Erinaceus_europaeus Locus Mono:148:SNORD74
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:148:SNORD74
Erinaceus_europaeus
Mono:148:SNORD74
scaffold_377188
SNORD74
1001..1075
2075
AAAGGCAGATGATCTAAAAGAAAACATTTCTGAGCTGAAGCTGGTCAGTAACCTATCCT
CAAATGATGGATTTTAAAACATATCGTCAAATCTAAAGCTTATGAGAATTTTATTTATGT
CTTGGTTTTGTTAGTTGTTTCTGTTTACATTGATTGGTGAATGCAGACTTGTTCTGTCTC
CTTAAATGTATCTATTGGCTTGTCAGAAAGTCATGACACATTGTTGCATAGAAAAATATG
TGATGACTTTTCCAAAAACTCAATATAGCATTAATTTGAAAAGAGAATAGCAGCTATACT
AATACCTTACAAGTAATGAGTATTTATTGAACAAAAAACCTGATATATTTAATATAATCA
TACAGTTTTTCAAGCATTACACTAATTATTATTTTATTTGATTCCTACAAGTAGCTAAGG
AAGAAAACAAGTATCACTGGCTCTATATCCCTGACTATAGCCACTCAGCTGACAAATGAT
TAAGCCAGGATTTAAACTTAGATTACATGAATAGTCATTCCTTGACCCTACCAAGGATAG
AATATGTTACCTTTGGGGAAAAAAAACAACTACTTTAAGTTGATGGTGGTTTAAGGAATG
TTGCAAAAGGAGAATATAAGAACTTATGCCAGAATGATAAATTTGGGCCAGCTTATAGAG
GGCCTTGAATGTCCAGTCACTAAGTCTGAACTCTACTCCAAAAGCAAAGTAAAACCATTG
GAAGTTTTTAAGCAAGAGATAAGTTTTTTCCTTTGGAACATCTATATTTATTCCAGATGG
ACTGCAACTAGGTGACAGTGGTAGCAAACAGGTATTTCTTCCTCAGAAAGAAGATAAAAC
AGAAGTTGAGATACAAGGAGCATTTGAAGTGGGTAAAGAAGTTAGAATATTGTGCTCAAA
AGTTTTGGCCCTTTTTAGTCTCAAGGAATGACTCCTAGTGTGAGCAGAGACAGTAAAACT
GATAATCTGTTGAGAGACTTCAGAATCTTTCATATAATAAGAAAATACGCCTCTGATTAA
GTCATTATTGGTAGGGACAGCTGAGAGAGAAAATAAAAGCACATAGAGAGCAGTTAGGAC
TTACCTGATAACATGAATCATGATGGCTCAAACTGATGAAGAGCTGAAACTTTTAACAAT
ATAGTTAATGTGATGGGGAAAATGGATAACAATGGGATAAGTAATTATACATTTGAGGGA
TTGAACATGCTCAATTAAACATGTAAACTAAAAATTAGGGTGACTTTAAGTCTACCCTTG
TGAGATAAAGTTAAGGACTACAAAAGCTGGGTAAGGGCAAGAGACAGACATACTTTAATG
ATGGCCCTTTTGGTCACTACCAGGCCACCCCATTACTGGGGCTCTAGTCAGGGAGTCCTT
AGATTCCCACATAGATATGATAGGGTCAGACCTCTAACAGATCCTTCACTCTACCACCAC
TGGTCACTTCCATCAGGAACATCATCATACTCCTTCTTGTGAGCAGCCTAGAATGTTCCT
AGCTATGACCATGGACTGTGAGCTCAGATTGACATGGATGCAGAGGTTACACAGGCTTTT
GTGCTAAATATGAATAGACATGGGCACTAGGTCAGCCGATGAGGTTTACAGTTAATGGTA
GTTATATACTTTCCCCATATTTGGGAGCTATTTTCTGTCCTGATCCGGTTATCTAGTCCT
ATTCCCAAGTCTGACACCATCTTTCATCTGCATGTTAACTATTGGGATAAGGAAAAAACT
AGTAAAGTCATGGACCCCTTGGAATATACCTAAATGATCTTCCTAGCTTCTTCCCACATC
AAGACCCTTAGTTCCATCTTCACTATTCTTATTTTTAGGTTTCTGATTATTAAATACTTT
TTTTCTTTATATCTTACTACTTTTCAGCCACCAAAGTTGCAGATGCTACCATGATACCAT
CCTGACTTCCCTGAGCAGACATCCTCACCAATGTGTCCTAGAACCTCACCCCTCCCCAGA
GCCCTGCCCTACTAGGGAAATATAGAAACAGGTTGGGGATATGGACTTGCCAATGTCCAT
GCTTAGTGGGGAAGCAATAAGAAAAGCCAGACCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved