Erinaceus_europaeus Locus Mono:233:SNORD75
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:233:SNORD75
Erinaceus_europaeus
Mono:233:SNORD75
scaffold_332465
SNORD75
1001..1060
2060
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTTATCTG
ACAATGGCGACATCAATAACAACAATCCCCAGGAGAGCGACAATAGAAAAAAAGGGCAAT
AAAAGGGAAAAAATAAAAAAAATAAGTAAAATATTAAAAATTAATTTGTGAACTATTTTC
CATTACTCAATTTAATATTTTTCACTACTGAAGTGAATGTTATATATAACTTTGCAATAT
ATTTTCAGTGAATGCCCTCTGGATGTTATCTATGTGTCAACTTACTTAGGCTTCATAACA
ACTTCATGCAGTAACTATTATCATCTTATTTATTTAGAGTGGAGGCTGAGAGGTTGACTA
CTTGTCCAACATTACGTGACTAGTATAACATATAAAGAGAGGTTTCGCCTATGCTCCAGA
GTACTTGCTGAAATCCACTGCTCTTTATTATTCAGGCAAGAAAGCTGAGTTTCAATTTAA
GCTCATTCCCAGACTCAGACAAGGCTACTGATGTGATTTCTTTTATTTACCTGATCCAAA
CTTGATTTCTTGAATGATCTGGGTTTTTCTTCGAAACTGTTCCAATCTGATTGCCTTCAG
TCTGGCTCTAAGTACCAAGTACTATGTGACCTCATCCCCAACCCACTGGAATTTTTTTCT
CAAGTTTCTTTCAATGATGAAGGTGTCAAAAATACAAACTAAGCCTATGGTGGTTTAAGA
GTAGTGGACAGAAAAGATTTCTGAAAAAAAAAATCCAAACTAAATGAACTAACCAACACT
GGAACTACGCAATTTTATTTCCAAGTAAGTGCACATGCTTTGACCTACTCAAGCTTGTCT
TCCAACAACCCCTGTTTTCTTCCTGACTCCTTTAAGCCTTGAACACCCCTTCCTTCCTTC
TTCTTTTCCATTTAACATCTTTCACTATCCTTTAGAGTTCCACTTTTGCAGATTCACAAA
ACAAAACTCACTTGTTTATAAGGGAATTTCTTTTATTTTTTTCTGTACCCCCAATGTATT
ATTATTATCAATTATTGTTATTATTAAGGTAATAATGGTTTTCAATATTGTGTATTTTAG
GGTTACAGTTTCACCACTTTAAAATGTTTATTATTATATCAATGTACCACCAGAGCATCA
ATATCTCTACCAGTGTCCATTAAAACCACCACTATACACCATTTCTTTTCATTTGCTCCC
CTAATTTTAAGGGTAGTACTTTTAAATTAAAATGTTATGATCAATAACTCTAATTATTAA
ATTTCATATTATCCTAGAGTTTGAAAATTTATATAACTGCTCCTCAAATTATAAGAACTC
TTTAAAATACCAGTATGTAAAGTCAGCTTTAGGAACTATATTGCTAAATCCAAATAACAT
TATTAATATGAAGGATGGCTTCAAAAAGCTTTTATTATCATGACACAAGACCACAGGAAA
AACTTAAATTATACATGAGACTGTATAGGTGATGGATATGGCTTTTGAGGAAAGGCTTAG
ACTGTACACACATATCTAATTTTATCCTATTCAAATGTTCAACTAAATGACCCAGGGGGT
CATGCAGTGGAGAGGGTCTTGGACTCTCAAGCATGAGGCTCCCAGCATTGCATGTACCAG
TACGATGTTCCAGTTCTTTCTCTCTTTCCCATTAGTAAGTAAATATTAAAATAAAATAAA
AAAATAATCATTTAAAAAAGACAAATTTTTCAGGAGATGTATATTCATAAAGACAGAGAG
AACAGTACAATTTTGGAAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved