Erinaceus_europaeus Locus Mono:209:SNORD47
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:209:SNORD47
Erinaceus_europaeus
Mono:209:SNORD47
scaffold_344367
SNORD47
1001..1076
2076
AGAAGGAAACATTCATGAGTGGCTGAAGTGGAGACGTAAATAACCGGGTCTCTCAGATA
CTCTCCCTCACCCTGATATCCTCCCGCTCAATTTCTGCGTCTATCCCATCAATAAGTGAA
TTAAGCGAATTTTTAAAAAATACATATTAAATTACGAATTTTAGTCTATGTTCCTAGAGG
GGGGGGAAATGTTGTCGAAAAATGAACAGAGGCTCTGAATCCCCATTCTATCAGGANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGC
GGTGAAGCAGGTTCTGCAAGGTATCTGTCTTTCTCTCCCCCTCTTCTGTGTTCCCTCCCT
ATCTACATTTCTCTTTGTGCTAACCCAACAATGACAACAATCAATAACACCACTAATAAA
TAATTACACCAATAAAATAACATGGGGCAACAAAAGGGAATAAAATATTTCTTAAAAAGA
GGGAGTCTACTGTTGAATGTAAAACATTAATTCCCCAATAAAGAAATAAAAAAAAAAGGG
AGTCAGGCGGTGGTGCAACGGGTTGAGTGCACATGGCGCAAAGCACAAGGACCGGCATAA
GGATCCCGGTTCGAGCCCCCGGGTCCCCACCTGCAGGGGAGTCGCTTCACAGGCGGTGAA
GCAGGTCTGCAGGTGTCTGTCTTTCTCTCCCCATCTCTGTCTTCCCCTCCTCTCTCCATT
TCTCTCTGTCCTATCCAACAACAATGACATCAATAATAACTACAACAATAAAATAAGGGC
AACAAAAGGGAAAATAAATAAATATTAAAAATAAAGAAAGGAACCAGTGATGCACTGATT
CTGCCAAATGAGTAAAATGATATCACATACTAAACCGTTCCATTTTTCTCTGAGGTTACT
TAAGTAAAAAAATAAATAAATAAATAAAAAGAAAGAAAGGAAGAGAAGGCAGGACCATAG
GGAAAATGGGCAAATCTATATAGACAGAGATAGATGACGGGTGGCTTGTGATCTTGGAGA
ACAAATGAAACTTCCAATGGAGGGAATGGGACACAGAAGTCTGGTGGAGGGAACAGTGTG
GAATTATACCCTCATTATCTTATAATTTTGTAAACCAATATTGAGTCACTCATTTAAAAA
GCAGTCCAGGGATCTCATCAAGCAGAGCGACCTTGGGGGGCTGGGAGTAGGCAGCACAGG
GTCCGAGCCCGGCTGTGTGGCCTCAGTGCTGAGGAGCTGCCACCTGGACACACGGGCTGC
CACGTGCCCTCTGTGGGGACAGCAAAGCCTGCTAAGCGGACAGCAGTGGCACGCCAGCGA
GGCCTCAGGGCTGAGGGCGGCCAGGCAGCCCAGGTCACCAGAAATAACACACAGGGTGCG
GGCACAGCCTGGGTACAGGCGGCTGCTGACCCCACTCCCCAGACGGAGGGCCCCCGGGAC
ACCAGCTGAGGGTCCCCCGCTGCCCCCTCCCACCCCACAGCCTCTAAAAGGCGGCTGGCA
CAGCGGGGGTATGGCACAGGACTGGCACACGCAGAGGCCCGGGGACACATCCCCCGTACC
CCCAGTGTTGAGCAGTGTCTGGGCAAGAATATTAATAAATAAAGTGGTTGGGCAGGGGGA
GACAGCATAATGGTTCTGCAAAGAGACTCTCATGCCTGAGACTCCAAAGTCCCAGGTTCA
ATCCCCCGCACCACCATAAGCCAGAGCTGAGCAGGGCTCTGGTGTTTCTCTCTGTGTCTT
TTTCTATCTGCATCTCTCTCAAAAATAAACAAATACTTTTAAAAATAAATAAATAAAGCA
GTGGGGGTGTCAGTGTGTGTGCAAGGACCCAGGTTCCAACCCCCGCTCCCCACCTGCAGG
GGGTATGCTTCACAAGGAGTGAAGCAGATCTGCCACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved