Erinaceus_europaeus Locus Mono:479:SNORD113
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:479:SNORD113
Erinaceus_europaeus
Mono:479:SNORD113
GeneScaffold_568
SNORD113
1001..1062
2062
AAAAAAGCAGGTAATAAATGTGCCATCTGCAGACAGTAGTCTTAGGATAAAAGATAGTA
AAAGCTAGGGAATAACATCTCGAAAACTTTCTTGTTTTTTTCCTTTTAATATTATTATTT
GCCTATATAGTCAAGTGCTCTAGAATTAAACTGATACTACAGTGGAATTTCAAAAATAGG
TTAACCAAGGCTTGCTGCTTCTCAACAAGGAGTTCTGAAAAAAACTACCAACTATCAAAG
TTACTCATAATGTTAAAAAACAATCTGACTTTGATGTAATCTTAAAAAGCTGATAATGTA
GAACAACTTTTATTACAGAAAGAATTGATTTATAAATAAATATATTATTTTCACCTTAAG
AAAAATTCAGTGGGAAGTTACTATTATATTTACTTTAAAGATAAGGAAATTAAGGCTTGG
AAAGGTTAATAAACTTGCCCAGAATATTTACAAATTCCCTTAAGCAGCCCCAACTTGGTG
ACATATCTGCAGTCTTCAACCTGCGTATGTTTACCTTTGGGGATACCAGGAAGTACACCT
GGGATTGTCTTAAGAGAATTTCCATATCCACTTGTCTTCTTAACTAAAAATTATCTCTGA
GGACGGCCTGCCCATTCAGTAAGTTTTTTCACATCTTATCTCATGTGACAAAGGCATATG
CAACAAATCTTATCAATATAAAATATTACGTTTAAAAGATCATTTTCAAAAGAGTACAAA
TAGCAGGATACCTTTTATGAAATTAAAAACTAAGAATTTTTAATATCAATTTTTATGAGT
ACACATAGATGGCAACAAGAACAGGGAAAATGATCACCTCAGGTGGAAGAAGGCAGGAGT
AAGACTGTGGGAGGGTGGGTGGGGAGGGCATGACATGATTAAAAGAGGTCATTTTCAAGG
TTTTAGCTTTTATTTGGTAGGTTCATGGCTGCTTATTAACACTATTTAAAATAACTAACT
AAATTAACTGAAAGGAGAAAAAAAAAAAAAAGAGCCATGCATGGACCAATGATGAGTGAC
ACAAAGATTATGATTAAACCAAGTCTATGCACCTGAGGTCCAAAAACAAAACAAAGGCAT
ACCTCTTAGCCATCTTACTATGGTGCATTGCCTCAGCGTGTAAAAACCTCCTGGAGTAAC
AAACAAAGGGACAATTTGAAATATTGATATTGGGAAGTTTTCAGGCATTATAAACTTGCC
AAAGATCTCCATCTCTCCATCTCTCCCTTTCTCTCTCTCTCTCACTGTCTGAATTATATG
CTATGTGGCCTTAGTCTTTAGGCATGTTTCAAATCTAGATATGATGCATTACTACAGAGC
AGGGTAACTGGAATGACCTTATTTCTGCCATTCTGTAACATGCACACTCAACCAGGTGTG
CCACCACCTGGCTGGCCCCTATTTCTGCCGTTCTGAAGTTCAGGAAATGCATTACTCTGG
TGAGAAAAGCTCAGGGGAATAAAAGGGAAAATTCACTCAGAGCTTTTTTCCTTCCTATAA
TTTAAAGGTAAGAGATTTCTTACAGGTGAGCAGACTATGCTCTCAATTCTCATTTACAGG
ACAGATAATCAATACCCAACAAATGACTGAAACAGTTTAAGTTAGTGATGCTCACTCTTA
CATGTACCAGTAAATGTTTCCAGAATGATCACAAATTTATGTGTTTTTCCGAGGGCTCAA
ACACTTATTTATGGTGTATTTTTATTTTTTTTTAAAGATTTTATTTATTCATGAGAAATG
ATAGGAGAGAAAGAAAGAACTAGACATCACTCTGGTACATGTGCTGCCAGGGATTGAACT
CAGGGGGCCTCAGTCTTGAGAGTCCAATGCCTTATCCACTGCACCACCTCCTGGACCACT
CTGGTGTACTACTAAGTAACTTGACCAGTGTGCCTGAGTTTCCTTATCTTTAAAAGTGAG
ATTAACAATATAACCTATTTTGTGAGGTAGAGATAATATTCATTAATATATAAGTACTTG
GATAGCATATGTACGCGCACTTACTCTACAGGCACTATATCAATGCTATATGTCATTTAT
TAACACATAAGGTGGTAAAAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved