Erinaceus_europaeus Locus Mono:143:SNORD103
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:143:SNORD103
Erinaceus_europaeus
Mono:143:SNORD103
scaffold_248925
SNORD103
1001..1087
2087
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNATGATATAATATGAAATAGAATGAAATAAAATATTAAATCATTC
AAAAACAACTGCCTGTTTCCACCTGTAGTCCCTCTTCTCCCATGCAATCATTTTGATTAT
TTCTATTTCACTTTGTTTGCTTCTGTTTCCCACCACTGTCCTAATAATGTGACTTAGGGT
CAGAGAGGGAGCTCACAGATAGGGTGCCTGTCTTGCCATGGGTGCAGCCTAGGTTCAAAC
CCCAGCACCACATAGAATTACCAGGACACCAGGGGAAACACTTGTGCTGTGGTGTTCTCC
CTGTCTCTCTGTGTCTCTCTGTATCTCTCTCCTTCTGTATCTCTCCCTCTTTCTATGGTT
CTCTCTCTCTTTCTCTCTCTCTCTCCCATAAAGGCAGGTTCCACAAAAAAAAGAGGGCAG
AAAATAAAAGGGGCTGTGTGTACCCTGACCTTCCTTCCAGGGGTTTCTCCTTCCCTCACA
CCTGTCTGTCATCTCCACTTTCAAACTGCAAGATAAACTTTAACATGGAGTTCCTGAACT
CAAATTAAATCTTCAGGCTTTGTGTGTAGGATTCTTATACATAGCATGGCATTGATAGAC
AACTTGCCCTCACTGAGAAGAAGGTTCTGTGATGAGAAGCTTTGTTATTCGAAATCAAGA
GTCATGGTCAGGTAATGGTGCACCTAGTCGAGCACACATGTTACCATGCAAAAGGACCAG
GGTTTGAGTCCCCAGTCCCCACCTGCAGGAGGGAAGCTTCAAAATCAGTGGAGTAGTGCA
GCAGGTCTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TTATAAATAAAATAAATCCTTTAGAAGAGGGAGAAGAGAAGAGTAGGGGAAGAGGAGGCA
TTTATTTGCTTCAGCTGACAAAGAATATTTTCACCATTTCTCCTTTGCACCCTGGTCCCA
AGGCTAAGAACAAAGACTGTTAAGTTTCAACACTTGCTAAAGGAAGTCTCTTGGTCCCTT
GTGGAGAATGTTCTGGGGAAAAGGAAAAAAACAGACCTGTGACTTCAGCCCTCACTTCAG
GGGAAAGAAGAAAGGGGGGGTGGGTTCAATTCCCTGATACTCACCTGCAGGGGGGCAGTT
TCATGATTGGTGAAGCATGACTGTAGGTCTCTCTCTTTCTCTCTCTCTCTCTCATCTATC
TATCTACCTATCTATACTATCAAAATAAATAAATAATTTTTTTCATTTTTTTATTTATTG
GGGAATTAATGTTTTACATTCAACAGTAAATACAATAGTTTGTACATGCATAACATTCCC
CAGCTTTCCATATAACAATACAACCCCACTAGGTCCTCTGTCATCCTTCTTGGATCTGTA
TTCTCCCCCCTCACCCGAGTCTTTTACTTTGGTGCAATACACCAATTCCAGTTCAGGTTC
TACTTGTGTTTTCTTTTCTGATCTTGTTTTTCAACTTCTGCCTGAGAGTGAGATCATCCC
ACATTCATCCTTCTGTTTCTGACTTATTTCACTTAACATGAATTTTTCAAGGTTCATCCA
AGATCGGCTGAAATTTCTTCCTCTTTTTCTTTATAAAAAAATTAATTTTATGTGGTCTAT
TTCTCCAAATCTTGTTTCTCACTTAAGAAGGGTCTCAGTATTTCAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved