Erinaceus_europaeus Locus Mono:452:SNORA32
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:452:SNORA32
Erinaceus_europaeus
Mono:452:SNORA32
GeneScaffold_5275
SNORA32
1001..1119
2119
CAAATTTGTGTTCTAACAAATCCTAAGGTGGTGCTGGGTAATACACTTGTGGGGTCATG
TCAAGAGCACTTTAGAAAACTGTTCAGTATGAACTTGTTGCAGGGAAATGTCACAATATT
CCCCTGCCCAGCAGGTTCCTTCCTCAGCAGGCCCCTCCTAGAGATTAATAGAACTCATGA
ATAAGCAGAAGGTTTTCTTAGCAGTATTATTTTTAGGGCTAAAGTCTATATACAGTTCAG
TTATCTCCCAACAATAAAGTAAAAACAAAATCCATGGCAGGCTGAGTAGTGAGTAAAATA
TATATTAGACATACTTATATATAAACACTAGCTTAGGGAGTCAGGCGGTAACTCAGTGGG
TTAAGCGCAGGTGGCACAAAGCACACGGACCAGTGTAAGGATCCCAGTTCAAGCCCCCGG
CTCTCGACCTGCAGGAGGTTTGCTTCAGAAGCAGTGAAGCAGATCTGCAGGTGTCTATCT
TTCCCCCTCTCTGTCTTCCCCTCTTCTCCATTTCTCTCTGTCCTATCCAACAACGACGGC
ATCAGTAACAATAATAACTACAACAATAAAACAACAAGGACAACAAAAGGGAATAAATAA
ATAAATATTTAAAAAACACTAGTTTATAAGCTGGAATAACATGAGTGTCAAGGTTCCTGT
TGGAAACTTCCCTGAAGTCAATTCTGTAAAGTAAATACAGAATATTTGAATTAATCTTTA
AAGCTAGAGGAAAAGTACTTAAACAGTTTTGAACTTTCAGGAGAAAGGGTTAAAAATTGG
AGTCTTGTTTGTATGGAAATTAGTATTTACCTATTGGCTATTAATAGCACACTTTCATCC
CGAATATGTCCTGATTTGCACAATAAACCCATGAGTATGTTTAATTTTAGTATTCTTTTG
TTAGACCCTTGAAATATTAAAGAGTATTTGCAGTGATAGATAAATTTTAGACCTTTACAA
CAAACATCAGCAAATGGGTATGTAAAGAATATTTGTTCCTCAGGTCATTACCAAGGCTTT
TAGAATGTGGTTTCTCATTTGCTGTGGACATGACCTTAAAGAAATGCCCATTAGGTTTAT
TCTCTGCTACTTGGTAGCATTCAGCCTTGTGGTAACATCTTTTTTATCTTTACTTACTGG
ATAGAGACAGCCAGAAATCGAGAGGGAAGGGAGAGATAGGGAGATGGCAGAGAGACACCT
GCAGCCCTGCTTCACCACTTGCAAAGCATTTCCCCTGCAGATGGGGACCAGGGGATCGAA
CCAAGCTCCTTGCGCATTGCACCACCGCCCAGCCCCTAGTTGGAACATCTTAAAAAAGAA
AGTAAGAAAAGGAGTATCTTGTTCTTACACATATATGGGGGGGGGGGGGAGATACGAAGT
TCCAAAACCATCACATTTCTTCTTTTTCTCCCTTTCTCCACATATAAAAAGGCTTTGCCT
ATTTGGATTTTTGCCCCCTAGGTTACTACTGGGACTTGGTGCTTCACAATTCAACCATTT
CTAGTGGCCATTTTTGTTTGGTACAGGATAAACAACAGAGATAGAGAGGGAGAGACATGG
GAGGAGGCTTTGCCAATTTAAGGATTCTAGTGATTTGTCTTTTTTTTCTTCCTCTTCTCC
TTCCCCTCTTCCCTCTCCTCTTCTTCCTCTTCCTCTCACTAGAGCACTGCTCAGATCTGG
CTTATAGTAGTGCAGGATTGAACCACAAAGCTCACTCCCTCATCATTTCTACTTTTTGCA
TGATGCTATCTATACCACCCTTAGGATTCTGATGAAATTAATCCTTTCAAGTGCTTCTAC
ATAAAAAGTCAAGCTGATTTCTTAAGATAACAGTGGAAAAAATGACTGTCATGCCTACAA
AAGCAGTGTCAACATCTGCAAAGCCATCTGTTTTTAAAGTCTCTATCCCATTTCCACAAG
TCTTCATCATAGGGAAAGCTGAAATAATGCAAGAGAAGTGTGGGAAGGGTACAGAGAGAT
CAGGGATGGAAGTGAAAGTGAGTCAAAATGAGAAGAGGAAGAAAAACCTGTACTTCTTAA
CTCAAAAAAAAAAAAAAGCTTGAATTCCATAAGTACAATCTCCAAGTAAAACACTGGGAA
CATCAGAGTGTTCCCACACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved