Erinaceus_europaeus Locus Mono:348:SNORA33
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:348:SNORA33
Erinaceus_europaeus
Mono:348:SNORA33
scaffold_341782
SNORA33
1001..1129
2129
CCACATTCTGATTTTCACAAGCAGCAGTAATACCTCTCCTAGAGTAAATTGTAAATAAC
CATCAGAATACCTCAATGCTGGGGGTGTCACATCCCATGGTTATGTTACAAAACTTTTGG
ATCTCCATATTATTATCAGACTCTCTCCCCCGTGGGCTGTGCCAGAGTGAGCAGCTAGGC
TGAGGACACTCATGTTAATACTACAGGGAAGTCAATATAACAAGGGACTAAGAAATACCT
CCACCTAAAAGCTAGTGAGGAACTGAGGCTCTCATTCCAACACCCCAGGCACTGAGTCCT
ACCAAGCCAAGTAAGGGAGACCAGGAGACTATTAACCTCCAGTAGACCTTCAGATGACAC
CCTGGCCCTGGTTGACACCTTGAAAGCAGGCTTGTGAGACACAGAAACTGTGGACCCAGC
CAAGTTGTGCCTGGATCGCTGACCCACAGAAATGAGGAGACTGTCTTAATGTGTGTTGTT
TTAAGCTACTTAAGTGTGTGGCTATTAGCATCACAGCCACAATAACTATATCTGTGTACA
GATTACAACTCACAAGAATCTGGTAGGACCCAGTAAAGCACACATGACATCATGTATGAG
GACCTGGGTTCAAGCCACCATTCCCATATGCAGGAGGGACGCTTCAAAAGCAATAGAGAA
AGCTGCAGGCATTTCTCTGTCTCTCCCTCCTTCTCTCTCTCCCTTTTTCTACCTCCCTAG
TTCTCTCTCTCTATAAGAAAAATAAAAAATTTCCCAGAGGAGGCACATCCTGTAAAGCAC
ACATTCCAGTGTGCAAGGACCCGAGTTCAAGCCCCTAGTCCCCATCTGTACCACAAATTT
TGAGGCAGTGTTAATTCTCTCTCTCTCTCTTTCTCTCTCCTCTTCTTTCCCTCTCAACTT
CTCTCTATCTATCCAAAAATACATAAATAAAACAAAAAAGGAAAAATGGCCCCACAGTTG
GTAGGTATTATCACTGGATCTACCTTTAAAAGTGCTACTTTAAGCCAGCCAATGAATCTG
CTTACCTGATTGTGTTTCTGCAGAAATTTTTTATAACTGGCGATAGCAATGCCATGTTAC
AAGCCTTAATGACGTTAGGGTCTTTAAGGTCCCTGAAAGTGCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGAGCTGATTTTCTCCCTCCTTCCTCCTGCCTCTTCCTTCC
TCTTCCCTCCTTCCTTCCATGTGAGGATACAGCAAGGACATGATGTAGACTCTCACCAGA
GACTGAATCTGCTGGTGCCCTGATCTTGACCTTCCCAGGCTACAACTGTGAGAGATACGA
CTTCTCTCCATGAGCAATCCAGTCTATGGCATTCCCTGACAGCAGGCTGAAAGGTTGAGT
GCAGTCCCGCACACCAGAGAATCTTCTCGAGCTTCACCTTGATGGCATTATGCCATGTGC
CAGACTTGGGGCTAAATGCACTGGCAGGATTATCTCATCAGAACCATTCCAAGTCTCCTA
AAAGGTGGGTACTACTATCGGCTGCCGTTTTCAGGAGGTGCTGACTTACTTGTTCAGGCT
CACACAGGTGGAAGGAGTACGGCTGGGATTTAAGCTCACCAGTCAGATTCAAAAATCCTC
ACTCTTCATACTTCCCTCTGGCCACAAGGAATTTTTATAACCTCCTCCCTGAGACAAAAC
TCTTATTCCAATTTCGTCTTAAAGTCCCAGTCTCCTTCTTTTTAAGGCTTATTTTATTTT
CAAAAATTTTAGAGAGAGAGAGAGAGAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved