAGGAAGGAAGGAAG
GAAGGAAGGAAGGAAAAAAGGAAGGAGTGCTGAAGAAATGCAACATATCTTAACCCTTCC
ATTGTGTGCAGGTGAAGCTCCTGGTTGTTTTACAGATATATTAGGAATAGGAAAGAGAAC
AACAGAGGAGACATAACACCAAGTCAAACTTTCTAAGTGACAACACACTTCACAAATTAA
AAGCAGACTTCAAAACTTGGAACCAGCATCAGAAAAACGCATGACATGGAAATTCCCCTC
TGCCCCTAACAAATTACAAAACTCAGTTTCTTCCTTTGTAAAGTGTCCCCACAAAGCAGG
GATAAATAAGAGAAAGAGAGAAAAAAATAAGAGAAAGAGAGAAATTCCCAAAGTCATTTT
CCAACCAAAGTACTTCCTGGGAGCTACTTTGATTTTTTTTTTTTTTCCTAAGAGAATTTC
AGTTACTATTATACTGTTTATGAATTAGGGCTGATACAGTATACGTGTAAAAGTAATAAA
CTGGAGAGCGTGACCCTTCACGATTCTCAGCTGTCTTATTATTGTCAGGAAGAAGATGGA
CATTGGTCATCATCAACCAGAAATATGGAAACACTTCTTAAGTCTTTAAAGAACATCAGA
TGGGTTCTGTGTTACTTAAGCACCATGAGAAAACAAGAAAATTGTGAAAACACACTGGGA
AACAGATACCAGGCAACAGCAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved