Erinaceus_europaeus Locus Mono:485:SNORA19
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:485:SNORA19
Erinaceus_europaeus
Mono:485:SNORA19
GeneScaffold_5776
SNORA19
1001..1141
2141
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTAAAACAATAAAGATGAGGAGAAAAATCCTATTTGTTTACGATC
ACTGTGTCTTCGGACTTTGCTAGAGGTACCTTTAAACTCTTGGGGCTGTTGTCGAACTTC
CATGACATGCTTTCGCCTTAGCTCTCTTTCTCTTCGTTTTATTATATTCCAGCTGATTAG
TGAGCTCAGTTTGATGTTGCAATCTGATCAACTCACAGCGCATCTTCTGAATTGTACTGA
GGTGGCGAAACTCCAGTTCTTGCATGGACTCATGCTGTCGCAGTAGCATGGCGTGCTCTA
AGTCCTTTTGAGTCTGCCTTTTATTTAACTCCTAATCCGTAACACATACAAAAACACAAA
CAAACAAACAAAAAAGAAAATAATTCATTGCTACACAAAATGCCGAGGAAAAATTCTGAG
AAAAAGAATAATCAGCAAATAGGTGTAACACTCTGACTCAATAATGGTTGCATAGTAAAT
ATTAGTTTTGTAACATTTACTTTAGTAAATGGGCAATTAGTAATATATTATCTTATTCTA
TTCATTATTACTATTTTATACAAAGCTAAAGATACAGAAAATCTATTAAAGAGTGTTAAT
GCATTCTTTCCTTTTGTTTTTAATTTACTGTCTTTTTTTTTTTAATACTATGAACCAGAC
ACCAGGGAAAGACTGAGACAAAATCTGTCATTTCATATAATTTCCCTTCTTTAGTGGAGA
TGACTTCACACCAATATAGTGTGTGTGAGAGAGAACAAAGATTTGACTAGGGAAGGCATT
TCTGAGGAGGTGACATTTGAGAAGAGACAGACCAGGTAGCTACCTGAGGAAGAGGGATTA
AAGCAGAAGCAACCACAAGTACAAAAGCCCAGAGGCTGGGTTGTGACTGACATATTTTTG
AGAATGATTATGATTTCATATCATACAAACATATGTCTCTGGTGCACATTTCATTGACCT
GCTTTCTTCTATCTGTGTGAGCAGTCTTATTTTTATGTGCTATACAAACAGATGAAGGTT
CGAACATTAGCAGTATATCTAAATAGTTGTGCTTCCATGCTGCCAGTCTCCTTCAGATAG
TTAAAAAAAAAAAAAAAAAAAAAAGACACTGGTGGTCCAGGAAATGGTGCAGTGGATAAA
GCACCGACTCTCAAGCATGAGGTCCTGGGTTCAATCCCCAGCAGCATACGTACCTGAGTA
ATGTCTAGTTCTTCTCTCTCCAGCTATAATTCTTCATAATAAATAAAATCTTAAAAAAAA
ACCTTTTTCCTGGATAGGGATACATTTCAGTAGTATAGCATGTGACCTGCATATCTGAGG
CTTCAGGTTCAGTCCCTAGTACCACATGTGCCTGAGCTGAGCAGTAGCTGAATCTTTCTC
CCTCGTTCTCTCTCTTAGAAATAAAATCTATTTATCTGTGGATAGAGACAGAAGTTGAGA
GGGAAGGGGGAGATGGACAGCTGCAACACTGCTCCATCACTTATCAAGCTTCTCTACTGT
AGGTAGGGACAGGGGGGTTAAACCCAGGTTGTTACACACTGTCATGTGTGTGCTCATCAG
GTGTGCTACCACATAGTCACCAGACATAAAATATTTAAAAAAATAAACAAAGTACCTCTC
TGACAAGGTCCTGCTCCAAGTTATGGCGCCCAAGTAACATTCTTCTCTTAAAGCGACGGC
ATTCCAGTTCTAAATATTGTCTCTGACGTCGGAGAAGGTTAGCTTCTTCTTCTGCTTGGA
AATGCTGTATATTTTCCTTTTGCTTTGAAAGCCACTCTTGCTTTTCTTTTTTTGGAGTGC
TCTGGTTTTCATTCAGTTCCTACGAATAGAAAAAACAAATTCAATTATAAATACATGAAT
ATTAACTAATTTAGTATTTGGAAACTAAACAAAAAAAACTTAATTTGTGGCTTTGGAGAT
GGCCCAGTGGTAGAGCTTTGGACTGGTGGCACAGTGGATAAAGCACTGAACTCTCAAGCA
TGATGTGCCGAGTTCAACCTCTGGCAGCACATGTACCAGAGTGATGTCCTCCTGTTCATT
CTCTCTCATCCTATCTTTCTCATTAATAAATAAAAAATTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved