Erinaceus_europaeus Locus Mono:165:SNORD60
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:165:SNORD60
Erinaceus_europaeus
Mono:165:SNORD60
scaffold_225424
SNORD60
1001..1082
1815
CACCCTGCATTCCTTGATACTATGGCCCATCCTTTTATTATCTACATATCAATCTTCTG
CTTTGTCTAACAAATGACTTAAGACCTCCACCCTATTCCTCCACCCATTCTGCTCATTTA
ATATATTCTTTTTCTACCCGCAAGGACACATTGTATTATTAATTCTACCAGTTAAACCCC
TAGCAACAGTTGCTACCTTTCCCAGCCCCTTTTCACCTTTCTCTGCCCCTTTCCTAACCA
AGGAAACTTCCGTTTCTGACTTGGCTCTTCCGTTTTCCAGCCTGGAGAAGCACGCAGGCA
GACAGCAAGGCTGACGCTAGCCATTGTGGTTTGCGCCACGTGGCTTATCTAGGTGTGTTA
TGGCTCAACTCTGGGGATCTCAGATGAATAAAGATTTGAACATCCTCACTGCCACAAGCT
TGGTTCCTGGGTTATCTCTCTTTCTTGCATCACTAGCCCGAAATCATGTCTAGCTTTGTG
GCAGAATTTGAATTGAAAGGCATTCTGAAAAATTTGAGGGCAATGTATGGGACAGCTGGT
AAAGTACACACATTGCAGTGCACAAGGACCCAGGTTTAATCCTCTGGTCCCCACCTGTAT
GGGGAAGCTTCATAAGTGATGAAGCAAGTATGCAGGTATCCCTGTTTTTTTCCCTGTCTA
TCTACCCTTTCTCAATGTCTCTCTATCCCTATCCAATAATAAATAATAACTTTAAGCAGT
AAAAGAGAGAGAGAAGCCTGTCACGAGTCTCTTTCATTTCTGACACTTTGTATGAGAACT
GCATGTGCAGTCTGATTTGCAAACTTCCCTAGTCTAGACAACATAAAAGACATACAGGTT
CAAGAATCCCAGAGGGTCCCAAACAAAATTAACCCAGACTTAAAGATACCAAGACACATC
ATATTTAGAATGGAAAGGAATAAGGATAAAGAAAGGATCCTGAAGGCTGACAGATGCATG
AGAAAAACAAAGAGTAATCTACAGAGCAAACCCCATAAGATTAGCAGCAGACTTCTCCAC
ACAAACACTACAGGCCAGAAGAGAATGGCAAGATATCTATCGAGTGCTCAATGAGAAAGG
CTTTCAACCAAGACTATTGTATCCTGCTAGACTGTCATTCAGACTAGATGGAGGCATCAA
AATCTTCTCAGACAAGTTGAAAGAATCAACTATCACCAAGCCTGCCCTGAAAGAAGTTCT
GAAAGTTCTCCTATAAACAGTCAGACCACCATAAATATGCCATGTAGCAGAACACTCTTA
AAAATCTACAGGGAATGGCGTTAAAATACCATCAATTTGATAATCATAAATGTCAGTGGG
TTGAAATCACCTATTAAAAGGCACAGAGTAAGGAAGATGGATCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved