Erinaceus_europaeus Locus Mono:126:SNORA31
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:126:SNORA31
Erinaceus_europaeus
Mono:126:SNORA31
scaffold_227707
SNORA31
1001..1127
2127
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGCATTCTGAC
TTCTAAAAGGGAATTAGGAACAAGATTGAAATGACATTAAGGCAAACTGGTCTTGTAGTA
AAGATGGTTTGTCATAGGGTTTGAGAATCTCTGGGCTTTTGTTGAACATATTTAAAGAGT
TATTTGACAGAATGGTCTTTTTCTTAAGCATTTGGTTAGTACTGCATCCACTGATAGACC
TTTGAACAGTTTCCTGTTCTTTGGTTTGCACTAGGATGCAAGAGGAAAAAATCCTTGCGC
TTTCTGTCTGTCTTTGTGGCAGCCCAGATTGAATAAGGGATTACATCTGCAGCCTAAAAG
TGTTAACTGCTTTCACGGATGCCAAAAGTTTAATGCAGTCTTCGTTGTTTTTACAGTAAC
AAATTTGGCAGTTACTTTGGATCTATCACCTGTCATCATAATTGGCTGTTTGTCATCTAC
ACAACACCAGGACAAAACGGGACTGATGTCATCTTGGGCTCTTCGTTTATTTTTGACCTT
GATTTATTTGGAGCGGAGGCATTGTTTTTAAGGAAAAACATGTCTTGTTAGGTTGTCTAA
AAAATAAAATGCATTTAAACTCATTTGAGAGAATGCCTCTTAGTCTGATACCTATTTAAA
TCCAGTCCTAATAGTTGCTGGAGAGACTAGAGCCTGGTTGCTAGCTTGTACTAGAAAGCT
TGAATGTCTTCAGATAACTTCTACAAACTACTTCTGGGACTGGAATATCAGAAACAAGAA
TCAAAAGTTAATTTTGAGTTGAAGTAAAGGGAAAAGACCATGCTCATAACAGTGCCAACA
TTTGAAGTGGATTCCTTATACATTTCATCAACTACAAATGGAAGTAGTTAACTGGAAAAG
ATTACCTAAAGAATAAAAAGAGACTAATACAGATGAAAGTGAAGTATTGTCTGAGCTTAT
TTATCACAAATCAAGTATAGAACCAAGTTCTGGAGAAATTTAGGCATCTGGAGTACTTGT
GGTAAAAACTACCTGAAAAGAGATTGGCAAAGTGACCTGTTCTGTCACCTGATTTTTGTA
CTACTTTAAGGTGGTGGTTGCATTTGTAAGAGCTTATGGGATATGAATCCACTTACTGAA
CATTGCCTTATTCTTTTATGGACTGACTGGCTTACACAAGAGCAGATAAAATAAAACATT
AGGGACAATCATTCCCAAAATATTCATGTGACAACCTTTAAACGAAAGATCCCTCACTAT
AGAAGATGGAACAGTGACATGGCTAAGGGGTAGAGAAAAGGCAACAGCTGCTAAACATGA
CAAGTCTTATCAGGTGAAGAGAATGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved