Erinaceus_europaeus Locus Mono:401:SNORA79
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:401:SNORA79
Erinaceus_europaeus
Mono:401:SNORA79
GeneScaffold_6360
SNORA79
1001..1144
2144
TTTATTTATTTTTCCTTATTTTTATTGTTGTTATAGTTATTATTGTCGTCTTTGTTAGT
TAGGACAGGGAGAAATGGAGAGAGGAAGGGAAGATGGGGGAGAGGAAGATAGACACTTGC
AGACTTGCTTCACCACCTGTGAAGCAGCGCCCCTGCAGGTGGGGAGCCAGGGGGCTCGAA
CCAGGATCCTTACGCCGTTCCTTGTGCTTTGCACCATGTGCACTTAACCCGCTGTGCTAC
AGCCCAACTCCCCCTTGAATGCCTAGTTTACAAGCGGAGAGAGTCAAGAGTAGTACCACT
CTGGCACACGTGATGCCAGTGAGAGAGTCAAGAGCACCACTCTGGCACACATGATCCAAC
TCATCTCTGAGCATCTAATGCCGTATTCACTATACCACTTCGCAGACTTAATTGAAAGCC
TTATATTCAGGTGTGTAGTAAGACTTTCTTTTGAGAAGGCTGCATAGTGGTGGTTTTCCA
CCTTTCTACGCAGGTTAGATCTGTAAAATTTTATTTACTAAGGGTTTTGTTATTTCATAT
ACTAAATTTGTATACTATTTTATGAAGAAAAGAAAAAAAAAGTCAGTAGTTATTTGCTCT
TTGTGGTCTTTCTGTGGAGGTTATTGAGTTGTACCCTCAACAAAGACTTTATGAAATAAC
CCTTAGCCATATTTCATAGGTCAGGTCAGCAAAGTCTGGGCCCTGAAAAAAGCTGATGAA
TTTATACATGCGATCACTATTTTTTGTTGTTATGACAAACATCTGTTTGTTATAAAACTA
CCCAGGCTATCGAGTTTTTCAAATCTTGCTATTGGACGGTGAAGATAAATGAAAAGATTA
TTTTAGGACAGCTATTCAGTTACCCTTTTGCCTCATTTGCCTGAGTTTATATAAGATAAA
GGTTCAGAAAGATTTATAGTTGAAATTAGTATTTGGATTATTTTATTGCTATATCAAATA
AGACTTAATCTTAACCTATACTTTTAAAATAATCTCTCTTTTGATGACTGTTCCTCCTCT
TGCCTTCAGGTCTGGCACTAGGATTTTAGGTCATCATAAATTAAAATTTGGTTTTCTTCA
CTCAGAGAATATTAGGATAATGGGATTATCTGTTTATTCTCTGATATTTGCGGAATCAAA
CATTTAGCTCCTTTTATACTTAGGGAACCTTGCTATTGTTTCCTCCTTTTCATAAAGGCA
TAGTAACGAGATTCTGGCAGCTGTCTATATCAGTTTGAAAAACCGAGCTCATTGTTTATG
GGTTAATAACTCATCCTAGTGATGATGATGATGATATGTCAATAAAATGGTGCTGCTAGC
AAGTCAAGATAAAATTCTGTACAAACATTTTCAGTTAAAGGATGTGCAGCAGATATGTAT
GTTAAAGTGTCTGGTATCTCACTGTTTTGTGTTCCCAAGTTCTCGTGTTTTTTAGGTGGC
GTTACTATTTTAAAAAATATTATATTGGTTTGTTAGCGATAGAAATTAAGAGAAATAGGA
GATAGACACCTGCAGCACTGCTTCACTCCTCGTGAAGCTTCCCTTTGCAGGTGGGGACTG
AGGGCTTGAACCTGCATCCTTGCGCAGAGTAAGGGGTGCGCAGCCAGGTGTCCTACAGCC
CAGCCCCCAGCGTTGTTCTTACCCTTTTAAAGATTGATTTTGATAGCCTACCAGTGTTGG
ATCACAGTTGCTGCTTGCTATAAAGATGTTGACATACAAAATAGCTGAGTGTATTTGAAT
GCAGAAAATATATAGCTGTTAATCTTAGGACCTTGTGTGTGTTCTCTCTCTTTTATTGAT
AGCTGCAGCACCACAAGTAATAGTTCCTGATTCTAAACTGATACAGCACATGAATGCATC
GAACATGGTAAGACTCAAAACATGACACTTAGCCTGGGCCCTACCTTTGGTTGCCCAGCT
TCTGATCGTTAGACATGTTGTATGATTAACAATTTCAGGTTTATTCAAGACTTGAGCAAA
AAAGACTCCTTTACACACACACACACACACTATATATATATATATATATTCTCCCTCCCC
CCCAGCAAACCTATAGGTCAGCTAGATACTTACTTTGAGGTTCACCAAATTATGCAGTTT
TCTGTTGAAAATATCAAGAATGCTGCTTTGTGAAAGCTATTTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved