Erinaceus_europaeus Locus Mono:305:SNORD24
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:305:SNORD24
Erinaceus_europaeus
Mono:305:SNORD24
scaffold_8233
SNORD24
1001..1076
2076
AACCGAAATATCATTGACACCATCATTTCTTTGATGATTGAGACTGACACATCTTGTGC
ATATTTTAAATCTTTCTTGTTGTTCCCCCAACATCTAGATGGATACTTTTTAAAAAGGAG
GCACTTGAAGGAAGGAGTGGATGAACGAGATTGATTTAAGACACATCTCAGTTCATAGTT
CTTTAGGCTTCGGAGAATTTTCTTTTTCTTTTTTTCCACTTATTTCTGGATTCCTGGAAA
AGTTCCACACGAAGGAGATTACCCATGAAGAAAGACATTGGTCACTCTGACATCCAATGC
AAGTGAAAGAGCAGGACAGCTCTGAGGCTCAGCTAGCTAGAGGAGGCTGAGCGTGCCAAG
CCTTAATTAGGGTCACCGTAACCTAGTCATTTCCCTGCTCTGCTGCTTTGGAATCATAGC
TACTAACTTGTTGCTTTTCTTTCCAGCAGGATTTTATACTTAAGTGTATCCAGGAATTAT
CCAGGAAACTGCTAGTCTTATTTGTCCTTTCAAGCTGTTATTTCAGGTTAAATCTATAAA
GTCAAATTATTAGAGCAGTAACTCTAATCCTGCCAATTTTCTCTGGCCTCATGATAAATA
ATACTATAGTGGAACTCTAAGCAGCTCCTCTAAAGAATTGGAGGCTTTATCAATTTGAGG
TATTTTTATTGCTCTTGACTGTGTAGAGGAGGGAGGAGGAGGAGGAAAAGTCAATTAAAT
AACTTTGTCATAGGGCATTTCGAATAAGACTTTCAGAATATGCCTTCCACATTTCTTTCA
GACGACAAGCACATGTAGATACATACACTGATGTGGAGAAGGCCTTAGAAAATTTTATTT
AGTTGAAAATAAACTTCTGGATCATCATTTCTCAAATAAGAATTCTCTGTCTTCTTTATA
CTGAACAGAAGCAAGGGAAAAAAAATCACGAAAATATTTTTGACCTGGGAACAAAAAGAG
TGAACACTGTCTGCTCTATGTTGTATTAAAAGAGAGCAGTTTCACAATGATGACAATTTA
TTTGCTACTCTTGCTTATAAAATGATGAGAATTAATACCACAAAAAGGGGGAAGGGGTGG
GGGAGCTGTCAATTATCAGAATGCCCTAAGGCTGCCACTTCACTTCTCTGTTAAGTAGTG
CTCTACTTTTCTCTTTGTTTCTTTTAGTAGATGCCACACACTTCAGGATCCCACTTTACA
TACAGTACAAGATGTGCAAAAACTTCAGATGATTCAGGATGATGGGTCTCACGGATGACA
GATGACACGTGTGTTAAAGGAAGGCTGATCTCTTGGCGTGGGACTACATGCCATGTCCTC
CTCCACCCGATGGTTACACTGCCAAAACTTTTCTAGGATCTTGGTAACTTTGAATTTTCT
TTCTCCTAAACTCCCTGGACCACCAGCTTAATCTCTGCACACCTCAGTTTCCTAATTGGT
AAAGTAAAGTGAGTAACATGTACCTCACAGTATTGCTGGGAAGATTAAATAAAGCCATTT
TTTATATGTTTCATATAATAAGATTAGGCTTGTCTTCCTGTATTATACAACACAAAATAA
CAGTGGACAACAGGGTAGAAATCTATTTCTGACTTAGACTAAAAAAAAAAAAAAAAGTTG
CAGGCAAACCTTCAGAAATTGCAACCCGGATGCCTTTCCTTGTGTCAGAGCCCCACACCA
CCACCCCACCCCCTTGTCCCCTGCGCCTGGGCTATTACAGGGTTCCACACACCACCCTGT
AATATTTCTCTGCCACTTGGCTGTCCACTCAAACTTTTGTCTACCTGAAGAGTTTCTTCC
CATTCTCTACTATGCACTGTCCATTTGAAGAGAAAAATGTCATGTACATAGAGATAGGAG
TGGCTGATGGGCTTATTGGGTCTGTGTTTTTATTGCTCAGATTGTAAACCTGGTGCCTCG
GCAGTGAAAGTCGGGCCTAGCTAATGGCTGTGTCTGGAGAAGAGGTTATGATGACTTCAA
TGCCAATAGAAAGGCCACCTGGGGGAGTTGGGCGGTGGTGCAGTGGGTTAAGCGCACGTT
GTGCAAAGCACAAGGACCTGTGTAAGGATCCCTGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved