Erinaceus_europaeus Locus Mono:80:SNORD49
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:80:SNORD49
Erinaceus_europaeus
Mono:80:SNORD49
scaffold_337144
SNORD49
1001..1072
2072
CAGCCGTTCCCCCACCCCTCCCTGCCCCCTTCTCTCTAGTTTGTTCTTATGCCAAAGAA
CAAACTGGAGCTGGGTGCTGGCACTATGAGTCCACTGCTCCAGAAACCCATTTTTCCCTT
TCCTTCCCCTCCCCCCTTTTTTTAGATAGAAATTGAGTAGTGGGTGAGGTAGAGAGGGAG
AGACACCTGCAGACCTACTTCACTCAGGAAGCTTCTCCCCTCCAGGTGCAGAGGTGGAGC
TCAAACCCAGATCCCTGCACGCTCAACCAGGTGTGTCATGAACAGGCCCTGTGTGTACGG
TCTCAACATTGGGATTTAGAAGCCGTGACAACATTTTCTGTTTAATAATTATCTCTACTT
ATTGGGTAGAGAACCAGAAATCAAGAGGGAGGGGGAGATAGAGACAGAGAGACACCTGCA
GCACTGCTTTCCCCCTGCAGGTGGGAATGGAGGCTTGAACCCGGGTTCTTGTGCATTGTG
ACATGTACGCTCAACCAGGTATGCCACAACCTGTCCCTGAAGCCATGACTTTTTATTTTT
TTTAAGCCTCGAGCTTTTTAAACCTCTAGCATTTTTTATGTTCCCTTTGCAAGCTAAGAA
ATTATTGCCATAGTCAATATGGTCTCTACTGATTTGAAACGTCATCATGTATCCTGGGAG
TAGTTCTAGCTCACTGTCTTCTGTTCATCTCTAATCTACTACTACATCTTAAAGATTTAT
TCACTTGTTTCATGAAAGAAACCAGATCACTGTTCTGTTCCAGCACATGTGCTGGGAATC
AAACCTGGGTCTCACACATGCAAATCTGCACTCCACCCAATGAGCCACCTCCATGATCAT
CATTATTACATTTTAACTTTCACTTCACATTTTATTTAAATAGCGAGTAGCCGGGTTGAT
TCATAAATCTTTACTCCTTCAATATTTTCTTGGCTATTCTTTGATAAACACAATTCCAAG
TTGGCTTGTAACTTTAAAAAAAAAATTTTTTTTTTTAAGTATGCTCTGATGAAATCACTC
ATAGGAAGTGCCGTCAGATGCAAAAAAAAAAAAAGTATGTTGTGATGTTCACTTCTTGAT
CACATCTAGGAGAGAGATTTCTCTATCTGCTGGGGTGTATTTCCTTCAAACATGTTCTAT
AACTAGTTGTACAAAAGGATGTGCCACACAGGGGATCACAGAAGAAACAATATGCACAGG
AACATTATTCTGTAGTCTTAAATTGGATCCTGGAATGTTGTTTGTTACTTTGAACATGTG
TTTCTCTTCAGGGGAAAGCTTGTTTTGAAAGAAAGTTGCTCTCCATGTTGTTTTCAGGGT
AAAATTGAAAGGATGTTTTCAGTAAGGACAGCCAAATATTCAGAGGGTCAGTGAAAGGGG
GAGATTTATTTGTGTTTATTTTTAAACTAAACATGGTATGAATTTCAGTGTTGAGATGAG
CTCTATCAAGGACTTAATTTCATAGCCTTCGCATGTATCAACTCATGTCTGAATTAGGTC
TGGATTAAGTTGTGGGTTTTTTTTTGTTTTTGTTTTTAATTTTGGACAGCACCTGTAATA
AAGGAGAAAATTTTCAGACCTAAACAAATTCTTGAAGATGCTTTAATACCTAAAGTTTAC
CTTTTTAGTGCTTTATCTTTTCTACGTTGACATCTTTATGACTTCCTTCTTCAACATCTT
ATTAGGAAGAGTTACTCTGACCTCCCTTAAAAAAAAAAAAACATCACCTGGGGGAGCACA
GCGGGTTCTTCTTCTTCTAGCATTTGCCCTTCTTCCATAGCCAGTCAACAGCGTCAGGTT
GAGCCTGATGTAAAGTTTCGAGACCTCCTTTGAATCTGGAGAGGTAGCAGTCGTTGACTA
TGTGGGTCATAGTCTGTCTGTAGCCGCAGGGGCAGTTCGGGTCGTCTCTGGCTCCCCAGC
GATGGAACATAGTGGCGCACCGGCTATGGCCTGTTCGATACCGATTGAGGAGAGCCCAAT
CATAACGTGCTAGGTCAAAGCCCGGTTGACGCTTGCAGGGGTCTGTGATGAGGTGTTTGT
TCTTTACCTCAAGAGTCTGGAACAGAGAAGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved