Erinaceus_europaeus Locus Mono:403:SNORD58
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:403:SNORD58
Erinaceus_europaeus
Mono:403:SNORD58
GeneScaffold_7436
SNORD58
1001..1066
2066
ATTTGCTTGTCCTATCAGCTTTTCAAAGCCTAAGTTCTCAATTGAAATATTTGGCTTTA
TTGGCTTCCCCCTAATTCCAATGTCTAAACATTGACATTGAGCTGTTTTCATGAGGAAAG
CATTCTCCTGACACGCCTTTGGTCAGATAGACAGTTGTGTGAACTACTTTAGAATCTTTG
CTGTTTCTTTTTTTTATATTTTATTTATTAATTAATGAGAAAGAGCCAGACATCACTCTG
GTACATGTGCTGCTGGGGATTGAACTCATGACCTCATGCTTGAGAGTGGTGCTTTATCCA
CTGCACCACCTCCAGGACCACTGCTGTTTTTTTTTTTTTTTTTTTTTTTTTAACATTCCT
ATTAGAGAGAAACACCGAAGCACTACACAGCTCTGTCTTATTGTGGTGTGGGGGATTGGA
AACCTGGGACGTCTCTGCAGCCTCAGGCAGGCATGAGAGTCTCTCTGCATAACCATTATG
CTATCCTATCCCTGCTCTTTAGAATCTTTGTAAAATGAAAATTTCCCACGTTTATCATAT
TGGGGAGACATATGCCAAGTCTTAGAATTTAAAGCAATGATATGTAGTAAACTTAAGAAT
ATTTGACACAGGAGTTTTTGCAGTTTGGACTTAAGTAGATTCATGTTTGTTTCAAGGATT
GTTTTTCAAAATGTCATGGGTGGTGAATGACACGGTTTTTTCTCAATGACAGTTTATGGT
ATTAACCAAGTATTTTGCTGTCCTCACCATTCTAGGGCCTAGATGTAGATTCCCTGGTCA
TTGAACATATCCAGGTGAACAAAGCCCCGAAGATGAGGCGCCGAACTTACAGAGCTCATG
GTCGGATTAACCCCTACATGAGCTCTCCCTGCCACATTGAGATGATCCTCACTGAAAAAG
AGCAGATTGTCCCTAAACCGGAGGAGGAGGTTGCACAGAAGAAAAAGGTGGTTACTTGGT
TTTTACTTAGTTTCATTTGTATAGTGGTACCAGGTTTTAGGTTGCTGTGATGACTAACTT
AGGACACCTTTGGAATAACCGTGAAAAAGAAAACTGTTCTGAGCAACCTTTTAGGCCTTT
TTAATTTATTGATTCATGAGAAAGAAGCAGACATCACTCTGGTACGGGATTGAACTCAGG
ACCTCATCATACTTGAGAGTCAATGCTCTATCTACGCCACCTCCCAGACACTTTTTTCTT
TTAAATCAGGTCACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved