Erinaceus_europaeus Locus Mono:396:SNORA32
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:396:SNORA32
Erinaceus_europaeus
Mono:396:SNORA32
scaffold_355489
SNORA32
1001..1119
2119
TGAACAATGTTCTGGTTAAAAATGAAAACTAAAACAAGGAGTCTGGGGAGACAAAATAG
TTATGCAAAGAGCCTTCCTTGCCAGAGATTTTGAGGTCCCATGTTCGATCCCCAGTTTCA
CCATAAACCAGAGCTGAGCAATGTCCTGGTGAAACATGCGCACATGCGTATGCTCACGCG
CACACACACATTCTACAATATAAGAATAGATATGTAAGAGTTAAGAAGTTGGGACATTGC
TTATTATTTTTCACCAATATGAAGAATGTCATGGAATTTACTTTTTATTCAATTATGTCA
GTTGCTCTTTCTTTTGTTAAATATTTATTTTCCCTTTTGTTGCCCTTGTTGATTTTTATA
GTTGTTGTAGTAGTTATTGTTGTTGTTATTGATGTTGTCGTTGTTAGATAGAGAGAAATG
GAGAGAGGAGGGGAAGACAGAGAGGGTGAGAAAGATAAGACACTTGACCTGCTTCACCGC
TTATGAAGGGACCCCCCCCTTGTAGGAGGGAATACTGGGGCTTGAACTGGGATCCTTGTG
CAGGTCCTTGCGCTTCATGCCAAGTTTGCTTAACCCGCTGCGTTACTGCCCAACTCCCAA
GTTATATCAGTTGTTATAACTCGTCTTGTACATGGCTAGGTTCATAGCTCTCCAAAAGAC
AATAATCTGTGAGAGTTCTACTGGTGATGATGATTACTTCGTGTTATGTTACTGTTGTGG
TATTCTCTAAAGGTTTTAGCAGTCAGGAACTGATACTTAGAAGAAAAAAATCTAGAGGGC
GTTGGGCAGTGGCACACCTGGTTGAGCACACATGTTACCATGCACAAGGACTAGGCTCAA
GCCCCCTAGTCCACACCAGTTAAATGCAAGGACCTGGGTTCATTGTCTTGTTGCCTGCCT
GCAGGAGGGACACTTCACAAATGGTGAAGCTGATCTGCAGGTGTTTATCTTTCTCTTCCT
CTTTCTATATCTCTTTCCTCTCTCAATTTGTCTCTGTCCACAGGTCATTACCAAGGCTTT
TAGAATGTGGTTTCTCATTTGCTGTGGACATGACCTTAAAAAATGCCCACTAGGTTTGTT
CTCTGCTACATTGGTAGCATTCAGCCTTGTGGGAACATCTTGTGTTAGTGCTGGGCAGTG
CTAGTGCTGATGGAAACAGTCACAAGTATAGCCAAATTTGTGTGTGCTCTTTATTGTGTG
TACTGGATTCATTGCTGATGGTTCTTAAAAAAAAAATTGTCTCTGTCCTATCTAATAAAA
AGAAAGAAAGAAAGAAAGAAAAGAATGGCCACTGAGAATGGTGGATTTATAGTGCCAGCA
CCAAGTCCCAGTGTCATCACTGGTAGCAATACAAATGATAAAGTATTTTTAAAAATCTAT
ATACTTGGGTAGGGGCATGAAGAGACGCCAAACACTGTGCTAGCATCCTTTAAGTTCCGC
TTTGGATCTCCCCTTTTCCTCTTTGTCTTTGTTTTTTAAAGTTCTTCGTATGAGATCATC
CAGTCAGTATCCTTAGGAAAGGAATTGCTGGGTCATAGGCTGGGGAGCATTCTGAGATGT
CGCCAGACTGTTGTCTACAGGGGTTGGACCACTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTTGCTAACACTTGTGTCTGTCGTTTCTTATATCATTATATTTTTTA
AAGCTAACTAAAGATTTATCTTTGAAGTACTAATTTCCATTTCTCCACAGCCTGAAAAAA
TAAAAAGATAACTTTCCTATGTGGTAGAGTAATACACAGTAACAGCCTCCATAGATAAAG
ACTACTGAGAGTGATGGTGGAGTTGTGCAGGTACCGAACCCCAAAGATAACCCTGGTGGG
AAAGAAGGAAGGGAGGGTGGGAGGGAGGAAGGGAAAGAGAAAGAGAGGATTCAGTCTTTA
ATATACTATATTCCTTAAACAGTATTCTTCAATTTATCTTGGTCTTTCATAAATTTCTTT
TGCTTTTCTTACAAAGAAAACTAAAATTAACCAAGACTCTCCAGTCTACAGAGTTTACAA
AAGAGAAAGCACTTTAACGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved