Erinaceus_europaeus Locus Mono:371:SNORA2
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:371:SNORA2
Erinaceus_europaeus
Mono:371:SNORA2
scaffold_254655
SNORA2
1001..1138
1275
ATACACATAGATGTTTCCCCCTGGAAAATTGTGTATTATCACGTGTGATCCAGGCAGGT
TTCTATATCAGATACTACATTATAACCAGAACCCCACTATACTCTAAGCAGGCTCTGTTC
CTGTACCTACTTTCCCATACCTTTGAATAAAGCCTCAAATCATTAAATTACCATGCAGAG
ACCTAAATGAACACTCCTTAATAACTCTCCTAGTCTTTATCATTTTCTCCCCAACTCACT
TTCTGCCTCAGTTTTGTTCAGTTTAGTTCCTAGACATTGCTATCTTCTTTTACACTATCG
GGCCTTAGCATATATAGTTCTTTCTACTGAGAATTCTCTCATTGATTCTACTCATCCATA
TAAGGTCTAGCCTTCTTTCCTGTGTCAGTTTAAATATCACTTTCTGAGGAAGTACTTCTT
TATCCCCAAACACTAGGACAGGACCTTGCTAATATATTCTCATAGTTCCCATAACTGTTT
CTTCTAGTCTTCAAAACTACAACTGTTGTTTTATAACTTTAATGTCAATATTTCTTTTCT
TCTTCTAGCGTTTGCCAATATTTCTTGTTAGACTCTAAGGCACCTGCATGGCATCATTTT
GTCACTAGTCTATTATAAAACTCGATCATCTATAAAAGATGATATTGGGGGGCCAGGCGG
TGGTACACCCAGTTGAGTGCACATGTTCCCATGCGCAATAACCCAGGTTCAAACCCCCAC
TCGCCACCTGCACGGGTGAAGTTTCATGAGTGTTGAAACAGGGGTGCAGGTGTCTCTGTC
TCTCTGTCTCTATAAAATAAATAAATATTTTAACTTAATTTTATTTATTTTATTGTTTGT
TTGTTTGTTTGTTTTTTACCAGAGCACTGCTCAGCTCTGGCTTATAGTAATGTGGGGGAT
TGAACTGGGACTTTGGACCCTCAGGAATGAGAGACTCTTTGCATAGCCATTATGCTATCT
ACCACCACCAATAAATAAATATTTTTTAAAAGATGATACTGATGGCTCTAACTGAAGACC
AACAGCTCTACTATAGCTGTTGGTTTTATACAGATGCCTTAGAGGATTATCTTCCCATGA
TCTGTCGGCTGTTCTGGAACCTCAGTAGAGAATGGCTATTTCATTTGGAAGAGACAGCAC
ACAGCTCTCCCACTGAGCTATATATCAGGGATGCTATACATGATGGACTTCCAACTAAAG
GACAAAGATAGGGTCAAGTGCAGGTGCCTAGAGATGGCAACAGACTGCATGGATCTCAAA
ATTCCGAGAAAGTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved