Erinaceus_europaeus Locus Mono:180:SNORA19
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:180:SNORA19
Erinaceus_europaeus
Mono:180:SNORA19
scaffold_266695
SNORA19
1001..1110
1647
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGAGCATATAAGAGGACTTTATGGCCATA
CTTCTACTCTCCATTATCTAAGTGTATTAGTAACAGCACACCTTTTACATCTTCCTATTG
GGAAGTCACAACCATTGGAACTTCATGTTATGAGAAACGAGCTCTGCCATACAATATATG
TCATGGCAACCAACAGGAGAAATAAATAGAATAAATATAAAAAAATATTTGAAAGCAAAT
GTCAATTGAATAGATCATCCGTGGCACATCCGTATAGCGATATAGTATTCAGCCATAAAA
GAGAATGCTTTGACATGTGCTATGAAGTGACAACTCTTAAAAACCTAAAATCAGGGCTCT
CACCACCAGAGATGCAGCTTTAAAGAAAAAAAAATCATAGGTAATTATTTGAGGTTACAT
TGGTTTGCAAAATTATAAATGTCTTAGAAATGTAATTTCACACCTCTTCAATGCATGACA
CCTATCACTAAAGTACAGAGGTCCATTACACTAAAGTACCAAGGTCCATCACACCCCCCT
CTGTACTTGTAGCCCCTTCTCCCACACCCCAAACCTCTTCTGTACGTCAGCTTTGGTGTG
AGTCCATATATTTTTCTTTTTTTAATTTTTATTAGTGATTTAATAATGATTAACAAGATC
GTAAGATTACAGCAGTATAATTCCATACAGTTCCCACAGCCAGAGTTCCATTGTCTCATC
CCCTGCTCCATCAGAAGCTTCTCTGTTCTTTATCCTTCTAAGAGTATAGACCAAAATTTT
TTATGGGTGAAAAGGTGGAAGGTCTGGCTTCTGTAACTGCTTTTCCACTGGACATGGGTG
TTGACAGATTGATCCATACTCCCAGCCTGTTTCTCTCTTTCCCTAGTGGGGAAGAGCTCT
ATCTAAAGAGGTGAGACTGCGACACACTGATGAGGTCATCTGCCCAAGGAAGTCAGGATG
GTATCATAGTCATGTCTGCTGAAAGGTGGTATGATATAAAGCAGGACAAATTATTTAATA
AACAGAAACCCTCTTATGTGCTATACAAATAGCTCAAGGTTAATTAGCAGTATAACTAAA
CAGTCATGCTGCCAGTCTCCTTCACACAGTTTTATTAAAAATAAACAGGAACCCAAAGGT
AGAAATAAAACAGATGAAATTAGGGGTCTTCATGTGGGAAGAAGCTAGAAAGTCTATTTT
AGGAATACTCAAAGGGGCCGTGACTTTTGTAATTTTTGCCTGAGCCTGATAGCTAAAATG
CAGGTGGACTAAAAATACTGTCTGGGATGACAGTGTCAAGAGTTGAGAACAGGACTAGAA
AGCTGGACTAGGGGGTGCCAGGAGGTGGCACACTTGGTTGGGCACACGTGTTACAATGCA
CCCAGGTTCAACCTACCTGCAGGGGGAAAGCTTCACAGGCGGAGAAGCAATGTTGCACAT
GTCTCTCTCCCTCTCTATCTCCCCCTTTCCTCTAGATTTCTTTCTGCCTCTATAAAATAT
ATAAACAAATAAATAGTATACTTTAAAAGAAAGAAAGAAAGCTAGATTAGAGCAGAGAGT
AGCTCCCAGACATGAGGAAAGTATACAAAAACTATTGACTGGGGCCAGGTGTTGGCGCAC
CTGGTTGAGTGCCCATGTTACAGTGCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved